Accessibility / Report Error

Wolbachia in guilds of Anastrepha fruit flies (Tephritidae) and parasitoid wasps (Braconidae)

Abstract

The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids.

Keywords
Bacteria; fruit flies; horizontal transmission; wsp gene; recombination

Introduction

The endosymbiotic bacteria Wolbachia (alphaproteobacteria; Rickettsiales) is an intracellular parasite. It has been associated with the manipulation of its host's reproduction by induction of several phenotypes, such as cytoplasmic incompatibility (CI) in several insect species, parthenogenesis in Hymenoptera, feminization of genetic males, and male killing in Coleoptera, Lepidoptera, Diptera and Pseudoscorpiones (Werren, 1997Werren JH (1997) Biology of Wolbachia. Annu Rev Entomol 42:587-609.; Bourtzis and O'Neill, 1998Bourtzis K and O'Neill SL (1998) Wolbachia infections and arthropod reproduction. BioSci 48:287-293.; Bourtzis et al., 2003Bourtzis K, Braig HR and Karr TL (2003) Cytoplasmic incompatibility. In: Bourtzis K and Miller TA (eds) Insect Symbiosis. CRC Press, Boca Raton, pp 217-246.; Werren et al., 2008Werren JH, Baldo L and Clark ME (2008) Wolbachia: Master manipulators of invertebrate biology. Nat Rev Microbiol 6:741-751.). However, the bacteria may be beneficial to their hosts by interfering positively in several fitness components of males and females. In such cases, the relationships between Wolbachia and their hosts evolved from a status of parasitism to mutualistic relationships (Werren et al., 2008Werren JH, Baldo L and Clark ME (2008) Wolbachia: Master manipulators of invertebrate biology. Nat Rev Microbiol 6:741-751.; Serbus et al., 2008Serbus LR, Casper-Lindley C, Landmann F and Sullivan W (2008) The genetics and cell biology of Wolbachia-host interactions. Annu Rev Genet 42:683-707.; Saridaki and Bourtzis, 2010Saridaki A and Bourtzis K (2010) Wolbachia: More than just a bug in insect genitals. Curr Opin Microbiol 13:67-72.). Previous data have indicated that species infection rates were variable but could account for the infection of 40 to 70% of arthropod species (Werren and Windsor, 2000Werren JH and Windsor DM (2000) Wolbachia infection frequencies in insects: Evidence of global equilibrium? Proc R Soc Lond B Biol Sci 267:1277-1285.; Jeyaprakash and Hoy, 2000Jeyaprakash A and Hoy MA (2000) Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species. Insect Mol Biol 9:393-405.; Hilgenboecker et al., 2008Hilgenboecker H, Hammerstein P, Schlattmann P, Telschow A and Werren JH (2008) How many species are infected with Wolbachia? A statistical analysis of current data. FEMS Microbiol Lett 281:215-220.; Zug and Hammerstein, 2012Zug R and Hammerstein P (2012) Still a host of hosts for Wolbachia: Analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One 7:e79825843.).

Wolbachia are found dispersed in various tissues of the hosts, and their presence in the female germ line assures a highly efficient maternal transmission (Werren, 1997Werren JH (1997) Biology of Wolbachia. Annu Rev Entomol 42:587-609.; Dobson et al., 1999Dobson SL, Bourtzis K, Braig HR, Jones BF, Zhou W, Rousset F and O'Neill SL (1999) Wolbachia infection are distributed throughout insect somatic and germ line tissues. Insect Biochem Mol Biol 29:153-160.). Although the infection is usually pervasive in populations, even if it started with few infected females, it was argued that vertical transmission alone does not explain the large distribution of the bacteria among arthropods. Moreover, phylogenies of Wolbachia are usually incongruent with phylogenies of their hosts. Hence, horizontal transmission was assumed as a possible mechanism promoting the spread of the bacteria among taxa of related organisms, as well as among those showing close relationships, like prey-predator, parasite-host, and parasitoid-hosts (O'Neill et al., 1992O'Neill SL, Giordano R, Colbert AME, Karr TL and Robertson HM (1992) 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc Natl Acad Sci U S A 89:2649-2702.; Werren et al., 1995Werren JH, Zhang W and Guo LR (1995) Evolution and phylogeny of Wolbachia: Reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261:55-71., 2008Werren JH, Baldo L and Clark ME (2008) Wolbachia: Master manipulators of invertebrate biology. Nat Rev Microbiol 6:741-751.; Vavre et al., 1999Vavre F, Fleury F, Lepetit D, Fouillet P and Boulétreau M (1999) Phylogenetic evidence for horizontal transmission of Wolbachia in host-parasitoid associations. Mol Biol Evol 16:1711-1723.; Noda et al., 2001Noda H, Miyoshi T, Zhang Q, Watanabe K, Deng H and Hoshizaki S (2001) Wolbachia infection shared among planthoppers (Homoptera: Delphacidae) and their endoparasites (Strepsiptera: Elenchidae): A probable case of interspecies transmission. Mol Ecol 10:2101-2106.; Dedeine et al., 2005Dedeine F, Ahrens M, Calcaterra L and Shoemaker DD (2005) Social parasitism in fire ants (Solenopsis spp.): A potential mechanism for interspecies transfer of Wolbachia. Mol Ecol 14:1543-1548.; Baldo et al., 2006aBaldo L, Borderstein S, Wernegreen JJ and Werren JH (2006a) Widespread recombination throughout Wolbachia genomes. Mol Biol Evol 23:437-449., 2008Werren JH, Baldo L and Clark ME (2008) Wolbachia: Master manipulators of invertebrate biology. Nat Rev Microbiol 6:741-751.; Stahlhut et al., 2010Stahlhut LK, Desjardins CA, Clark ME, Baldo L, Russell JA, Werren JH and Jaenike J (2010) The mushroom habitat as an ecological arena for global exchange of Wolbachia. Mol Ecol 19:1940-1952.; Pattabhiramaiah et al., 2011Pattabhiramaiah M, Brückner D and Reddy MS (2011) Horizontal transmission of Wolbachia in the honeybee subspecies Apis melifera carnica and its ectoparasite Varroa destructor. Int J Environ Sci 2:514-523.; Le Clec'h et al., 2013Le Clec'h, W, Chevalier FD, Genty L, Bertaux J, Bouchon D and Sicard M (2013) Cannibalism and predation as path for horizontal passage of Wolbachia between terrestrial isopods. PLoS One 8:e60232.). Other ways of horizontal transmission were found between species of herbivorous insects that acquire Wolbachia strains by ingesting tissues of the host plants contaminated with the bacteria (Kittayapong et al., 2003Kittayapong P, Jamnongluk W, Thipaksorn A, Milne JR and Sindhusake C (2003) Wolbachia infection complexity among insect in the tropical rice-field community. Mol Ecol 12:1049-1060.; Sintupachee et al., 2006Sintupachee S, Milne J, Poonchaisri S, Baimai V and Kyttayapong P (2006) Closely related Wolbachia strains within the pumpkin arthropod community and the potential for horizontal transmission via the plant. Microbiol Ecol 51:294-301.; Yang et al., 2013Yang X-H, Zhu D-H, Liu Z, Zhao L and Su C-Y (2013) High levels of multiple infections, recombination and horizontal transmission of Wolbachia in the Andricus mukaigawae (Hymenoptera; Cynipidae) communities. PLoS One 8:e78970.), or by contact of haemolymph through wounds in the host's bodies (Rigaud and Juchault, 1995Rigaud T and Juchault P (1995) Success and failure of horizontal transfers of feminizing Wolbachia endosymbionts in woodlice. J Evol Biol 8:249-255.). Horizontal transmission was also considered the route of infection by multiple Wolbachia strains, as is frequently observed in many species of Coleoptera, Diptera, Hymenoptera and Lepidoptera (Werren et al., 1995Werren JH, Zhang W and Guo LR (1995) Evolution and phylogeny of Wolbachia: Reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261:55-71.; Jamnongluk et al., 2002Jamnongluk W, Kittayapong P, Baimai V and O'Neill SL (2002) Wolbachia infections of tephritid fruit flies: Molecular evidence for five distinct strains in a single host species. Curr Microbiol 45:255-260.; Rokas et al., 2002Rokas A, Atkinson RJ, Nieves-Aldrey JL, West SA and Stone GN (2002) The incidence and diversity of Wolbachia in gallwasps (Hymenoptera; Cynipidae) on oak. Mol Ecol 11:1815-1829.; Reuter and Keller, 2003Reuter M and Keller L (2003) High level of multiple Wolbachia infection and recombination in the ant Formica exsecta. Mol Biol Evol 20:749-753.; Hiroki et al., 2004Hiroki M, Tagami Y, Miura K and Kato Y (2004) Multiple infection with Wolbachia inducing different reproductive manipulations in the butterfly Eurema hecabe. Proc R Soc Lond B Biol Sci 271:1751-1755.; Schuler et al., 2011Schuler H, Arthofer W, Riegler M, Berthau C, Krumböck S, Köppler K, Vogt H, Teixeira LAF and Stauffer C (2011) Multiple Wolbachia infections in Rhagoletis pomonella. Entomol Exp Appl 139:138-144.; Yang et al., 2012Yang C-Y, Xiao J-H, Niu L-M, Ma G-C, Cook JM, Bian S-N, Fu Y-G and Huang Da-Wei (2012) Chaos of Wolbachia sequences inside the compact fig syconia of Ficus benjamina (Ficus: Moraceae). PLoS One 7:e48882., 2013Yang X-H, Zhu D-H, Liu Z, Zhao L and Su C-Y (2013) High levels of multiple infections, recombination and horizontal transmission of Wolbachia in the Andricus mukaigawae (Hymenoptera; Cynipidae) communities. PLoS One 8:e78970.; Augustinos et al., 2014Augustinos AA, Asimakopoulou AK, Moraiti CA, Mavragani-Tsipidou P, Papadopoulos NT and Bourtzis K (2014) Microsatellite and Wolbachia analysis in Rhagoletis cerasi natural populations: Population structuring and multiple infections. Ecol Evol 4:1943-1962.).

