Abstract
Auxin regulates a plethora of events during plant growth and development, acting in concert with other phytohormones. YUCCA genes encode flavin monooxygenases that function in tryptophan-dependent auxin biosynthesis. To understand the contribution of the YUCCA4 (YUC4) gene on auxin homeostasis, plant growth and interaction with abscisic acid (ABA) signaling, 35S::YUC4 seedlings were generated, which showed elongated hypocotyls with hyponastic leaves and changes in root system architecture that correlate with enhanced auxin responsive gene expression. Differential expression of PIN1, 2, 3 and 7 auxin transporters was detected in roots of YUC4 overexpressing seedlings compared to the wild-type: PIN1 was down-regulated whereas PIN2, PIN3 and PIN7 were up-regulated. Noteworthy, 35S::YUC4 lines showed enhanced sensitivity to ABA on seed germination and post-embryonic root growth, involving ABI4 transcription factor. The auxin reporter genes DR5::GUS, DR5::GFP and BA3::GUS further revealed that abscisic acid impairs auxin responses in 35S::YUC4 seedlings. Our results indicate that YUC4 overexpression influences several aspects of auxin homeostasis and reveal the critical roles of ABI4 during auxin-ABA interaction in germination and primary root growth.
Keywords:
Arabidopsis; auxin; abscisic acid; YUCCA4; root growth; germination
Introduction
The phytohormone auxin (indole-3-acetic acid, IAA) plays a role in many aspects of plant growth and development, including cell division, growth and differentiation. It also mediates adaptation to biotic and abiotic stress (Ghanashyam and Jain, 2009; Rahman, 2013). These functions require coordinated IAA biosynthesis, degradation, conjugation, transport and signaling for which specific genes and proteins have been identified in Arabidopsis and crops. Auxin biosynthesis mainly occurs in developing tissues such as cotyledons, expanding leaves and root tips (Ljung et al., 2001), and arises via tryptophan (Trp)-independent and Trp-dependent pathways (Zhao, 2010). In the second case, Trp is first converted into indole-3-pyruvic acid by TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS1/TRYPTOPHAN AMINOTRANSFERASE RELATED (TAA1/TAR) enzymes (Kasahara, 2015). Subsequently, enzymes of the YUCCA family of flavin-containing mono-oxygenases (FMOs) catalyze the conversion of indole-pyruvic acid (IPA) into IAA. This two-step auxin biosynthesis pathway is highly conserved throughout the plant kingdom and is essential for almost all of the major developmental transitions and whole plant functioning (Zhao, 2012).
The YUC gene family has been identified in several plant species, it includes eleven members in Arabidopsis (Cheng et al., 2006), seven in rice (Yamamoto et al., 2007), six in tomato (Exposito-Rodriguez et al., 2011), eight in strawberry (Liu et al., 2014), twelve in poplar (Ye et al., 2009) and ten in cucumber (Yan et al., 2016). Disruption of a single YUC gene in Arabidopsis shows no obvious phenotypical alterations, which implicates functional redundancy. However, double, triple and quadruple mutants show abnormalities in different developmental and tissue specific contexts (Cheng et al., 2006). On the other hand, gain-of-function YUC plants exhibit phenotypes consistent with auxin overproduction. From the 11 YUC homologues in Arabidopsis, overexpression of YUCAA1,3,5,6,7,8, 9 has been studied under different contexts (Zhao et al., 2001; Woodward et al., 2005; Kim et al., 2007; Lee et al., 2012; Hentrich et al., 2013b; Chen et al., 2014a; Cha et al., 2015). However, overexpression of YUCCA4 gene and its impact on plant development has not been studied to date; a previous work only reports a line called thread, generated by activation tag inserts in Arabidopsis using the maize (Zea mays) En-I transposon system (Marsch-Martinez et al., 2002).
Auxin is distributed via two spatially separated transport pathways: in the phloem it moves by mass flow (Muday and DeLong, 2001; Michniewicz et al., 2007), while in other tissues, it is transported cell-to-cell through the PIN-FORMED (PIN) proteins, distributed differentially within cell membranes of transporting tissues (Galweiler et al., 1998; Muller et al., 1998; Krecek et al., 2009). These transport systems ensure auxin redistribution according to the cell physiological and developmental status, and at the same time enable rapid growth and patterning responses.
