A germline-targeted genetic screen for xrn-2 suppressors identifies a novel gene C34C12.2 in Caenorhabditis elegans

Abstract

XRN2 is an evolutionarily conserved 5’-to-3’ exoribonuclease, which degrades or trims various types of RNA in the nucleus. Although XRN-2 is essential for embryogenesis, larval development and reproduction in Caenorhabditis elegans, relevant molecular pathways remain unidentified. Here we create a germline-specific xrn-2 conditional mutant and perform a mutagenesis screen for suppressors of sterility. Loss-of-function alleles of dpy-10, osr-1, ptr-6 and C34C12.2 genes are identified. Depletion of DPY-10, OSR-1 or PTR-6 increases expression of gpdh-1 that encodes a glycerol-3-phosphate dehydrogenase, thereby elevates glycerol accumulation to suppress sterility of the mutant. The C34C12.2 protein is predominantly localized in the nucleolus of germ cells and shows a similarity to Saccharomyces cerevisiae Net1, which is involved in rDNA silencing. Depletion of NRDE-2, a putative interacting partner of C34C12.2 and a component of the nuclear RNAi machinery, restores fertility to the xrn-2 conditional mutant. These results may help to identify an essential role of XRN-2 in germline development.

Keywords:
XRN2; C34C12.2; glycerol regulation; mutagenesis screen; germline development

Introduction

XRN2 is an evolutionarily conserved 5’-to-3’ exoribonuclease. Predominantly localized in the nucleus, it degrades or trims various types of RNA for their maturation, level control or surveillance (Miki and Großhans, 2013; Nagarajan et al., 2013). Targets of XRN2 include the precursor, mature or aberrant forms of rRNA, tRNA, mRNA and microRNA (miRNA). Among multiple functions of XRN2, its role in rRNA maturation has been well-characterized in many species including yeast (Amberg et al., 1992; Petfalski et al., 1998; Fang et al., 2005), ciliates (Couvillion et al., 2012), kinetoplastids (Sakyiama et al., 2013), plants (Zakrzewska-Placzek et al., 2010) and mammals (Wang and Pestov, 2011). Precursor rRNA (pre-rRNA) is transcribed as a single molecule by RNA polymerase I in the nucleolus. During its processing into three rRNA species, XRN2 plays crucial roles in maturation of 5.8S and 25S/28S (in yeast/mammals, respectively) rRNAs by trimming the 5’ ends of their precursors.

We have previously shown that xrn-2 is ubiquitously expressed throughout the development of Caenorhabditis elegans (C. elegans) and that its activity is required for embryogenesis, larval development and reproduction (Miki et al., 2014a ). Although XRN-2 has been reported to degrade miRNA (Chatterjee and Grosshans, 2009; Miki et al., 2014a,b) and pre-mRNA (Miki et al., 2016) and to terminate transcription by RNA polymerase II on a subset of genes (Miki et al., 2017) in C. elegans, it remains unclear whether these functions are required for development. Ubiquitous expression and the multifunctional nature of XRN-2 make it difficult to relate one molecular pathway to one developmental process. Genetic screens for enhancers or suppressors of each developmental phenotype are expected to address the issue.

Here we create a germline specific xrn-2 conditional mutant and perform a genetic screen for suppressors of sterility. Loss- or reduced-function alleles of dpy-10, osr-1, ptr-6 and C34C12.2 genes are recovered. Depletion of DPY-10, OSR-1 or PTR-6, but not of C34C12.2, increases accumulation of glycerol, leading to restoration of fertility to the mutant animals. C34C12.2 is predominantly localized in the nucleolus of germ cells and partially homologous to Saccharomyces cerevisiae Net1, which has a role in rDNA silencing. Depletion of NRDE-2, a putative interacting partner of C34C12.2 and an effector protein in the nuclear RNAi pathway, suppresses sterility of the xrn-2 mutant, indicating that the two proteins might function together to counteract the role of XRN-2 in germline development.

Material and Methods

Worm strains

The Bristol N2 strain was used as wild type. The mutant strains used are listed in ^{Table S1}.

Worm culture

Worms were cultured on Nematode Growth Medium (NGM) agar seeded with Escherichia coli OP50 according to the standard methods described previously (Brenner, 1974).

Single copy transgene insertion

Mos1-mediated single-copy transgene insertion (MosSCI) was performed as described previously (Frøkjaer-Jensen et al., 2008). Insertion loci are shown in ^{Table S1}.