Experimentally, natural transmission of bacteria was found between a non-infected parasitoid (Leptopilina boulardi) that acquired some Wolbachia strains after culture with its infected host (Drosophila simulans) (Heath et al., 1999Heath DB, Butcher RDJ, Whitfield WGF and Hubbard SF (1999) Horizontal transfer of Wolbachia between phylogenetically distant insect species by naturally occurring mechanism. Curr Biol 9:313-316.). Experimental transmission of Wolbachia from infected hosts to non-infected eggs by microinjection of egg cytoplasm was obtained, for example, between closely related host species, Drosophila simulans and D. melanogaster (Boyle et al., 1993Boyle L, O'Neill SL, Robertson HM and Karr TL (1993) Interspecific and intraspecific horizontal transfer of Wolbachia in Drosophila. Science 260:1796-1799.), between flies of different genera, Rhagoletis cerasi and Ceratitis capitata (Zabalou et al., 2004Zabalou S, Riegler M, Theodorakopoulou M, Stauffer C, Savakis C and Bourtzis K (2004) Wolbachia-induced cytoplasmic incompatibility as a means for insect pest population control. Proc Nat Acad Sci U S A 101:15042-15045.), and between species of different families, like Drosophila simulans and Aedes albopictus (Braig et al., 1994Braig HR, Guzman H, Tesh RB and O'Neill SL (1994) Replacement of the natural Wolbachia symbiont of Drosophila simulans with a mosquito counterpart. Nature 367:453-455.).

The large variability of Wolbachia strains, either in single or multiple infection cases, may also be due to the appearance of distinct haplotypes by recombination events. Putative recombinant haplotypes involving distinct Wolbachia strains were found to be widespread among insect species (Jiggins et al., 2001Jiggins FM, von Der Schulenburg JH, Hurst GD and Majerus ME (2001) Recombination confounds interpretations of Wolbachia evolution. Proc R Soc Lond B Biol Sci 268:1423-1427.; Werren and Bartos, 2001Werren JH and Bartos JD (2001) Recombination in Wolbachia. Curr Biol 11:431-435.; Reuter and Keller, 2003Reuter M and Keller L (2003) High level of multiple Wolbachia infection and recombination in the ant Formica exsecta. Mol Biol Evol 20:749-753.; Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418., 2006aBaldo L, Borderstein S, Wernegreen JJ and Werren JH (2006a) Widespread recombination throughout Wolbachia genomes. Mol Biol Evol 23:437-449.; Arthofer et al., 2009Arthofer W, Riegler M, Schneider D, Krammer M, Miller WJ and Stauffer C (2009) Hidden Wolbachia diversity in field populations of the European cherry fruit fly, Rhagoletis cerasi (Diptera, Tephritidae). Mol Ecol 18:3816-3830.; Yang et al., 2012Yang C-Y, Xiao J-H, Niu L-M, Ma G-C, Cook JM, Bian S-N, Fu Y-G and Huang Da-Wei (2012) Chaos of Wolbachia sequences inside the compact fig syconia of Ficus benjamina (Ficus: Moraceae). PLoS One 7:e48882., 2013Yang X-H, Zhu D-H, Liu Z, Zhao L and Su C-Y (2013) High levels of multiple infections, recombination and horizontal transmission of Wolbachia in the Andricus mukaigawae (Hymenoptera; Cynipidae) communities. PLoS One 8:e78970.). Intragenic recombination occurs frequently in the wsp gene of Wolbachia, infecting a large number of insect species (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418., 2006aBaldo L, Borderstein S, Wernegreen JJ and Werren JH (2006a) Widespread recombination throughout Wolbachia genomes. Mol Biol Evol 23:437-449.). This gene is highly variable and, for this reason, not reliable for phylogenetic inferences, but it is useful for identifying groups of closely related alleles (Baldo and Werren, 2007Baldo L and Werren JH (2007) Revisiting Wolbachia supergroup typing based on WSP: Spurious lineages and discordance with MLST. Curr Microbiol 55:81-87.). The high variability is not distributed evenly along the gene: there are four hypervariable regions (HVR) that are isolated from each other by conserved regions (CR) (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418.). The portions of the Wsp protein coded by the HVRs form loops outside the bacteria cell and are assumed to participate in establishing the relationships of the bacteria with their hosts. Actually, new Wsp proteins are due largely to mutation, but recombination seems to account for 50% of amino acid differences in recent diverged proteins (Baldo et al., 2010Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 10:e48.).

Among the frugivorous tephritid flies, Wolbachia was found to infect species of the genera Rhagoletis (Riegler and Stauffer, 2002Riegler M and Stauffer C (2002) Wolbachia infections and superinfections in cytoplasmically incompatible populations of the European cherry fruit fly Rhagoletis cerasi (Diptera, Tethritidae). Mol Ecol 11:2425-2434.; Schuler et al., 2009Schuler H, Arthofer W, Krumböck S, Köppler K, Vogt H, Teixeira LAF, Riegler M and Stauffer C (2009) The bacterial endosymbiont Wolbachia in the invasive cherry fruit fly Rhagoletis cingulata (Diptera, Tephritidae). Mitt Dtsch Ges Allg Angew Entomol 17:99-101., 2011Schuler H, Arthofer W, Riegler M, Berthau C, Krumböck S, Köppler K, Vogt H, Teixeira LAF and Stauffer C (2011) Multiple Wolbachia infections in Rhagoletis pomonella. Entomol Exp Appl 139:138-144., 2013Schuler H, Bertheau C, Egan SP, Feder JL, Riegler M, Schlick-Steiner BC, Steiner FM, Johannesen J, Kern P, Tuba K, et al. (2013) Evidence of a recent horizontal transmission and spatial spread of Wolbachia from endemic Rhagoletis cerasi (Diptera, Tephhritidae) to invasive Rhagoletis cingulate in Europe. Mol Ecol 22:4101-4111.; Arthofer et al., 2009Arthofer W, Riegler M, Schneider D, Krammer M, Miller WJ and Stauffer C (2009) Hidden Wolbachia diversity in field populations of the European cherry fruit fly, Rhagoletis cerasi (Diptera, Tephritidae). Mol Ecol 18:3816-3830.; Drosopoulou et al., 2011Drosopoulou E, Augustinos AA, Nakou I, Koepler K, Kounatidis I, Vogt H, Papadopoulos NT, Bourtzis K and Mavragani-Tsipidou P (2011) Genetic and cytogenetic analysis of the American cherry fruit fly, Rhagoletis cingulata (Diptera; Tephritidae). Genetica 139:1449-1464.; Augustinos et al., 2014Augustinos AA, Asimakopoulou AK, Moraiti CA, Mavragani-Tsipidou P, Papadopoulos NT and Bourtzis K (2014) Microsatellite and Wolbachia analysis in Rhagoletis cerasi natural populations: Population structuring and multiple infections. Ecol Evol 4:1943-1962.), Bactrocera (Kittayapong et al., 2000Kittayapong P, Milne JR, Tigvattananont S and Baimai V (2000) Distribution of the reproduction-modifying bacteria, Wolbachia, in natural populations of tephritid fruit flies in Thailand. Sci Asia 26:93-103.; Jamnongluk et al., 2002Jamnongluk W, Kittayapong P, Baimai V and O'Neill SL (2002) Wolbachia infections of tephritid fruit flies: Molecular evidence for five distinct strains in a single host species. Curr Microbiol 45:255-260.; Liu et al., 2006Liu R, Li ZH, Sun X, Shen ZR and Gao XW (2006) First discovery of Wolbachia infection of Bactrocera (Zeugodacus) tau (Walker) from China. Chinese Bull Entomol 43:368-370.; Sun et al., 2007Sun X, Cul L and Li Z (2007) Diversity and phylogeny of Wolbachia infecting Bactrocera dorsalis (Diptera, Tephritidae) populations from China. Mol Ecol Evol 36:1283-1289.; Morrow et al., 2014Morrow JL, Frommer M, Shearman DCA and Riegler M (2014) Tropical tephritid fruit fly community with high incidence of shared Wolbachia strains as platform for horizontal transmission of endosymbionts. Environ Microbiol 16:3622-3637., 2015Morrow JL, Frommer M, Royeer JE, Shearman DCA and Riegler M (2015) Wolbachia pseudogenes and low prevalence infections in tropical but not temperate Australian tephritid fruit flies: Manifestations of lateral gene transfer and endosymbiont spillover? BMC Evol Biol 15:e202.), Dacus (Kittayapong et al., 2000Kittayapong P, Milne JR, Tigvattananont S and Baimai V (2000) Distribution of the reproduction-modifying bacteria, Wolbachia, in natural populations of tephritid fruit flies in Thailand. Sci Asia 26:93-103.), Ceratitis (Rocha et al., 2005Rocha LS, Mascarenhas RO, Perondini ALP and Selivon D (2005) Occurrence of Wolbachia in Brazilian samples of Ceratitis capitata (Wiedemann) (Diptera, Tephritidae). Neotrop Entomol 32:527-529.), and Anastrepha (Werren et al., 1995Werren JH, Zhang W and Guo LR (1995) Evolution and phylogeny of Wolbachia: Reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261:55-71.; Selivon et al., 2002Selivon D, Perondini ALP, Ribeiro AF, Marino CL, Lima MMA and Coscrato VE (2002) Wolbachia endosymbionts in a species of the Anastrepha fraterculus complex (Diptera: Tephritidae). Invertebr Reprod Dev 42:121-127.; Coscrato, et al., 2009Coscrato VE, Braz ASK, Perondini ALP, Selivon D and Marino CL (2009) Wolbachia in Anastrepha fruit flies (Diptera, Tephritidae). Curr Microbiol 59:295-301.; Cáceres et al., 2009Cáceres C, Segura DF, Vera MT, Wornoayporn V, Cladera JL, Teal P, Sapountzis P, Bourtzis K, Zacharopoulou A and Robinson AS (2009) Incipient speciation revealed in Anastrepha fraterculus (Diptera: Tephritidae) by studies on mating compatibility, sex pheromones, hybridization, and cytology. Biol J Linn Soc 97:152-165.; Marcon et al., 2011Marcon HS, Domingues DS, Coscrato VE, Selivon D, Perondini ALP and Marino CL (2011) New mariner elements in Anastrepha species (Diptera, Tephritidae). Neotrop Entomol 40:568-570.; Martínez et al., 2012Martínez H, Toledo J, Liedo P and Mateos M (2012) Survey of heritable endosymbionts in southern Mexico populations of the fruit fly species Anastrepha striata and A. ludens. Curr Microbiol 65:711-718.). Like in other cases of Wolbachia infections, a non-congruence of the endosymbiont phylogenies and their hosts was also observed in fruit flies, suggesting the occurrence of horizontal transmission events (Jamnongluk et al., 2002Jamnongluk W, Kittayapong P, Baimai V and O'Neill SL (2002) Wolbachia infections of tephritid fruit flies: Molecular evidence for five distinct strains in a single host species. Curr Microbiol 45:255-260.; Sun et al., 2007Sun X, Cul L and Li Z (2007) Diversity and phylogeny of Wolbachia infecting Bactrocera dorsalis (Diptera, Tephritidae) populations from China. Mol Ecol Evol 36:1283-1289.; Coscrato et al., 2009Coscrato VE, Braz ASK, Perondini ALP, Selivon D and Marino CL (2009) Wolbachia in Anastrepha fruit flies (Diptera, Tephritidae). Curr Microbiol 59:295-301.). Another way of horizontal transfer of the bacteria among fruit flies would be through the common association of fruit flies with parasitoids, as suggested for species of Bactrocera and parasitoid wasps of the genus Fopius (Morrow et al., 2014Morrow JL, Frommer M, Shearman DCA and Riegler M (2014) Tropical tephritid fruit fly community with high incidence of shared Wolbachia strains as platform for horizontal transmission of endosymbionts. Environ Microbiol 16:3622-3637.).

