The expression of LRRN4 was correlated with the progression and prognosis of colon adenocarcinoma (COAD) patients

Zhang, Yuxian; Xie, Jianlan; Liu, Diangang; Zhu, Shengtao; Zhang, Shutian

doi:10.1590/1678-4685-GMB-2021-0138

Acessibilidade / Reportar erro

Brasil

Genetics and Molecular Biology

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Human and Medical Genetics • Genet. Mol. Biol. 45 (1) • 2022 • https://doi.org/10.1590/1678-4685-GMB-2021-0138 copy

The expression of LRRN4 was correlated with the progression and prognosis of colon adenocarcinoma (COAD) patients

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

Our present study aims to investigate the value of LRRN4 in the progression and prognosis of COAD patients. All COAD and adjacent sample data was downloaded from TCGA database. Survival analysis was performed according to Kaplan-Meier method. The real-time quantitative PCR and immunohistochemistry analysis were conducted for validation in cell lines and tissues. The GSEA was conducted to find functional KEGG pathways. Multivariate Cox regression proportional hazard mode was used to determine whether LRRN4 expression was an independent prognostic factor. The LRRN4 expression in COAD samples were significantly higher than that in adjacent samples, which was consistent with our experiments in cell lines and tissues. Along with the increase of TNM Stage, LRRN4 expression had an increasing tendency. The COAD patients with high LRRN4 expression showed undesirable prognoses. Additionally, the TGF-β signaling pathway, WNT signaling pathway and other 25 pathways were significantly activated in the high LRRN4 expression group. In conclusion, high LRRN4 expression was closely related to the onset of COAD and it was a poor prognostic factor for COAD patients.

Keywords:
Colon adenocarcinoma; LRRN4; prognosis; biomarker

Clinical characteristics		Total (n=433)	Percent(%)
Age	Median[Min,Max]	68[34,90]
Gender	Male	233	53.82
	Female	200	46.18
TNM Stage	Stage I	73	16.86
	Stage II	165	38.12
	Stage III	123	28.41
	Stage IV	61	14.09
	Unknown	11	2.54
T Stage	T1	11	2.54
	T2	75	17.32
	T3	296	68.36
	T4	50	11.55
	Tis	1	0.23
N Stage	N0	254	58.66
	N1	102	23.56
	N2	77	17.78
M Stage	M0	320	73.90
	M1	61	14.09
	MX	45	10.39
	Unknown	7	1.62
Race	American indian or alaska native	1	0.23
	Asian	11	2.54
	Black or african american	56	12.93
	white	209	48.27
	Unknown	156	36.03
History of colon polyps	NO	238	54.97
	YES	128	29.56
	Unknown	67	15.47
Disease type	Adenomas and Adenocarcinomas	369	85.22
	Epithelial Neoplasms	3	0.69
	Mucinous and Serous Neoplasms	61	14.09
BMI	Median[Min,Max]	27.13[14.72,271.86]
Vital status	Alive	338	78.06
	Dead	95	21.94

Genes	Forward Primer (5’-3’)	Reverse Primer (5’-3’)	Product length (bp)	Tm(℃) (◦C)
LRRN4	CGTGGGACCGCAGCATAAGC	CCTTCCTCCTCCTCACTGTAGTCG	133	60
GAPDH	GCAAATTCCATGGCACCGTC	AGCATCGCCCCACTTGATTT	110	60

Sociedade Brasileira de Genética Rua Cap. Adelmio Norberto da Silva, 736, 14025-670 Ribeirão Preto SP Brazil, Tel.: (55 16) 3911-4130 / Fax.: (55 16) 3621-3552 - Ribeirão Preto - SP - Brazil
E-mail: editor@gmb.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Send correspondence to
Shutian Zhang. Beijing Key Laboratory for Precancerous Lesion of Digestive Disease, Beijing Digestive Disease Center, National Clinical Research Center for Digestive Disease, Capital Medical University, Beijing Friendship Hospital, Department of Gastroenterology, No. 95, Yong’an Road, Xicheng District, Beijing 100050, P. R. China. Email: zhangshutian@ccmu.edu.cn.