Mutagenesis screen

About 4,000 xrn-2ts ^germ animals at the fourth larval stage were harvested, washed and incubated with 50 mM ethyl methanesulfonate (EMS) in 6 ml of M9 buffer for 4 hours at 20 °C. The worms were washed three times with M9 buffer and incubated at 20 °C. Once many eggs appeared on the plate, P0 animals were moved to fresh plates. This process was repeated for 2 days. Once many larvae of the F2 generation appeared, the animals were harvested, from which F1 animals were removed by brief centrifugation. The mutated F2 larvae were incubated at 25.5 °C and screened for fertility. Gravid animals were isolated and backcrossed 5 times with the parental xrn-2ts ^germ strain to remove unrelated mutations. Whole genome sequencing of the animals was performed as described previously (Miki et al., 2017). Mutations were mapped by single nucleotide variant analysis using the MiModD software (Baumeister Lab., University of Freiburg, Germany) according to the guideline.

Microscopy

Stereoscopic images were obtained with an M205A stereo microscope (Leica, Solms, Germany) or an SMZ25 stereo microscope (Nikon, Tokyo, Japan). DIC and fluorescent images were obtained using an Axio Observer Z1 microscope (Carl Zeiss, Oberkochen, Germany).

RNAi

RNAi clones were obtained from the Ahringer library (Kamath and Ahringer, 2003). RNAi was performed by the feeding method (Timmons and Fire, 1998) with bacteria carrying the insertless L4440 RNAi vector as a negative control.

Quantitative reverse transcription PCR (RT-qPCR)

Worms were harvested, washed three times with M9 medium, resuspended in 700 µl of TRIzol Reagent (Thermo Fischer Scientific, Waltham, MA, USA) and frozen in liquid nitrogen. They were broken open by five repeats of freeze and thaw using liquid nitrogen using 42 °C heating block, before RNA was extracted and purified by the Direct-zol RNA MiniPrep Kit (Zymo Research, CA, USA) according to the supplier’s protocol. cDNA was generated from total RNA by the High-Capacity cDNA Reverse Transcription Kit with oligo(dT)18 Primer (Thermo Fischer Scientific) according to the supplier’s protocol. RT-qPCR was performed by QuantStudio 3 Real-Time PCR system (Thermo Fischer Scientific) using PowerUp SYBR Green Real-Time PCR Master Mix (Thermo Fischer Scientific) and specific primers for gpdh-1 (sense: GCAATTGTTGGCGGTGGAAACTGG, antisense: CCTGGTTTCCTGGAATCTCTGCAC) and act-1 (sense: AAATCACCGCTCTTGCCCCATCAA, antisense: GCACTTGCGGTGAACGATGGAT).

Results

Creation of a germline-specific xrn-2 conditional mutant

In order to gain more insight into roles of XRN-2 in C. elegans development, we decided to perform genetic screens for suppressors of developmental defects caused by inactivation of XRN-2. A conditional mutant is a powerful tool, which enables screening for genetic modifiers of an essential gene. We have previously reported temperature-sensitive alleles of xrn-2 in C. elegans (Miki et al., 2014a , 2016, 2017). The mutant animals showed defects in many developmental processes including embryogenesis, larval development and fertility at restrictive temperatures. Genetic suppressor screens using these mutants had failed to identify any mutations other than those in xrn-2 itself. Since xrn-2 is expressed ubiquitously throughout development (Miki et al., 2014a), we reasoned that a single allele might not be able to suppress all developmental defects in different tissues or cells of xrn-2 mutant animals. Therefore, to narrow down the target of screening, we focused on germline development. In order to create a germline specific xrn-2 temperature-sensitive mutant (xrn-2ts ^germ ), we expressed a green fluorescent protein (GFP)-fused functional xrn-2 transgene (xrn-2::gfp) in somatic cells of xrn-2(xe31), a temperature-sensitive mutant of xrn-2 (xrn-2ts) (Miki et al., 2017), by MosSCI (Frøkjaer-Jensen et al., 2008). For rescue of somatic cells, we expressed xrn-2::gfp using the promoter of dpy-18. XRN2-GFP signal was detected in hypodermal and other somatic cells, but not in the intestine or the gonad (Figure 1A). For rescue of the embryo, we expressed xrn-2::gfp using the promoter of pes-2.1, which is active specifically in the embryo (Figure 1B). When incubated at a permissive temperature (20 °C) from the first larval (L1) stage, the xrn-2ts ^germ animals developed to adult and reproduced. At a restrictive temperature (26 °C), on the other hand, xrn-2ts ^germ animals developed to adult but were sterile, while xrn-2ts animals ceased development as larvae (Figure 1C), as previously reported (Miki et al., 2017). Thus, the xrn-2ts ^germ strain can function as a tool to screen for genetic suppressors of sterility caused by XRN-2 inactivation in the germline. In order to identify developmental stages that require XRN-2 for fertility, we applied different timings of temperature shifts to xrn-2ts ^germ animals. The animals were fertile, when temperature was elevated from the middle of L4 stage, though not of L2 stage (Figure 1D). These results indicate that XRN-2 plays a crucial role in germline development before the mid-L4 stage.