Parasitoid wasps of the families Braconidae, Figitidae (Eucolinae) and Pteromalidae have a worldwide distribution (O'Neill et al., 1992O'Neill SL, Giordano R, Colbert AME, Karr TL and Robertson HM (1992) 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc Natl Acad Sci U S A 89:2649-2702.; Godfray, 1994Godfray HCJ (1994) Parasitoids. Behavioral and Evolutionary Ecology. Princeton University Press, Princeton, 488 p.), and in the Brazilian territory they are largely dispersed, using as hosts several insect species including Anastrepha (Canal and Zucchi, 2000Canal NA and Zucchi RA (2000) Parasitóides - Braconidae. In: Malavasi A and Zucchi RA (eds) Moscas-das-Frutas de Importancia Econômica no Brasil: Conhecimento Básico e Aplicado. Holos Editora, Ribeirão Preto, pp 119-126.). Although the Braconidae encompass the largest number of species that use fruit flies as hosts (Leonel Jr et al., 1995Leonel Jr FL, Zuchi RA and Wharton RA (1995) Distribution and tephritidae hosts (Diptera) of braconid parasitoids (Hymenoptera) in Brazil. Int J Pest Manag 41:199-206.; Ovruski et al., 2000Ovruski SM, Aluja M, Sivinski J and Wharton RA (2000) Hymenopteran parasitoids on fruit-infesting Tephritidae (Diptera) in Latin America and the southern United States: Diversity, distribution, taxonomic status and their use in fruit fly biological control. Integ Pest Manag Rev 5:81-107.; Marinho et al., 2009Marinho CF, Souza-Filho MF, Raga A and Zucchi RA (2009) Parasitóides (Hymenoptera: Braconidae) de moscas-das-frutas (Diptera: Tephritidae) no Estado de São Paulo: Plantas associadas e parasitismo. Neotrop Entomol 38:321-326.), no studies about Wolbachia infection in these fruit fly-parasitoid communities were found. The present report describes the results of an analysis of Wolbachia infection involving communities of eight species of Anastrepha and six species of braconid wasps derived from these fly hosts. The data show: (a) a very large species infection rate in both insect groups, (b) that several species of wasps share identical Wolbachia wsp alleles with distinct species of their Anastrepha hosts, and (c) signatures of recombination between wsp alleles. The data indicate that horizontal transmission of the wsp gene may have occurred in guilds of fruit fly-parasitoids.

Materials and Methods

Collection of infested fruits

The species of fruit flies and the associated braconid parasitoids used in the present study derived from infested fruits collected in several locations in Brazil (Table 1 and Figure S1). The localities of collection were chosen in order to collect fruits known, in most cases, to host single species of Anastrepha. For example, after several collections only Anastrepha obliqua was recovered from starfruit from the city of Indaiatuba. The fruits brought to the laboratory were divided into small groups, which were kept under standard conditions until emergence of adult flies. The emerged adult females of both fruit flies and parasitoids were fixed in 100% ethanol and stored at −20 °C. Identification of fruit flies and braconid wasp species was made according to established criteria (Canal and Zucchi, 2000Canal NA and Zucchi RA (2000) Parasitóides - Braconidae. In: Malavasi A and Zucchi RA (eds) Moscas-das-Frutas de Importancia Econômica no Brasil: Conhecimento Básico e Aplicado. Holos Editora, Ribeirão Preto, pp 119-126.; Zucchi, 2007Zucchi RA (2007) Diversidad, distribución y hospedeiros del género Anastrepha in Brasil. In: Hernández-Orttiz V (ed) Moscas de la Fruta en Latinoamérica (Diptera, Tephritidae): Diversidad, Biologia y Manejo. SyG Editores, Mexico City, pp 77-100.; Selivon et al., 2004Selivon D, Vetros C, Fontes L and Perondini ALP (2004) New variant forms in the Anastrepha fraterculus complex (Diptera: Tephritidae). Proceedings of the 6th International Symposium on Fruit Flies of Economic Importance, Isteg Scientific Publ., Irene, pp 253-258., 2005Selivon D, Perondini ALP and Morgante JS (2005) A genetic-morphological characterization of two cryptic species of the Anastrepha fraterculus complex (Diptera: Tephritidae). Ann Entomol Soc Am 98:367-381.).

Table 1
Collection sites host fruits and recovered species of Anastrepha and of associated braconid wasps.

DNA extraction and amplification

DNA was extracted from abdomens of females (Jowett, 1986Jowett T (1986) Preparation of nucleic acids. In: Roberts DB (ed) Drosophila: A Practical Approach. IRL Press, Oxford, pp 275-286.). For the fruit flies, abdomens from three to seven flies were individually analyzed per species and sample. For the braconids, three to four abdomens were pooled for each extraction, and three to nine extractions were made for samples of each species. Amplification was done using primers for the Wolbachia wsp gene (Zhou et al., 1998Zhou W, Rousset F and O'Neill S (1998) Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc R Soc Lond B-Biol Sci 265:509-515.), wsp 81F (5TGGTCCAATAGTGATGAAGAAAC3) and wsp 691R (5AAAAATTAAACGCTACTCCA3). The PCR reaction consisted of a 3 μL of the extracted DNA of each sample, 2 μL of 10 buffer (Invitrogen), 1.0 μL of MgCl2 (50 mM), 1.0 μL of nucleotide mix (5 mM each), 0.5 μL of forward and reverse primers (20 μM each), 1 U of Taq DNA polymerase (Invitrogen), and distilled deionized water to a final volume of 20 μL. The amplification cycle was as follows: one cycle (2 min at 95 °C), 35 cycles (1 min at 95 ° C, 1 min at 55 ° C, two2 min at 75 °C), and an extension of 5 min at 72 ° C (Werren et al., 1995Werren JH, Zhang W and Guo LR (1995) Evolution and phylogeny of Wolbachia: Reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261:55-71.). For electrophoresis, 5 μL of each PCR product were run on a 0.8% gel to determine the presence and size of the amplified DNA fragments. About 15% of the PCR products were electrophoresed in 0.8% agarose gel (Gibco) in horizontal system and TAE 1X buffer (40 mM Tris-acetate; 1 mM EDTA, pH 8.0) at 86 V. The samples were mixed with 0.015% bromophenol blue, 0.015% of xylene cyanol and 30% of glycerol (20% in buffer). The DNA fragments were visualized after staining with 5 μg/mL ethidium bromide in a UV transilluminator. Samples of Wolbachia-infected Ceratitis capitata (Rocha et al., 2005Rocha LS, Mascarenhas RO, Perondini ALP and Selivon D (2005) Occurrence of Wolbachia in Brazilian samples of Ceratitis capitata (Wiedemann) (Diptera, Tephritidae). Neotrop Entomol 32:527-529.) were used as a positive control for the PCR assays. In case of a negative amplification, the sample DNA was tested for amplification of the 28S rDNA using the universal arthropod primers, and samples that were negative were discarded only after changing the DNA concentrations and PCR conditions (Werren et al., 1995Werren JH, Zhang W and Guo LR (1995) Evolution and phylogeny of Wolbachia: Reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261:55-71.). In case of negative results, new DNA extractions from individuals of that sample were made and the procedure repeated as described above.

Sequencing and cloning

Fragments of the expected size (~650 bp) were excised from the agarose gels using a purification kit (MagSep Tissue gDNA, Eppendorf) according to the manufacturer's instructions, and these were then sequenced using the BigDye reaction kit (Applied Biosystems) in an ABI-377 Prism automatic sequencer (Applied Biosystems). Sequence reactions were repeated until at least two replicates of the extremities of each sequence were obtained. The electropherograms were examined by the web tool Electropherogram Quality Analysis (Togawa and Brigido, 2003Togawa RC and Brigido MM (2003) PHPH: Web based tool for simple electropherogram quality analysis. 1st International Conference on Bioinformatics and Computational Biology, Ribeirão Preto, Brazil, http://asparagin.cenargen.embrapa.br/phph/ribeirao_preto_poster.pdf.
http://asparagin.cenargen.embrapa.br/php...
). Beside these analyses, sequences without signals of PCR artifacts were considered free of errors if they were found in more than two individuals in a given sample, and for unique sequences if their amino acid conceptual translation was achieved without interruptions (Yang et al., 2012Yang C-Y, Xiao J-H, Niu L-M, Ma G-C, Cook JM, Bian S-N, Fu Y-G and Huang Da-Wei (2012) Chaos of Wolbachia sequences inside the compact fig syconia of Ficus benjamina (Ficus: Moraceae). PLoS One 7:e48882.). For sequences with evidence of two distinct nucleotides in any given peak in the electropherogram, the amplified fragments were cloned in Top 10 E. coli bacteria using the Topo Cloning kit (Invitrogen). Bacteria were grown in 3 mL of LB culture medium containing 100 μg/mL of Carbemicillin, and incubated overnight at 37 ° C under rotation at 200 rpm. From the cultures, 1.5 mL was transferred to a polypropylene tube, and centrifuged at 20,800 g for 1 min at room temperature. The pellet was suspended in 100 mL of GTE (20 mM Tris, 50 mM glucose, 10 mM EDTA, pH 8.0) to which 200 μL of 0.2 N NaOH, 1% SDS was added and homogenized by inversion. After addition of 150 μL of 3 M sodium acetate (pH 4.8), centrifugation at 20,800 g for 6 min, the upper layer was transferred to another tube, pure ethanol was added to a 1.5 mL final volume and the tube shacken vigorously. After centrifugation, the pellet was washed with 70% ethanol, dried at 37 °C, and suspended in 50 μL of TE buffer containing 20 μg/mL of RNase A (Sigma). Ten clones of each sample were sequenced using the primers included in the cloning kit. The sequences are available at the Wolbachia WSP database and may be assessed by their allele codes.

Sequence analysis

The sequences were aligned using the Clustal Omega program (Sievers et al., 2011Sievers F, Wilm A, Dineen DG, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, et al. (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539.). Identification of haplotypes was made by the DnaSP 5.10 software (Librado and Rozas, 2009Librado P and Rozas J (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism. Bioinformatics 25:1451-1452.), and the distance matrices between sequences of the wsp gene were generated in MEGA 6 software (Tamura et al., 2013Tamura K, Stecher G, Peterson D, Filipski A and Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30:2725-2729.). The sequences were submitted to the WSP Typing methodology to determine the existing WSP alleles. This is based on the independent variability of the four hypervariable regions and half of each conserved region (HVR+). The alleles are defined by four numerical codes and each identifies one of the HVR+ regions (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418.). The HVR profiles were compared to sequences in the Wolbachia WSP database and those that had no matches were submitted to the Wolbachia database curators for inclusion as new alleles. Occurrence of wsp alleles in Wolbachia found in fruit flies and in wasp species was assessed by a chi-square test in a contingency table. Alleles found in low frequency (n < 2) could not be included in these tests (Stahlhut et al., 2010Stahlhut LK, Desjardins CA, Clark ME, Baldo L, Russell JA, Werren JH and Jaenike J (2010) The mushroom habitat as an ecological arena for global exchange of Wolbachia. Mol Ecol 19:1940-1952.). Search for signatures of recombination was made by comparison among the HVR amino acid motifs (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418.) and by three statistical methods: Maxchi (Maynard Smith, 1992Maynard Smith J (1992) Analyzing the mosaic structure of genes. J Mol Evol 34:126-129.), Geneconv (Posada and Crandall, 2001Posada D and Crandall KA (2001) Evaluation of methods for detecting recombination from DNA sequences: Computer simulations. Proc Natl Acad Sci U S A 98:13757-13762.) and Chimaera (Padidam et al., 1999Padidam M, Sawyer S and Fauquet CM (1999) Possible emergence of new geminiviruses by frequent recombination. Virology 265:218-225.), implemented in the RDP3.10 software (Heath et al., 2006Heath L, van der Walt E, Varsani A and Martin DP (2006) Recombination patterns in aphthoviruses mirror those found in other picornaviruses. J Virol 80:11827-11832.). In these tests, parameters previously used in analyses of other insects were employed (Baldo et al., 2006bBaldo L, Dunning Hotopp JC, Jolley KA, Borderstein SR, Biber SA, Choudhury RR, Hayashi C, Maiden MCJ, Tettelin H and Werren J (2006b) Multilocus sequence typing system for the endosymbiont Wolbachia pipientis. Appl Environ Microbiol 72:7098-7110.).

Results and Discussion

Recovered species of fruit flies and wasps

From the 11 samples of infested fruits, eight species of Anastrepha were recovered: A. amita, A. macrura, A. montei, A. obliqua, A. pickeli, A. serpentina, A. sp.1 aff. fraterculus and A. sp.2 aff. fraterculus (Table 1). Among the braconid wasps, six species were recovered: Doryctobracon areolatus, Doryctobracon brasiliensis, Doryctobracon fluminensis, Opius bellus, Utetes anastrephae, and Asobara anastrephae (Table 1). Table 1 also shows the associations of the six wasp species with their Anastrepha hosts. The species of braconid wasps that were recovered confirm previous observations that they are commonly dispersed in southeastern Brazil (Canal and Zucchi, 2000Canal NA and Zucchi RA (2000) Parasitóides - Braconidae. In: Malavasi A and Zucchi RA (eds) Moscas-das-Frutas de Importancia Econômica no Brasil: Conhecimento Básico e Aplicado. Holos Editora, Ribeirão Preto, pp 119-126.; Marinho et al., 2009Marinho CF, Souza-Filho MF, Raga A and Zucchi RA (2009) Parasitóides (Hymenoptera: Braconidae) de moscas-das-frutas (Diptera: Tephritidae) no Estado de São Paulo: Plantas associadas e parasitismo. Neotrop Entomol 38:321-326.). An Anastrepha species not usually found in southern regions (Anastrepha macrura) was collected in a sample from the northeastern city of Natal (Zucchi, 2007Zucchi RA (2007) Diversidad, distribución y hospedeiros del género Anastrepha in Brasil. In: Hernández-Orttiz V (ed) Moscas de la Fruta en Latinoamérica (Diptera, Tephritidae): Diversidad, Biologia y Manejo. SyG Editores, Mexico City, pp 77-100.).

Detection and characterization of Wolbachia wsp alleles

Out of 62 females of eight species of Anastrepha individually screened for Wolbachia, 58 turned out to be infected. The sample of A. serpentina was the only uninfected one. One hundred and twenty-four out of 140 samples of the six species of braconid wasps, each composed of pooled individuals, were positive for Wolbachia, while two samples of Asobara anastrephae and one sample of O. bellus were not infected. However, a sample of A. serpentina from southeastern Brazil was previously found to host a strain of Wolbachia (Coscrato et al., 2009Coscrato VE, Braz ASK, Perondini ALP, Selivon D and Marino CL (2009) Wolbachia in Anastrepha fruit flies (Diptera, Tephritidae). Curr Microbiol 59:295-301.). The only other case of Wolbachia-free Anastrepha was found in samples of A. ludens from Mexico (Martínez et al., 2012Martínez H, Toledo J, Liedo P and Mateos M (2012) Survey of heritable endosymbionts in southern Mexico populations of the fruit fly species Anastrepha striata and A. ludens. Curr Microbiol 65:711-718.). From the Anastrepha species screened so far, 14 out of 15 (93.3%) were infected by Wolbachia (Werren et al., 1995Werren JH, Zhang W and Guo LR (1995) Evolution and phylogeny of Wolbachia: Reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261:55-71.; Selivon et al., 2002Selivon D, Perondini ALP, Ribeiro AF, Marino CL, Lima MMA and Coscrato VE (2002) Wolbachia endosymbionts in a species of the Anastrepha fraterculus complex (Diptera: Tephritidae). Invertebr Reprod Dev 42:121-127.; Coscrato et al., 2009Coscrato VE, Braz ASK, Perondini ALP, Selivon D and Marino CL (2009) Wolbachia in Anastrepha fruit flies (Diptera, Tephritidae). Curr Microbiol 59:295-301.; Cáceres et al., 2009Cáceres C, Segura DF, Vera MT, Wornoayporn V, Cladera JL, Teal P, Sapountzis P, Bourtzis K, Zacharopoulou A and Robinson AS (2009) Incipient speciation revealed in Anastrepha fraterculus (Diptera: Tephritidae) by studies on mating compatibility, sex pheromones, hybridization, and cytology. Biol J Linn Soc 97:152-165.; Martínez et al., 2012Martínez H, Toledo J, Liedo P and Mateos M (2012) Survey of heritable endosymbionts in southern Mexico populations of the fruit fly species Anastrepha striata and A. ludens. Curr Microbiol 65:711-718.). This is a very high infection rate even among tephritid flies since, for example, in Bactrocera from Thailand Wolbachia infection occurred in 28.3% of the species (Kittayapong et al., 2000Kittayapong P, Milne JR, Tigvattananont S and Baimai V (2000) Distribution of the reproduction-modifying bacteria, Wolbachia, in natural populations of tephritid fruit flies in Thailand. Sci Asia 26:93-103.) and in 37% of species of fruit flies, including Bactrocera from Australia (Morrow et al., 2015Morrow JL, Frommer M, Royeer JE, Shearman DCA and Riegler M (2015) Wolbachia pseudogenes and low prevalence infections in tropical but not temperate Australian tephritid fruit flies: Manifestations of lateral gene transfer and endosymbiont spillover? BMC Evol Biol 15:e202.). Amongst the braconids, five out of six (83.3%) species were infected by the endosymbiont, a rate similar to the 84% (14 out of 17 species) found in fig wasps from China (Yang et al., 2012Yang C-Y, Xiao J-H, Niu L-M, Ma G-C, Cook JM, Bian S-N, Fu Y-G and Huang Da-Wei (2012) Chaos of Wolbachia sequences inside the compact fig syconia of Ficus benjamina (Ficus: Moraceae). PLoS One 7:e48882.). Thus, the species infection rate found in Anastrepha and in the parasitoid wasps are among the highest found in insect species which span from 40 to 76% (Werren and Windsor, 2000Werren JH and Windsor DM (2000) Wolbachia infection frequencies in insects: Evidence of global equilibrium? Proc R Soc Lond B Biol Sci 267:1277-1285.; Jeyaprakash and Hoy, 2000Jeyaprakash A and Hoy MA (2000) Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species. Insect Mol Biol 9:393-405.; Hilgenboecker et al., 2008Hilgenboecker H, Hammerstein P, Schlattmann P, Telschow A and Werren JH (2008) How many species are infected with Wolbachia? A statistical analysis of current data. FEMS Microbiol Lett 281:215-220.; Zug and Hammerstein, 2012Zug R and Hammerstein P (2012) Still a host of hosts for Wolbachia: Analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One 7:e79825843.).