Figure 1 -
Creation of a germline-specific xrn-2 temperature-sensitive mutant. (A) Animals with a dpy-18 promoter-driven xrn-2::gfp transgene (Pdpy-18::xrn-2::gfp) were incubated at 20 °C and observed. GFP signal was detected in hypodermal cells (top) but not in the intestine or the gonad (bottom). Corresponding DIC images are shown (right). (B) Animals with a pes-2.1 promoter-driven xrn-2::gfp transgene (Ppes-2.1::xrn-2::gfp) were incubated at 20 °C and observed. GFP signal was detected in embryos. Corresponding DIC images are shown right. (C) Wild-type, xrn-2ts and xrn-2ts ^germ animals were incubated at 20 °C or 26 °C from L1 stage for 72 hours and observed by stereomicroscopy at the same magnification. An inset shows an adult animal without embryos at higher magnification. (D) xrn-2ts ^germ animals were incubated at 20 °C from L1 stage until the middle of L2 (left) or L4 (right) stage, then at 26 °C until the adult stage. The animals were observed by stereomicroscopy at the same magnification. An inset shows embryos and a hatched larva.

dpy-10, osr-1, ptr-6 and C34C12.2 genes are identified as genetic suppressors of xrn-2ts ^germ

We mutagenized xrn-2ts ^germ animals with EMS and isolated four strains that were able to reproduce at 25.5 °C (Figure 2A). Genomic DNA sequencing of these strains followed by mutation mapping identified recessive alleles of dpy-10, osr-1, ptr-6 and C34C12.2 genes (Table 1). dpy-10 encodes a collagen protein in the cuticle (Levy et al., 1993). The dpy-10(kid6) allele has a missense mutation, and the mutant animals showed a dumpy phenotype. osr-1 was identified as a gene whose loss conferred resistance to osmotic stress on animals (Solomon et al., 2004), and the osr-1(kid1) allele has a nonsense mutation. ptr-6 encodes a member of patched family proteins, and the ptr-6(kid4) allele changes an amino acid in an evolutionarily conserved extracellular ligand binding site (Kuwabara and Labouesse, 2002; Zugasti et al., 2005; Daggubati et al., 2022). Although we recovered another allele of ptr-6 with a missense mutation that substituted glycine at amino acid position 635 to glutamic acid, the strain carrying the allele was permanently lost due to an extreme difficulty in cryopreservation as previously reported (Choi et al., 2016). C34C12.2 encodes a protein of unknown function, and the C34C12.2(kid2) allele changed the guanine at the 5’ splice site of the fourth intron to alanine, abrogating splicing. Thus, these alleles were expected to reduce or abolish the gene functions. Consistently, RNAi-mediated knockdown of each of the genes restored fertility to xrn-2ts ^germ animals at a restrictive temperature (Figure 2B). These results suggest that the four genes counteract the function of xrn-2 in germline development directly or indirectly.

Figure 2 -
dpy-10, osr-1, ptr-6 and C34C12.2 genes were identified as genetic suppressors of xrn-2tsgerm. (A) Animals of indicated genotypes were incubated at 25.5 °C from the L1 stage for 72 hours and observed. Oocytes and embryos were found in all strains except xrn-2ts ^germ . (B) xrn-2ts ^germ animals were exposed to mock RNAi or RNAi for indicated genes from L1 to adult at 25.5 °C and observed by stereomicroscopy at the same magnification. Embryos were found in all conditions except mock RNAi.

Table 1 -
Alleles recovered from the screen.