In every species and samples of fruit flies and wasps, local alignment (BLASTN) of the sequences to the WSP database showed that the amplified fragments were from the wsp gene of supergroup A Wolbachia. Species of the Bactrocera and Rhagoletis fruit flies harbor Wolbachia strains of groups A and B (Jamnongluk et al., 2002Jamnongluk W, Kittayapong P, Baimai V and O'Neill SL (2002) Wolbachia infections of tephritid fruit flies: Molecular evidence for five distinct strains in a single host species. Curr Microbiol 45:255-260.; Sun et al., 2007Sun X, Cul L and Li Z (2007) Diversity and phylogeny of Wolbachia infecting Bactrocera dorsalis (Diptera, Tephritidae) populations from China. Mol Ecol Evol 36:1283-1289.; Arthofer et al., 2011Arthofer W, Riegler M, Schuler H, Schneider D, Moder K, Miller WJ and Stauffer C (2011) Allele intersection analysis: A novel tool for multi locus sequence assignment in multiply infected hosts. PLoS One 6:e22198.), but in Anastrepha, group B was so far found only in A. striata from Mexico (Martínez et al., 2012Martínez H, Toledo J, Liedo P and Mateos M (2012) Survey of heritable endosymbionts in southern Mexico populations of the fruit fly species Anastrepha striata and A. ludens. Curr Microbiol 65:711-718.), and in a sample of unknown origin of nominal A. fraterculus (Cáceres et al., 2009Cáceres C, Segura DF, Vera MT, Wornoayporn V, Cladera JL, Teal P, Sapountzis P, Bourtzis K, Zacharopoulou A and Robinson AS (2009) Incipient speciation revealed in Anastrepha fraterculus (Diptera: Tephritidae) by studies on mating compatibility, sex pheromones, hybridization, and cytology. Biol J Linn Soc 97:152-165.). In line with previous data, infection by Wolbachia supergroup A is prevalent among distinct host insects, including the Diptera and Hymenoptera (Werren et al., 1995Werren JH, Zhang W and Guo LR (1995) Evolution and phylogeny of Wolbachia: Reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261:55-71.; Stahlhut et al., 2010Stahlhut LK, Desjardins CA, Clark ME, Baldo L, Russell JA, Werren JH and Jaenike J (2010) The mushroom habitat as an ecological arena for global exchange of Wolbachia. Mol Ecol 19:1940-1952.; Baldo et al., 2010Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 10:e48.).

Among the entire set of nucleotide sequences, regardless of whether they were from the fruit flies or the braconids, DnaSP detected 22 wsp nucleotide haplotypes. Assuming that the distinctiveness of Wolbachia haplotypes is recognized just for those differing in more than 1.5% (Zhou et al., 1998Zhou W, Rousset F and O'Neill S (1998) Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc R Soc Lond B-Biol Sci 265:509-515.; Zabalou et al., 2004Zabalou S, Riegler M, Theodorakopoulou M, Stauffer C, Savakis C and Bourtzis K (2004) Wolbachia-induced cytoplasmic incompatibility as a means for insect pest population control. Proc Nat Acad Sci U S A 101:15042-15045.; Sintupachee et al., 2006Sintupachee S, Milne J, Poonchaisri S, Baimai V and Kyttayapong P (2006) Closely related Wolbachia strains within the pumpkin arthropod community and the potential for horizontal transmission via the plant. Microbiol Ecol 51:294-301.), the 22 haplotypes formed eight groups, named as w1, w2, w3, w4, w5, w6, w7 and w8. The intragroup distance varied from 0.002 (w8) to 0.007 (w1), and the intergroup distances varied from 0.022 (w4/w7) to 0.258 (w1/w7) (Table S1). The sequences were further analyzed by the WSP Typing methodology (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418.) that, based on the four HVR peptides, detected eight wsp alleles of Wolbachia infecting the guilds of fruit flies and braconid wasps (Table 2). These wsp alleles correspond to the eight haplotypes determined by the nucleotide sequences: wsp-75 (w8), wsp-23 (w3), wsp-156 (w1), wsp-680 (w2), wsp-681(w4), wsp-682 (w5), wsp-683 (w6) and wsp-684 (w7). Three WSP alleles, wsp-23, wsp-75 and wsp-156, were found in the WSP database and occur in Wolbachia infecting a variety of insect species (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418., 2010Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 10:e48.). The other five alleles, wsp-680, wsp-681, wsp-682, wsp-683 and wsp-684, are novel wsp alleles detected in the present analysis.

Table 2
Wsp HVR profiles of Wolbachia infecting Anastrepha and parasitoid braconid wasps.

The present data show that the number of different wsp alleles of Wolbachia infecting Anastrepha species is higher than found in a previous screening based on nucleotide haplotypes of 10 species, in which the sequences were very similar to wMel (Coscrato et al., 2009Coscrato VE, Braz ASK, Perondini ALP, Selivon D and Marino CL (2009) Wolbachia in Anastrepha fruit flies (Diptera, Tephritidae). Curr Microbiol 59:295-301.). The high rate of species infection can be explained by assuming that the fruit flies and parasitoid wasps may be highly prone to infection by the bacteria, and may be favored by the combination of their habitats and life strategies, allowing horizontal transmissions, in line with observations in other insect species (Werren et al., 2008Werren JH, Baldo L and Clark ME (2008) Wolbachia: Master manipulators of invertebrate biology. Nat Rev Microbiol 6:741-751.; Stahlhut et al., 2010Stahlhut LK, Desjardins CA, Clark ME, Baldo L, Russell JA, Werren JH and Jaenike J (2010) The mushroom habitat as an ecological arena for global exchange of Wolbachia. Mol Ecol 19:1940-1952.). These facts may also be a possible explanation for infection by multiple Wolbachia strains found in many hosts insects (Werren et al., 1995Werren JH, Zhang W and Guo LR (1995) Evolution and phylogeny of Wolbachia: Reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261:55-71.; Rokas et al., 2002Rokas A, Atkinson RJ, Nieves-Aldrey JL, West SA and Stone GN (2002) The incidence and diversity of Wolbachia in gallwasps (Hymenoptera; Cynipidae) on oak. Mol Ecol 11:1815-1829.; Kittayapong et al., 2003Kittayapong P, Jamnongluk W, Thipaksorn A, Milne JR and Sindhusake C (2003) Wolbachia infection complexity among insect in the tropical rice-field community. Mol Ecol 12:1049-1060.; Reuter and Keller, 2003Reuter M and Keller L (2003) High level of multiple Wolbachia infection and recombination in the ant Formica exsecta. Mol Biol Evol 20:749-753.; Hiroki et al., 2004Hiroki M, Tagami Y, Miura K and Kato Y (2004) Multiple infection with Wolbachia inducing different reproductive manipulations in the butterfly Eurema hecabe. Proc R Soc Lond B Biol Sci 271:1751-1755.; Yang et al., 2013Yang X-H, Zhu D-H, Liu Z, Zhao L and Su C-Y (2013) High levels of multiple infections, recombination and horizontal transmission of Wolbachia in the Andricus mukaigawae (Hymenoptera; Cynipidae) communities. PLoS One 8:e78970.).

Wsp alleles in fruit flies and parasitoid wasps

Table 3 summarizes the Wolbachia harboring distinct wsp alleles found in each species and sample of Anastrepha, as well as in the braconids that emerged from the puparia of the sampled host fruit flies. The present analysis showed that most Anastrepha species were infected by a single Wolbachia strain, but a double infection (sample from Indaiatuba) and a multiple infection (sample from Caçapava) were found in A. obliqua. Similarly, two Wolbachia bearing distinct alleles were found only in a sample (from São Paulo) of the parasitoid D. brasiliensis, while a single infection was found in the other five wasp species. The data in Table 4 show significant differences (X2 = 33.13, d.f. = 2, P < 0.001) in the distribution of Wolbachia harboring distinct wsp alleles between the fruit flies and the wasps. Wolbachia wsp-23 was more frequent in flies (76.3%) than in wasps, while Wolbachia wsp-156 and Wolbachia wsp-680 were more frequent in wasps than in the fruit flies hosts (80.9% and 94.1%, respectively). In the majority of cases, Wolbachia infecting the fruit flies were distinct from those detected in the braconid wasps with respect to the wsp alleles. However, in some samples, Wolbachia infecting the fruit flies had an identical wsp allele as the bacteria infecting the parasitoid wasps. Table 5 shows the congruence involving Wolbachia bearing allele wsp-23 or allele wsp-156 between fruit flies and wasps. The striking cases seem to be those of Wolbachia wsp-156 found in D. fluminensis derived from two species of fruit flies, and of Wolbachia wsp-23 that was found in Utetes anastrephae derived from four species of Anastrepha. These data indicate that horizontal transmission might have occurred in the communities of fruit flies and braconid wasps, similarly to what was assumed in guilds of other insects with their parasitoid wasps (Vavre et al., 1999Vavre F, Fleury F, Lepetit D, Fouillet P and Boulétreau M (1999) Phylogenetic evidence for horizontal transmission of Wolbachia in host-parasitoid associations. Mol Biol Evol 16:1711-1723.; Yang et al., 2012Yang C-Y, Xiao J-H, Niu L-M, Ma G-C, Cook JM, Bian S-N, Fu Y-G and Huang Da-Wei (2012) Chaos of Wolbachia sequences inside the compact fig syconia of Ficus benjamina (Ficus: Moraceae). PLoS One 7:e48882.; Yang et al., 2013Yang X-H, Zhu D-H, Liu Z, Zhao L and Su C-Y (2013) High levels of multiple infections, recombination and horizontal transmission of Wolbachia in the Andricus mukaigawae (Hymenoptera; Cynipidae) communities. PLoS One 8:e78970.; Morrow et al., 2014Morrow JL, Frommer M, Shearman DCA and Riegler M (2014) Tropical tephritid fruit fly community with high incidence of shared Wolbachia strains as platform for horizontal transmission of endosymbionts. Environ Microbiol 16:3622-3637.).