Gene(allele)	Type of mutation	Nucleotide change	Codon change	Amino acid change
dpy-10(kid6)	Missense	G → A	GGA → AGA	G131R
osr-1(kid1)	Nonsense	C → T	CAA → TAA	Q239Stop
ptr-6(kid4)	Missense	G → A	GGA → GAA	G223E
C34C12.2(kid2)	Splice site	G → A*	n/a	n/a

• ^*
  5’ splice site of intron 4
• n/a: not applicable

DPY-10, OSR-1 and PTR-6 control glycerol accumulation

We became aware from literature searches that dpy-10, osr-1 and ptr-6 were among positive genes in a genome-wide RNAi screen for activation of the promoter of gpdh-1, a glycerol-3-phosphate dehydrogenase that mediates glycerol synthesis (Lamitina et al., 2006). Consistently, RNAi-mediated knockdown of dpy-10, osr-1 or ptr-6 increased gpdh-1 mRNA levels (Figure 3A), which correlated roughly with the rates of animals that restored fertility (Figure 3B). Thus, DPY-10, OSR-1 and PTR-6 negatively regulate gpdh-1 expression, and depletion of each of them de-represses gpdh-1 to elevate glycerol levels, leading to restoration of fertility to xrn-2ts ^germ animals. Our attempt to restore fertility to xrn-2ts ^germ animals by providing glycerol externally from culture plates failed, possibly because the animals were reluctant to take exogenously provided glycerol (^{Figure S1}).

Figure 3 -
Knockdown of dpy-10, osr-1, ptr-6 or C34C12.2 gene increases gpdh-1 expression. (A) Wild-type animals were exposed to mock RNAi or RNAi for indicated genes from L1 to adult at 25 °C. Levels of gpdh-1 mRNA were quantified by RT-qPCR and normalized to act-1 mRNA levels with values of mock-treated animals defined as 1 (n = 5, means ± SEM). p-values were calculated according to the two-sided paired t-test and marked: *p < 0.05, **p < 0.01, ***p < 0.001, n.s. not significant. Values are shown in ^{Table S2}. (B) xrn-2ts ^germ animals were exposed to mock RNAi or RNAi for indicated genes from L1 to adult at 26 °C, and rates of fertile animals were examined (n = 100 in each condition from two independent experiments). (C) Animals of indicated genotypes were incubated at 25 °C from L1 stage for 72 hours and observed by stereomicroscopy at the same magnification.

The xrn-2ts and xrn-2ts ^germ strains have the xrn-2(xe31) allele that has a missense mutation to destabilize XRN-2 at elevated temperatures (Miki et al., 2017). Since glycerol is known to stabilize proteins (Vagenende et al., 2009), we suspected that the dpy-10, osr-1 and ptr-6 alleles stabilized mutant XRN-2 in the germ cells of xrn-2ts ^germ animals at the elevated temperature, leading to restoration of fertility. Indeed, dpy-10 alleles have been reported to suppress phenotypes of several temperature-sensitive mutants (Maine and Kimble, 1989; Goh and Bogaert, 1991; Nishiwaki and Miwa, 1998; O’Rourke et al., 2007). If this is the case, elevated accumulation of glycerol, as it diffuses throughout the animal body, should be able to stabilize mutant XRN-2 not only in germ cells but in somatic cells of xrn-2ts animals to support their development. However, knockdown of dpy-10, osr-1 or ptr-6 failed to rescue the xrn-2ts animals from larval arrest (^{Figure S2}). Since RNAi-mediated depletion of the target protein is usually partial, we crossed osr-1(ok959), a loss-of-function allele of osr-1 (Wheeler and Thomas, 2006), into xrn-2ts (osr-1(ok959); xrn-2ts), to examine the effect of constitutive deletion of the gene. When incubated from the L1 stage at 25 °C, all osr-1(ok959); xrn-2ts animals ceased development as larvae and showed no developmental advantage over xrn-2ts animals (Figure 3C). These results indicate that gpdh-1 upregulation restored fertility to xrn-2ts ^germ animals by other means than stabilizing mutant XRN-2 at the elevated temperature.

C34C12.2 is predominantly localized in the nucleolus of germ cells

In contrast to three other genes identified in the screen, knockdown of C34C12.2 did not affect gpdh-1 expression (Figure 3B). Thus, the C34C12.2 allele is likely to restore fertility to xrn-2ts ^germ animals through a mechanism that is different from the dpy-10, osr-1 and ptr-6 alleles. No cellular functions or developmental roles of C34C12.2 have been reported until now. Protein homology search by Position-Specific Iterated BLAST (National Center for Biotechnology Information, Bethesda, MA, USA) found a similarity between C34C12.2 and Saccharomyces cerevisiae Net1 (^{Figure S3}). Net1 is a core subunit of the regulator of nucleolar silencing and telophase exit (RENT) complex (Straight et al., 1999). It tethers the RENT complex to rDNA for silencing by NAD-dependent deacetylase Sir2, another component of the complex, in the nucleolus. In order to examine whether C34C12.2 is localized in the nucleolus of germ cells, we created a transgenic strain that expressed GFP-fused C34C12.2 by MosSCI. As shown in Figure 4, C34C12.2 was predominantly localized in the nucleolus. Consistent to its potential role in germline development, C34C12.2 was detected in germ cells, oocytes and sperm, in addition to the hypodermis and the intestine.