Table 3
Wolbachia alleles* * In bold, congruence of Wolbachia alleles in fruit flies and associated wasps in species of Anastrepha associated with braconid parasitoids, localities of collection and number of samples (N) screened for Wolbachia.
Table 4
Distribution of Wolbachia bearing distinct alleles in the fruit flies and wasps.
Table 5
Congruence of Wolbachia infecting species of braconid wasps and their Anastrepha host species.

Recombination between wsp alleles

The presence of two or more wsp sequences in single individuals offers an opportunity for the appearance of new haplotypes through events of recombination, which consequently contributes to the increase in the number of Wolbachia variants. Recombination between Wolbachia sequences is widespread among insects, and the recombinant haplotypes are assumed to be functional (Reuter and Keller, 2003Reuter M and Keller L (2003) High level of multiple Wolbachia infection and recombination in the ant Formica exsecta. Mol Biol Evol 20:749-753.; Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418., 2006aBaldo L, Borderstein S, Wernegreen JJ and Werren JH (2006a) Widespread recombination throughout Wolbachia genomes. Mol Biol Evol 23:437-449.,bBaldo L, Dunning Hotopp JC, Jolley KA, Borderstein SR, Biber SA, Choudhury RR, Hayashi C, Maiden MCJ, Tettelin H and Werren J (2006b) Multilocus sequence typing system for the endosymbiont Wolbachia pipientis. Appl Environ Microbiol 72:7098-7110., 2010Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 10:e48.; Baldo and Werren, 2007Baldo L and Werren JH (2007) Revisiting Wolbachia supergroup typing based on WSP: Spurious lineages and discordance with MLST. Curr Microbiol 55:81-87.). Those involving the wsp gene seem to produce novel phenotypes that could create new possibilities for the bacteria to explore new hosts (Werren et al., 2008Werren JH, Baldo L and Clark ME (2008) Wolbachia: Master manipulators of invertebrate biology. Nat Rev Microbiol 6:741-751.; Baldo et al., 2010Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 10:e48.).

In the present study, a search for recombination signatures within the communities of fruit flies-parasitoids was made by analysis of the four HVR amino acid motifs according to Baldo et al. (2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418.). For these analyses, besides the three alleles previously known, wsp-23, wsp-75 and wsp-156, the WSP database was searched for wsp alleles that would have sequences partially similar to the novel five alleles herein detected. Three Wolbachia alleles with high similarity were found: wsp-31 from Wolbachia infecting Drosophila melanogaster host, and two from ant species hosts, wsp-273 from Formica truncorum and wsp-313 from Formica exsecta hosts. Since wsp-23 is considered an ancestral Wolbachia wsp allele (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418., 2010Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 10:e48.), its amino acid sequence was taken as reference for the present analysis (Figure 1). The previous known alleles, wsp-75 and wsp-156, differed from wsp-23 in their four HVRs (Table 2). As known, wsp-31 from Wolbachia wMel is considered a recombinant sequence differing from wsp-23 in HVR4 (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418.). The novel wsp-680 has its four HVRs distinct from those of wsp-23. Signals of HVR shuffling were found for the other four new alleles: (a) wsp-681 might be a recombinant allele since it has HVR1 and HVR2 identical to those of wsp-23, but HVR3 and HVR4 identical to the corresponding ones in wsp-680 and wsp-682; (b) wsp-683 and wsp-684 would be recombinants involving distinct HVRs between wsp-23 and wsp-680. The alleles wsp-75 and wsp-156 seem to be involved in recombination with alleles wsp-273 and wsp-313, both from ant species.

Figure 1
Amino acid motifs of the hypervariable regions (HVRs) of Wolbachia wsp alleles infecting species of Anastrepha and associated parasitoid braconid wasps. The sequences were aligned relative to the wsp-23 allele. The intervening conserved regions (CR) were omitted from the sequences. The HVR motifs were grouped according to similarity of polymorphism and taking HVR1 as the reference for grouping. Each wsp allele has a unique combination of HVRs indicated by colors, which are interpreted as the result of HVR shuffling.

Moreover, signatures of recombination were tested by three statistical methods, Maxchi, Geneconv and Chimaera, and only the putative events concomitantly disclosed by the three methods were considered. Figure 2 shows the results of this analysis and the three methods gave very significant P values (P < 0.000001) for every case tested. The data confirmed the visual analysis made on the HVR amino acid motifs described above, and showed that wsp-681 (Figure 2A) and wsp-684 (Figure 2B) may represent distinct recombinant haplotypes between wsp-23 and wsp-680. Two other cases were found involving four sequences with a single breakpoint each. As shown in Figure 2C, besides the parental sequences (wsp-23 and wsp-680), two putative recombinant sequences were found (wsp-682 and wsp-683), and, shown in Figure 2D, two parental sequences (wsp-156 and wsp-313) and two possible reciprocal recombinants (wsp-75 and wsp-273) were found. The origin of these reciprocal recombinant sequences could be due to independent events of recombination or to reciprocal exchange of single events, as discussed previously for putative recombination in other insects (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418.). In every case of recombination the breakpoints occurred in the limits of the HVRs and the CRs intervening regions, as was usually described for wsp recombination in other insects (Baldo et al., 2005Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418.).

Figure 2
Putative recombination detected among Wolbachia wsp alleles infecting species of Anastrepha and associated parasitoid braconid wasps. In each alignment, only the polymorphic sites of the sequences are shown. Gray shaded parts of sequences are polymorphisms shared with the top sequence in each alignment. Sequences in the middle of each alignment were indicated as recombinant sequences, and the top and bottom sequences as the two parental sequences. The numbers below the alignments indicate the approximate nucleotide position of the breakpoints detected by three methods (Maxchi, Geneconv, Chimaera). The lines above the sequences indicate the position of the four HVRs.

Signatures of intragenic recombination of the wsp gene, detected for the first time in Anastrepha hosts in the present analysis, were found in Wolbachia infecting Anastrepha obliqua. The other case of inferred putative recombination involved two alleles, wsp-75 and wsp-156, found in the parasitoid Doryctobracon brasiliensis, with wsp sequences of Wolbachia previously found in two ant species, allele wsp-273, from Formica truncorum host, and wsp-313 from F. exsecta host. The way these putative recombinant events have occurred is unknown, but it should involve the presence of different Wolbachia strains in the fruit flies and/or wasps and in the ant species. Evidence of interspecies transfer of Wolbachia was found previously in the social parasitism of two ant species (Solenopsis spp) with parasitoids and a social parasite (Dedeine et al., 2005Dedeine F, Ahrens M, Calcaterra L and Shoemaker DD (2005) Social parasitism in fire ants (Solenopsis spp.): A potential mechanism for interspecies transfer of Wolbachia. Mol Ecol 14:1543-1548.). In this scenario, besides the close ecological relationships between fruit flies and parasitoid wasps, one may assume that they also share ecological proximity to ants. Indeed, fruit fly species have ants as one of their most important predators during the life stages when they are exposed in soil, as mature larvae when they leave the fruits, as pupae and as emerging adults (Bateman, 1992Bateman MA (1992) The ecology of fruit flies. Ann Rev Entomol 17:493-518.). Hence, predation of Anastrepha by ants infected with Wolbachia and carrying eggs of parasitoid wasps, may be a possible way of horizontal transmission of Wolbachia between these three insect clades, and could account for the suggestive recombination events herein described.

Recombination between Wolbachia haplotypes seems infrequent among fruit fly hosts. Strain wCer3 of Rhagoletis has been suggested to be a recombinant between A and B Wolbachia supergroups (Arthofer et al., 2009Arthofer W, Riegler M, Schneider D, Krammer M, Miller WJ and Stauffer C (2009) Hidden Wolbachia diversity in field populations of the European cherry fruit fly, Rhagoletis cerasi (Diptera, Tephritidae). Mol Ecol 18:3816-3830.), and no recombinants were yet described in the genus Bactrocera (Kittayapong et al., 2000Kittayapong P, Milne JR, Tigvattananont S and Baimai V (2000) Distribution of the reproduction-modifying bacteria, Wolbachia, in natural populations of tephritid fruit flies in Thailand. Sci Asia 26:93-103.; Jamnongluk et al., 2002Jamnongluk W, Kittayapong P, Baimai V and O'Neill SL (2002) Wolbachia infections of tephritid fruit flies: Molecular evidence for five distinct strains in a single host species. Curr Microbiol 45:255-260.; Sun et al., 2007Sun X, Cul L and Li Z (2007) Diversity and phylogeny of Wolbachia infecting Bactrocera dorsalis (Diptera, Tephritidae) populations from China. Mol Ecol Evol 36:1283-1289.; Morrow et al., 2014Morrow JL, Frommer M, Shearman DCA and Riegler M (2014) Tropical tephritid fruit fly community with high incidence of shared Wolbachia strains as platform for horizontal transmission of endosymbionts. Environ Microbiol 16:3622-3637., 2015Morrow JL, Frommer M, Royeer JE, Shearman DCA and Riegler M (2015) Wolbachia pseudogenes and low prevalence infections in tropical but not temperate Australian tephritid fruit flies: Manifestations of lateral gene transfer and endosymbiont spillover? BMC Evol Biol 15:e202.). Our data indicate that a similar situation seems to occur for Wolbachia infecting Anastrepha species.