Figure 4 -
C34C12.2 is predominantly localized in the nucleolus. Animals with a gfp::C34C12.2 transgene were incubated at 20 °C and observed. Insets show cell nuclei at higher magnification. GFP signal was detected in the nucleolus of germ cells, oocytes, sperm, hypodermal cells and intestinal cells. Corresponding DIC images are shown right. Punctate signal in the intestine is the autofluorescence of gut granules (Coburn and Gems, 2013)

Knockdown of nrde-2 restores fertility to xrn-2ts ^germ animals

Our previous study failed to find C34C12.2 in XRN-2-containing complexes purified from whole-worm lysates (Miki et al., 2014b), raising the possibility that the two proteins function without stable physical interaction in germ cell nuclei. Wan and colleagues identified C34C12.2 in NRDE-2-containing complexes by immunoprecipitation mass spectrometry, although its function was not addressed in the study (Wan et al., 2020). NRDE-2 is an effector protein in the nuclear RNAi pathway. An Argonaute protein, NRDE-3 in the soma or HRDE-1 in the germline, bound by an endogenous siRNA species 22G RNA, translocates from the cytoplasm to the nucleus, where it recruits NRDE-1, -2 and -4 to the nascent pre-mRNA to inhibit elongation of RNA polymerase II and to deposit repressive histone H3K9 trimethylation marks (Guang et al., 2008, 2010; Burkhart et al., 2011; Ashe et al., 2012; Buckley et al., 2012; Luteijn et al., 2012). This pathway is particularly important to maintain germline integrity by silencing transposons, regulating gene expression and promoting epigenetic inheritance. Interestingly, the same machinery functions to repress expression of pre-rRNA (Zhou et al., 2017; Liao et al., 2021). If C34C12.2 functions in complex with NRDE-2 to counteract the role of XRN-2 directly or indirectly in germ cells, knockdown of nrde-2 should restore fertility to xrn-2ts ^germ animals. Indeed, xrn-2ts ^germ animals depleted of NRDE-2 regained fertility (Figure 2B).

Discussion

XRN-2 is a multifunctional protein that is involved in various RNA-processing pathways. Therefore, a mutagenesis screen is unlikely to isolate an allele that suppress all developmental defects caused by XRN-2 inactivation. An allele that can suppress sterility may not be sufficient for survival and maintenance of xrn-2 mutant animals, if it fails to suppress the larval arrest phenotype, for example. We overcame this issue by restricting a target of screening to a single developmental process, namely germline development. The xrn-2ts ^germ conditional mutant was created by expressing a functional xrn-2 transgene in the somatic cells and the embryo of the xrn-2ts mutant. A promoter of dpy-18 was used to drive expression of xrn-2::gfp in somatic cells of larvae. Consistent to the previous report of dpy-18 expression (Hill et al., 2000), XRN2-GFP was detected in the hypodermis of the larvae, while missing in some somatic tissues such as the intestine. Nevertheless, the mutant animals were able to develop to adult at an elevated temperature without showing somatic phenotypes such as larval arrest, a molting defect and vulval bursting, which had been reported for xrn-2 (Frand et al., 2005; Miki et al., 2014a). Although xrn-2 is expressed ubiquitously (Miki et al., 2014a), its activity in the hypodermis might be sufficient for somatic development of larvae. If so, a soma specific xrn-2 conditional mutant could be created by expressing functional xrn-2 in the embryo and the germline of the xrn-2ts mutant using appropriate promoters, which would function as a useful tool to dissect the roles of XRN-2 in somatic development of larvae. Our approach to create a spatially restricted conditional mutant would be useful to dissect a gene that has multiple essential functions in different tissues or cell-types. Although this method requires a conditional allele and has limited versatility as compared to the auxin-inducible degron system (Nishimura et al., 2009; Zhang et al., 2015; Negishi et al., 2022), it has advantages of low-cost and the ease of control, particularly in long-run experiments such as a genetic screen in this study.

Our results indicate that elevated accumulation of glycerol restores fertility to xrn-2ts ^germ animals by other means than stabilizing the mutant XRN-2 protein. A previous study suggests that increase in glycerol accumulation may function as an adaptive response to osmotic stress in the C. elegans germline to maintain the quality of germ cells and oocytes (Davis et al., 2017). This is consistent with the observation that animals that lack gpdh-1 and gpdh-2 genes showed reduced brood size as compared to wild-type animals under osmotic stress (Lamitina et al., 2006). Perhaps XRN-2 functions to maintain proper osmolality in the germline through an unknown mechanism. If so, high levels of glycerol could function as a chemical chaperon to protect XRN-2-inactivated germ cells from osmotic stress by stabilizing proteins and other structures. However, note that we cannot formally exclude the possibility that stabilization of mutant XRN-2 by glycerol is responsible for the phenotypic rescue. If somatic development of C. elegans larvae requires higher activity of XRN-2 than germline development, for instance, stabilization of mutant XRN-2 by glycerol might be merely insufficient for rescue of xrn-2ts animals from larval arrest.

C34C12.2 is unique among the genes identified in our screen on the point that it does not affect gpdh-1 expression. C34C12.2 is partially homologous to S. cerevisiae Net1, which tethers the RENT complex to rDNA for silencing (Straight et al., 1999). We found that depletion of NRDE-2, a putative interacting partner of C34C12.2, restored fertility to xrn-2ts ^germ animals. NRDE-2 functions an effector of the nuclear RNAi machinery, which negatively regulates expression of pre-mRNA and pre-rRNA (Guang et al., 2010; Liao et al., 2021). From these results and its predominant localization in the nucleolus, we speculate that C34C12.2, by interacting with the nuclear RNAi machinery through NRDE-2, represses expression of pre-rRNA and that loss of its function results in elevation of rRNA levels. Thus, the C34C12.2 loss-of-function allele may compensate for a decrease in rRNA accumulation that is caused by XRN-2 inactivation. If so, rRNA maturation might be an essential function of XRN-2 in germline development. Further study on interaction between C34C12.2 and NRDE-2 and the impact of C34C12.2 dysregulation on rRNA accumulation will shed light on the roles of C34C12.2 and XRN-2 in germline development.

Acknowledgements

We thank Agata Tyczewska and other members of the Laboratory of Animal Model Organisms at the Institute of Bioorganic Chemistry Polish Academy of Sciences (IBCH PAS) for preparation of culture plates and media; Helge Großhans at the Friedrich Miescher Institute (FMI) for discussion and sharing worm strains (HW1660, HW1682, HW1714 and HW1715); Sebastien Smallwood and other members of the FMI Functional Genomics Facility for genomic DNA sequencing. The RB1032 strain with the osr-1(ok959) allele was provided by the Caenorhabditis Genetics Center, which is funded by National Institutes of Health Office of Research Infrastructure Programs (P40 OD010440). This work is funded by IBCH PAS and Narodowe Centrum Nauki (grant ID: 2018/31/B/NZ1/03580).