Concluding Remarks

The present analysis shows a high infection rate for fruit flies and braconid wasps and the occurrence of putative intragenic recombination between Wolbachia wsp sequences. By screening for Wolbachia infection in Anastrepha species and in braconid wasps that emerged from samples of these fly species we obtained for the first time strong evidence for horizontal transmission between these two groups of insects. Horizontal transmission also explains the widespread occurrence of Wolbachia bearing a given wsp allele, as is known for a large number of insect species (Baldo et al., 2010Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 10:e48.; Stahlhut et al., 2010Stahlhut LK, Desjardins CA, Clark ME, Baldo L, Russell JA, Werren JH and Jaenike J (2010) The mushroom habitat as an ecological arena for global exchange of Wolbachia. Mol Ecol 19:1940-1952.). One such case is the ancestral allele wsp-23 detected in Wolbachia from at least 21 species, 11 genera and 11 families, but found preferentially in Diptera and Hymenoptera (Baldo et al., 2010Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 10:e48.). Wolbachia bearing this allele was found also in tephritid flies, in species of Anastrepha (Coscrato et al., 2009Coscrato VE, Braz ASK, Perondini ALP, Selivon D and Marino CL (2009) Wolbachia in Anastrepha fruit flies (Diptera, Tephritidae). Curr Microbiol 59:295-301.), Rhagoletis cerasi (wCer2) (Arthofer et al., 2011Arthofer W, Riegler M, Schuler H, Schneider D, Moder K, Miller WJ and Stauffer C (2011) Allele intersection analysis: A novel tool for multi locus sequence assignment in multiply infected hosts. PLoS One 6:e22198.), R. pomonella (wPom1) (Schuler et al., 2011Schuler H, Arthofer W, Riegler M, Berthau C, Krumböck S, Köppler K, Vogt H, Teixeira LAF and Stauffer C (2011) Multiple Wolbachia infections in Rhagoletis pomonella. Entomol Exp Appl 139:138-144.), and in the fly-wasp guilds, studied herein. Since Wolbachia strains usually do not persist for long periods of time in a given host (Baldo et al., 2008Baldo L, Ayoub NA, Hayashi CY, Russell JA, Stahlhut JK and Werren JH (2008) Insight into the routes of Wolbachia invasion: High levels of horizontal transmission in the spider genus Agelenopsis revealed by Wolbachia strain and mitochondrial DNA diversity. Mol Ecol 17:557-569., 2010Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 10:e48.), the most parsimonious hypothesis to explain the presence of Wolbachia wsp-23 in Rhagoletis, in Anastrepha and in the parasitoids found, might be by horizontal transmission.

Acknowledgments

The present study was supported by a grant from Fundação de Amparo à Pesquisa do Estado de São Paulo, Brazil (Proc. 2010/52040-8) to DS. LFP had a doctoral scholarship from CAPES and DS had a fellowship from CNPq.