References

• Amberg DC, Goldstein AL and Cole CN (1992) Isolation and characterization of RAT1: An essential gene of Saccharomyces cerevisiae required for the efficient nucleocytoplasmic trafficking of mRNA. Genes Dev 6:1173-1189.
• Ashe A, Sapetschnig A, Weick EM, Mitchell J, Bagijn MP, Cording AC, Doebley AL, Goldstein LD, Lehrbach NJ, Le Pen J et al (2012) piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans Cell 150:88-99.
• Brenner S (1974) The genetics of Caenorhabditis elegans Genetics 77:71-94.
• Buckley BA, Burkhart KB, Gu SG, Spracklin G, Kershner A, Fritz H, Kimble J, Fire A and Kennedy S (2012) A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality. Nature 489:447-451.
• Burkhart KB, Guang S, Buckley BA, Wong L, Bochner AF and Kennedy S (2011) A pre-mRNA-associating factor links endogenous siRNAs to chromatin regulation. PLoS Genet 7:e1002249.
• Chatterjee S and Grosshans H (2009) Active turnover modulates mature microRNA activity in Caenorhabditis elegans Nature 461:546-549.
• Choi MK, Son S, Hong M, Choi MS, Kwon JY and Lee J (2016) Maintenance of membrane integrity and permeability depends on a patched-related protein in Caenorhabditis elegans Genetics 202:1411-1420.
• Coburn C and Gems D (2013) The mysterious case of the C. elegans gut granule: Death fluorescence, anthranilic acid and the kynurenine pathway. Front Genet 4:151.
• Couvillion MT, Bounova G, Purdom E, Speed TP and Collins K (2012) A Tetrahymena Piwi bound to mature tRNA 3' fragments activates the exonuclease Xrn2 for RNA processing in the nucleus. Mol Cell 48:509-520.
• Daggubati V, Raleigh DR and Sever N (2022) Sterol regulation of developmental and oncogenic Hedgehog signaling. Biochem Pharmacol 196:114647.
• Davis M, Montalbano A, Wood MP and Schisa JA (2017) Biphasic adaptation to osmotic stress in the C. elegans germ line. Am J Physiol Cell Physiol 312:C741-C748.
• Fang F, Phillips S and Butler JS (2005) Rat1p and Rai1p function with the nuclear exosome in the processing and degradation of rRNA precursors. RNA 11:1574-1578.
• Frand AR, Russel S and Ruvkun G (2005) Functional genomic analysis of C. elegans molting. PLoS Biol 3:e312.
• Frøkjaer-Jensen C, Davis MW, Hopkins CE, Newman BJ, Thummel JM, Olesen SP, Grunnet M and Jorgensen EM (2008) Single-copy insertion of transgenes in Caenorhabditis elegans Nat Genet 40:1375-1383.
• Goh PY and Bogaert T (1991) Positioning and maintenance of embryonic body wall muscle attachments in C. elegans requires the mup-1 gene. Development 111:667-681.
• Guang S, Bochner AF, Pavelec DM, Burkhart KB, Harding S, Lachowiec J and Kennedy S (2008) An Argonaute transports siRNAs from the cytoplasm to the nucleus. Science 321:537-541.
• Guang S, Bochner AF, Burkhart KB, Burton N, Pavelec DM and Kennedy S (2010) Small regulatory RNAs inhibit RNA polymerase II during the elongation phase of transcription. Nature 465:1097-1101.
• Hill KL, Harfe BD, Dobbins CA and L'Hernault SW (2000) dpy-18 encodes an alpha-subunit of prolyl-4-hydroxylase in Caenorhabditis elegans Genetics 155:1139-1148.
• Kamath RS and Ahringer J (2003) Genome-wide RNAi screening in Caenorhabditis elegans Methods 30:313-321.
• Kuwabara PE and Labouesse M (2002) The sterol-sensing domain: Multiple families, a unique role? Trends Genet 18:193-201.
• Lamitina T, Huang CG and Strange K (2006) Genome-wide RNAi screening identifies protein damage as a regulator of osmoprotective gene expression. Proc Natl Acad Sci. U S A 103:12173-12178.
• Levy AD, Yang J and Kramer JM (1993) Molecular and genetic analyses of the Caenorhabditis elegans dpy-2 and dpy-10 collagen genes: A variety of molecular alterations affect organismal morphology. Mol Biol Cell 4:803-817.
• Liao S, Chen X, Xu T, Jin Q, Xu Z, Xu D, Zhou X, Zhu C, Guang S and Feng X (2021) Antisense ribosomal siRNAs inhibit RNA polymerase I-directed transcription in C. elegans Nucleic Acids Res 49:9194-9210.
• Luteijn MJ, van Bergeijk P, Kaaij LJ, Almeida MV, Roovers EF, Berezikov E and Ketting RF (2012) Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans EMBO J 31:3422-3430.
• Maine EM and Kimble J (1989) Identification of genes that interact with glp-1, a gene required for inductive cell interactions in Caenorhabditis elegans Development 106:133-143.
• Miki TS and Großhans H (2013) The multifunctional RNase XRN2. Biochem Soc Trans 41:825-830.
• Miki TS, Rüegger S, Gaidatzis D, Stadler MB and Großhans H (2014a) Engineering of a conditional allele reveals multiple roles of XRN2 in Caenorhabditis elegans development and substrate specificity in microRNA turnover. Nucleic Acids Res 42:4056-4067.