References

  • Arthofer W, Riegler M, Schneider D, Krammer M, Miller WJ and Stauffer C (2009) Hidden Wolbachia diversity in field populations of the European cherry fruit fly, Rhagoletis cerasi (Diptera, Tephritidae). Mol Ecol 18:3816-3830.
  • Arthofer W, Riegler M, Schuler H, Schneider D, Moder K, Miller WJ and Stauffer C (2011) Allele intersection analysis: A novel tool for multi locus sequence assignment in multiply infected hosts. PLoS One 6:e22198.
  • Augustinos AA, Asimakopoulou AK, Moraiti CA, Mavragani-Tsipidou P, Papadopoulos NT and Bourtzis K (2014) Microsatellite and Wolbachia analysis in Rhagoletis cerasi natural populations: Population structuring and multiple infections. Ecol Evol 4:1943-1962.
  • Baldo L and Werren JH (2007) Revisiting Wolbachia supergroup typing based on WSP: Spurious lineages and discordance with MLST. Curr Microbiol 55:81-87.
  • Baldo L, Lo N and Werren JH (2005) Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406-5418.
  • Baldo L, Borderstein S, Wernegreen JJ and Werren JH (2006a) Widespread recombination throughout Wolbachia genomes. Mol Biol Evol 23:437-449.
  • Baldo L, Dunning Hotopp JC, Jolley KA, Borderstein SR, Biber SA, Choudhury RR, Hayashi C, Maiden MCJ, Tettelin H and Werren J (2006b) Multilocus sequence typing system for the endosymbiont Wolbachia pipientis Appl Environ Microbiol 72:7098-7110.
  • Baldo L, Ayoub NA, Hayashi CY, Russell JA, Stahlhut JK and Werren JH (2008) Insight into the routes of Wolbachia invasion: High levels of horizontal transmission in the spider genus Agelenopsis revealed by Wolbachia strain and mitochondrial DNA diversity. Mol Ecol 17:557-569.
  • Baldo L, Desjardins CA, Russell JA, Stahlhut JK and Werren JH (2010) Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia BMC Evol Biol 10:e48.
  • Bateman MA (1992) The ecology of fruit flies. Ann Rev Entomol 17:493-518.
  • Bourtzis K and O'Neill SL (1998) Wolbachia infections and arthropod reproduction. BioSci 48:287-293.
  • Bourtzis K, Braig HR and Karr TL (2003) Cytoplasmic incompatibility. In: Bourtzis K and Miller TA (eds) Insect Symbiosis. CRC Press, Boca Raton, pp 217-246.
  • Boyle L, O'Neill SL, Robertson HM and Karr TL (1993) Interspecific and intraspecific horizontal transfer of Wolbachia in Drosophila Science 260:1796-1799.
  • Braig HR, Guzman H, Tesh RB and O'Neill SL (1994) Replacement of the natural Wolbachia symbiont of Drosophila simulans with a mosquito counterpart. Nature 367:453-455.
  • Cáceres C, Segura DF, Vera MT, Wornoayporn V, Cladera JL, Teal P, Sapountzis P, Bourtzis K, Zacharopoulou A and Robinson AS (2009) Incipient speciation revealed in Anastrepha fraterculus (Diptera: Tephritidae) by studies on mating compatibility, sex pheromones, hybridization, and cytology. Biol J Linn Soc 97:152-165.
  • Canal NA and Zucchi RA (2000) Parasitóides - Braconidae. In: Malavasi A and Zucchi RA (eds) Moscas-das-Frutas de Importancia Econômica no Brasil: Conhecimento Básico e Aplicado. Holos Editora, Ribeirão Preto, pp 119-126.
  • Coscrato VE, Braz ASK, Perondini ALP, Selivon D and Marino CL (2009) Wolbachia in Anastrepha fruit flies (Diptera, Tephritidae). Curr Microbiol 59:295-301.
  • Dedeine F, Ahrens M, Calcaterra L and Shoemaker DD (2005) Social parasitism in fire ants (Solenopsis spp.): A potential mechanism for interspecies transfer of Wolbachia Mol Ecol 14:1543-1548.
  • Dobson SL, Bourtzis K, Braig HR, Jones BF, Zhou W, Rousset F and O'Neill SL (1999) Wolbachia infection are distributed throughout insect somatic and germ line tissues. Insect Biochem Mol Biol 29:153-160.
  • Drosopoulou E, Augustinos AA, Nakou I, Koepler K, Kounatidis I, Vogt H, Papadopoulos NT, Bourtzis K and Mavragani-Tsipidou P (2011) Genetic and cytogenetic analysis of the American cherry fruit fly, Rhagoletis cingulata (Diptera; Tephritidae). Genetica 139:1449-1464.
  • Godfray HCJ (1994) Parasitoids. Behavioral and Evolutionary Ecology. Princeton University Press, Princeton, 488 p.
  • Heath DB, Butcher RDJ, Whitfield WGF and Hubbard SF (1999) Horizontal transfer of Wolbachia between phylogenetically distant insect species by naturally occurring mechanism. Curr Biol 9:313-316.
  • Heath L, van der Walt E, Varsani A and Martin DP (2006) Recombination patterns in aphthoviruses mirror those found in other picornaviruses. J Virol 80:11827-11832.
  • Hilgenboecker H, Hammerstein P, Schlattmann P, Telschow A and Werren JH (2008) How many species are infected with Wolbachia? A statistical analysis of current data. FEMS Microbiol Lett 281:215-220.
  • Hiroki M, Tagami Y, Miura K and Kato Y (2004) Multiple infection with Wolbachia inducing different reproductive manipulations in the butterfly Eurema hecabe Proc R Soc Lond B Biol Sci 271:1751-1755.
  • Jamnongluk W, Kittayapong P, Baimai V and O'Neill SL (2002) Wolbachia infections of tephritid fruit flies: Molecular evidence for five distinct strains in a single host species. Curr Microbiol 45:255-260.
  • Jeyaprakash A and Hoy MA (2000) Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species. Insect Mol Biol 9:393-405.
  • Jiggins FM, von Der Schulenburg JH, Hurst GD and Majerus ME (2001) Recombination confounds interpretations of Wolbachia evolution. Proc R Soc Lond B Biol Sci 268:1423-1427.
  • Jowett T (1986) Preparation of nucleic acids. In: Roberts DB (ed) Drosophila: A Practical Approach. IRL Press, Oxford, pp 275-286.
  • Kittayapong P, Milne JR, Tigvattananont S and Baimai V (2000) Distribution of the reproduction-modifying bacteria, Wolbachia, in natural populations of tephritid fruit flies in Thailand. Sci Asia 26:93-103.
  • Kittayapong P, Jamnongluk W, Thipaksorn A, Milne JR and Sindhusake C (2003) Wolbachia infection complexity among insect in the tropical rice-field community. Mol Ecol 12:1049-1060.
  • Le Clec'h, W, Chevalier FD, Genty L, Bertaux J, Bouchon D and Sicard M (2013) Cannibalism and predation as path for horizontal passage of Wolbachia between terrestrial isopods. PLoS One 8:e60232.
  • Leonel Jr FL, Zuchi RA and Wharton RA (1995) Distribution and tephritidae hosts (Diptera) of braconid parasitoids (Hymenoptera) in Brazil. Int J Pest Manag 41:199-206.
  • Librado P and Rozas J (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism. Bioinformatics 25:1451-1452.
  • Liu R, Li ZH, Sun X, Shen ZR and Gao XW (2006) First discovery of Wolbachia infection of Bactrocera (Zeugodacus) tau (Walker) from China. Chinese Bull Entomol 43:368-370.
  • Marcon HS, Domingues DS, Coscrato VE, Selivon D, Perondini ALP and Marino CL (2011) New mariner elements in Anastrepha species (Diptera, Tephritidae). Neotrop Entomol 40:568-570.
  • Marinho CF, Souza-Filho MF, Raga A and Zucchi RA (2009) Parasitóides (Hymenoptera: Braconidae) de moscas-das-frutas (Diptera: Tephritidae) no Estado de São Paulo: Plantas associadas e parasitismo. Neotrop Entomol 38:321-326.
  • Martínez H, Toledo J, Liedo P and Mateos M (2012) Survey of heritable endosymbionts in southern Mexico populations of the fruit fly species Anastrepha striata and A. ludens Curr Microbiol 65:711-718.
  • Maynard Smith J (1992) Analyzing the mosaic structure of genes. J Mol Evol 34:126-129.
  • Morrow JL, Frommer M, Shearman DCA and Riegler M (2014) Tropical tephritid fruit fly community with high incidence of shared Wolbachia strains as platform for horizontal transmission of endosymbionts. Environ Microbiol 16:3622-3637.
  • Morrow JL, Frommer M, Royeer JE, Shearman DCA and Riegler M (2015) Wolbachia pseudogenes and low prevalence infections in tropical but not temperate Australian tephritid fruit flies: Manifestations of lateral gene transfer and endosymbiont spillover? BMC Evol Biol 15:e202.
  • Noda H, Miyoshi T, Zhang Q, Watanabe K, Deng H and Hoshizaki S (2001) Wolbachia infection shared among planthoppers (Homoptera: Delphacidae) and their endoparasites (Strepsiptera: Elenchidae): A probable case of interspecies transmission. Mol Ecol 10:2101-2106.
  • O'Neill SL, Giordano R, Colbert AME, Karr TL and Robertson HM (1992) 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc Natl Acad Sci U S A 89:2649-2702.
  • Ovruski SM, Aluja M, Sivinski J and Wharton RA (2000) Hymenopteran parasitoids on fruit-infesting Tephritidae (Diptera) in Latin America and the southern United States: Diversity, distribution, taxonomic status and their use in fruit fly biological control. Integ Pest Manag Rev 5:81-107.
  • Padidam M, Sawyer S and Fauquet CM (1999) Possible emergence of new geminiviruses by frequent recombination. Virology 265:218-225.
  • Pattabhiramaiah M, Brückner D and Reddy MS (2011) Horizontal transmission of Wolbachia in the honeybee subspecies Apis melifera carnica and its ectoparasite Varroa destructor Int J Environ Sci 2:514-523.
  • Posada D and Crandall KA (2001) Evaluation of methods for detecting recombination from DNA sequences: Computer simulations. Proc Natl Acad Sci U S A 98:13757-13762.
  • Reuter M and Keller L (2003) High level of multiple Wolbachia infection and recombination in the ant Formica exsecta. Mol Biol Evol 20:749-753.
  • Riegler M and Stauffer C (2002) Wolbachia infections and superinfections in cytoplasmically incompatible populations of the European cherry fruit fly Rhagoletis cerasi (Diptera, Tethritidae). Mol Ecol 11:2425-2434.
  • Rigaud T and Juchault P (1995) Success and failure of horizontal transfers of feminizing Wolbachia endosymbionts in woodlice. J Evol Biol 8:249-255.
  • Rocha LS, Mascarenhas RO, Perondini ALP and Selivon D (2005) Occurrence of Wolbachia in Brazilian samples of Ceratitis capitata (Wiedemann) (Diptera, Tephritidae). Neotrop Entomol 32:527-529.
  • Rokas A, Atkinson RJ, Nieves-Aldrey JL, West SA and Stone GN (2002) The incidence and diversity of Wolbachia in gallwasps (Hymenoptera; Cynipidae) on oak. Mol Ecol 11:1815-1829.
  • Saridaki A and Bourtzis K (2010) Wolbachia: More than just a bug in insect genitals. Curr Opin Microbiol 13:67-72.
  • Schuler H, Arthofer W, Krumböck S, Köppler K, Vogt H, Teixeira LAF, Riegler M and Stauffer C (2009) The bacterial endosymbiont Wolbachia in the invasive cherry fruit fly Rhagoletis cingulata (Diptera, Tephritidae). Mitt Dtsch Ges Allg Angew Entomol 17:99-101.
  • Schuler H, Arthofer W, Riegler M, Berthau C, Krumböck S, Köppler K, Vogt H, Teixeira LAF and Stauffer C (2011) Multiple Wolbachia infections in Rhagoletis pomonella Entomol Exp Appl 139:138-144.
  • Schuler H, Bertheau C, Egan SP, Feder JL, Riegler M, Schlick-Steiner BC, Steiner FM, Johannesen J, Kern P, Tuba K, et al. (2013) Evidence of a recent horizontal transmission and spatial spread of Wolbachia from endemic Rhagoletis cerasi (Diptera, Tephhritidae) to invasive Rhagoletis cingulate in Europe. Mol Ecol 22:4101-4111.
  • Selivon D, Perondini ALP, Ribeiro AF, Marino CL, Lima MMA and Coscrato VE (2002) Wolbachia endosymbionts in a species of the Anastrepha fraterculus complex (Diptera: Tephritidae). Invertebr Reprod Dev 42:121-127.
  • Selivon D, Vetros C, Fontes L and Perondini ALP (2004) New variant forms in the Anastrepha fraterculus complex (Diptera: Tephritidae). Proceedings of the 6th International Symposium on Fruit Flies of Economic Importance, Isteg Scientific Publ., Irene, pp 253-258.
  • Selivon D, Perondini ALP and Morgante JS (2005) A genetic-morphological characterization of two cryptic species of the Anastrepha fraterculus complex (Diptera: Tephritidae). Ann Entomol Soc Am 98:367-381.
  • Serbus LR, Casper-Lindley C, Landmann F and Sullivan W (2008) The genetics and cell biology of Wolbachia-host interactions. Annu Rev Genet 42:683-707.
  • Sievers F, Wilm A, Dineen DG, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, et al. (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539.
  • Sintupachee S, Milne J, Poonchaisri S, Baimai V and Kyttayapong P (2006) Closely related Wolbachia strains within the pumpkin arthropod community and the potential for horizontal transmission via the plant. Microbiol Ecol 51:294-301.
  • Stahlhut LK, Desjardins CA, Clark ME, Baldo L, Russell JA, Werren JH and Jaenike J (2010) The mushroom habitat as an ecological arena for global exchange of Wolbachia Mol Ecol 19:1940-1952.
  • Sun X, Cul L and Li Z (2007) Diversity and phylogeny of Wolbachia infecting Bactrocera dorsalis (Diptera, Tephritidae) populations from China. Mol Ecol Evol 36:1283-1289.
  • Tamura K, Stecher G, Peterson D, Filipski A and Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30:2725-2729.
  • Vavre F, Fleury F, Lepetit D, Fouillet P and Boulétreau M (1999) Phylogenetic evidence for horizontal transmission of Wolbachia in host-parasitoid associations. Mol Biol Evol 16:1711-1723.
  • Werren JH (1997) Biology of Wolbachia Annu Rev Entomol 42:587-609.
  • Werren JH and Bartos JD (2001) Recombination in Wolbachia Curr Biol 11:431-435.
  • Werren JH and Windsor DM (2000) Wolbachia infection frequencies in insects: Evidence of global equilibrium? Proc R Soc Lond B Biol Sci 267:1277-1285.
  • Werren JH, Zhang W and Guo LR (1995) Evolution and phylogeny of Wolbachia: Reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261:55-71.
  • Werren JH, Baldo L and Clark ME (2008) Wolbachia: Master manipulators of invertebrate biology. Nat Rev Microbiol 6:741-751.
  • Yang C-Y, Xiao J-H, Niu L-M, Ma G-C, Cook JM, Bian S-N, Fu Y-G and Huang Da-Wei (2012) Chaos of Wolbachia sequences inside the compact fig syconia of Ficus benjamina (Ficus: Moraceae). PLoS One 7:e48882.
  • Yang X-H, Zhu D-H, Liu Z, Zhao L and Su C-Y (2013) High levels of multiple infections, recombination and horizontal transmission of Wolbachia in the Andricus mukaigawae (Hymenoptera; Cynipidae) communities. PLoS One 8:e78970.
  • Zabalou S, Riegler M, Theodorakopoulou M, Stauffer C, Savakis C and Bourtzis K (2004) Wolbachia-induced cytoplasmic incompatibility as a means for insect pest population control. Proc Nat Acad Sci U S A 101:15042-15045.
  • Zhou W, Rousset F and O'Neill S (1998) Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc R Soc Lond B-Biol Sci 265:509-515.
  • Zucchi RA (2007) Diversidad, distribución y hospedeiros del género Anastrepha in Brasil. In: Hernández-Orttiz V (ed) Moscas de la Fruta en Latinoamérica (Diptera, Tephritidae): Diversidad, Biologia y Manejo. SyG Editores, Mexico City, pp 77-100.
  • Zug R and Hammerstein P (2012) Still a host of hosts for Wolbachia: Analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One 7:e79825843.

Internet Resources

  • Associate Editor: Célia Maria de Almeida Soares

Data availability

Data citations

Wolbachia database, http://pubmlst.org/wolbachia/wsp/ (January 12, 2016).

Publication Dates

  • Publication in this collection
    19 Sept 2016
  • Date of issue
    Oct-Dec 2016

History

  • Received
    21 Mar 2016
  • Accepted
    10 June 2016
Sociedade Brasileira de Genética Rua Cap. Adelmio Norberto da Silva, 736, 14025-670 Ribeirão Preto SP Brazil, Tel.: (55 16) 3911-4130 / Fax.: (55 16) 3621-3552 - Ribeirão Preto - SP - Brazil
E-mail: editor@gmb.org.br