• Miki TS, Richter H, Rüegger S and Großhans H (2014b) PAXT-1 promotes XRN2 activity by stabilizing it through a conserved domain. Mol Cell 53:351-360.
• Miki TS, Carl SH, Stadler MB and Großhans H (2016) XRN2 autoregulation and control of polycistronic gene expresssion in Caenorhabditis elegans PLoS Genet 12:e1006313.
• Miki TS, Carl SH and Großhans H (2017) Two distinct transcription termination modes dictated by promoters. Genes Dev 31:1870-1879.
• Nagarajan VK, Jones CI, Newbury SF and Green PJ (2013) XRN 5'→3' exoribonucleases: Structure, mechanisms and functions. Biochim Biophys Acta 1829:590-603.
• Negishi T, Kitagawa S, Horii N, Tanaka Y, Haruta N, Sugimoto A, Sawa H, Hayashi KI, Harata M and Kanemaki MT (2022) The auxin-inducible degron 2 (AID2) system enables controlled protein knockdown during embryogenesis and development in Caenorhabditis elegans Genetics 220:iyab218.
• Nishimura K, Fukagawa T, Takisawa H, Kakimoto T and Kanemaki M (2009) An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat Methods 6:917-922.
• Nishiwaki K and Miwa J (1998) Mutations in genes encoding extracellular matrix proteins suppress the emb-5 gastrulation defect in Caenorhabditis elegans Mol Gen Genet 259:2-12.
• O'Rourke SM, Dorfman MD, Carter JC and Bowerman B (2007) Dynein modifiers in C. elegans: Light chains suppress conditional heavy chain mutants. PLoS Genet 3:e128.
• Petfalski E, Dandekar T, Henry Y and Tollervey D (1998) Processing of the precursors to small nucleolar RNAs and rRNAs requires common components. Mol Cell Biol 18:1181-1189.
• Sakyiama J, Zimmer SL, Ciganda M, Williams N and Read LK (2013) Ribosome biogenesis requires a highly diverged XRN family 5'->3' exoribonuclease for rRNA processing in Trypanosoma brucei RNA 19:1419-1431.
• Solomon A, Bandhakavi S, Jabbar S, Shah R, Beitel GJ and Morimoto RI (2004) Caenorhabditis elegans OSR-1 regulates behavioral and physiological responses to hyperosmotic environments. Genetics 167:161-170.
• Straight AF, Shou W, Dowd GJ, Turck CW, Deshaies RJ, Johnson AD and Moazed D (1999) Net1, a Sir2-associated nucleolar protein required for rDNA silencing and nucleolar integrity. Cell 97:245-256.
• Timmons L and Fire A (1998) Specific interference by ingested dsRNA. Nature 395:854.
• Vagenende V, Yap MG and Trout BL (2009) Mechanisms of protein stabilization and prevention of protein aggregation by glycerol. Biochemistry 48:11084-11096.
• Wan G, Yan J, Fei Y, Pagano DJ and Kennedy S (2020) A Conserved NRDE-2/MTR-4 complex mediates nuclear RNAi in Caenorhabditis elegans Genetics 216:1071-1085.
• Wang M and Pestov DG (2011) 5'-end surveillance by Xrn2 acts as a shared mechanism for mammalian pre-rRNA maturation and decay. Nucleic Acids Res 39:1811-1822.
• Wheeler JM and Thomas JH (2006) Identification of a novel gene family involved in osmotic stress response in Caenorhabditis elegans Genetics 174:1327-1336.
• Zakrzewska-Placzek M, Souret FF, Sobczyk GJ, Green PJ and Kufel J (2010) Arabidopsis thaliana XRN2 is required for primary cleavage in the pre-ribosomal RNA. Nucleic Acids Res 38:4487-4502.
• Zhang L, Ward JD, Cheng Z and Dernburg AF (2015) The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans Development 142:4374-4384.
• Zhou X, Feng X, Mao H, Li M, Xu F, Hu K and Guang S (2017) RdRP-synthesized antisense ribosomal siRNAs silence pre-rRNA via the nuclear RNAi pathway. Nat Struct Mol Biol 24:258-269.
• Zugasti O, Rajan J and Kuwabara PE (2005) The function and expansion of the Patched- and Hedgehog-related homologs in C. elegans Genome Res 15:1402-1410.

Internet Resources

• MiModD software, MiModD software, https://mimodd.readthedocs.io (accessed 21 June 2016).
  » https://mimodd.readthedocs.io
• PSI-BLAST, PSI-BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed 22 September 2022).
  » https://blast.ncbi.nlm.nih.gov/Blast.cgi

Supplementary material

The following online material is available for this article:

Table S1 - Worm strains.

Table S2 - gpdh-1 RT-qPCR data.

Figure S1 - Incubation with glycerol did not restore fertility to xrn-2ts ^germ animals.

Figure S2 - Knockdown of dpy-10, osr-1 or ptr-6 did not rescue xrn-2ts animals from larval arrest.

Figure S3 - C34C12.2 shows homology to S. cerevisiae Net1.

Edited by

Associate Editor:

Alberto R. Kornblihtt

Publication Dates

• Publication in this collection
  15 May 2023
• Date of issue
  2023

History

• Received
  09 Nov 2022
• Accepted
  22 Feb 2023