Auxin is perceived by TIR1 and related AFB1, AFB2 and AFB3 protein receptors, associated with the SCF complex (Benjamins and Scheres, 2008). Auxin-responsive genes are commonly activated by specific transcription factors termed auxin-response factors (ARFs) through binding to auxin response elements (AREs) present in their promoters (Chandler, 2016). By contrast, the AUX/IAA repressors, negatively regulate auxin responses via interaction with ARFs (Hagen and Guilfoyle, 2002). Auxin acts as a glue to attach the AUX/IAA proteins with SCFTIR1, resulting in ubiquitination and degradation of the AUX/IAA repressors via the proteasome (Quint and Gray, 2006).
In addition to its importance towards understanding hormonal-dependent regulation of plant growth and development, how auxin interacts with abscisic acid (ABA) is a question of growing interest owing its role in adaptation to environmental stress (Kim et al., 2013; Ke et al., 2015; Tiwari et al., 2017). ABA regulates embryo and seed development, seed dormancy, germination, senescence, vegetative growth, lateral root development, and drought tolerance (Finkelstein et al., 2002; De Smet et al., 2003). ABA synthesis takes place in vasculature, stomata and in seeds, where it promotes dormancy and blocks germination (Boursiac et al., 2013). The cells perceive ABA through various receptor families, some of them localized into the nucleus. Currently, the best established ABA signaling model involves the soluble PYR/PYL/RCAR receptors, and downstream acting PP2C phosphatases that directly regulate SnRK2 kinases, controlling the transcription factors that finally regulate expression of ABA responsive genes (Cutler et al., 2010).
Here, we generated and characterized Arabidopsis thaliana lines that overexpress the YUC4 gene under transcriptional control of the CaMV 35S promoter (35S::YUC4). An analysis of these lines enabled not only to establish the functionality of the corresponding coding sequence, but also to perform a detailed investigation on growth and development related to auxin biosynthesis and transport, and characterization of the auxin-ABA crosstalk that influences germination and early plant growth.
Materials and Methods
Generation of YUCCA4 overexpressing lines
The YUC4 coding sequence was amplified by PCR and then cloned into the vector pENTR/D-TOPO® according to the manufacturer’s protocol (Thermo-Fisher). Primers for cDNA amplification were forward 5-CAC CAT GGG CAC TTG TAG AGA A-3 and reverse 5-TCA CAT ATA CAT ATA CAC ATT GAC-3. PCR product clones were confirmed by nucleotide sequencing and mobilized by recombination into the binary vector pEarleyGate100. The resulting vector was transferred to the Agrobacterium tumefaciens strain pGV2260 to perform Agrobacterium-mediated transformation of Arabidopsis (ecotype Col-0) plants using the modified floral dip method (Martinez-Trujillo et al., 2004). T1 seedlings were selected on MS medium containing 50 μg/mL of glufosinate ammonium (BASTA). BASTA-resistant T1 seedlings were transferred to soil and allowed to self-pollinate to generate T2 plants. The resistant T2 seedlings with 3:1 segregation of resistance were transferred to soil to obtain homozygous T3 seedlings from individual lines.
Plant material and growth conditions
Arabidopsis thaliana lines used were Col-0 (WT), the transgenic Arabidopsis lines DR5::GUS (Ulmasov et al., 1997), BA3::GUS (Oono et al., 1998), HS::AXR3NT-GUS (Gray et al., 2001), ABI4::GUS (Shkolnik-Inbar and Bar-Zvi, 2010), PIN1::PIN1-GFP (Benková et al., 2003), PIN2::PIN2-GFP, PIN3::PIN3-GFP, PIN7::PIN7-GFP (Blilou et al., 2005) and the mutant line abi4 (Finkelstein, 1994), Crosses were made between reporter lines and 35S::YUC4; F3 populations from the crosses were screened for auxin overproducing phenotypes in shoots of plants harboring the marker constructs; homozygous lines were used in subsequent experiments. Seeds were surface sterilized with 95% ethanol (v/v) for 5 min and 20% bleach (v/v) for 7 min and washed five times in 1 ml of sterile distilled water. Seeds were vernalized for 2 days at 4 °C and placed into plates containing 0.2x solidified MS medium prepared with MS basal salts (Murashige and Skoog Basal Salts Mixture, Sigma Aldrich), 1% agar (Phytagar Gibco-BRL), and 1% sucrose (Sigma-Aldrich). Plates were vertically placed at an angle of 65° to allow root growth along the agar surface and to allow aerial growth of the hypocotyls, into a plant growth chamber (Percival AR-95L) with a photoperiod of 16 h of light/8 h of darkness, light intensity of 105 μmol m-2 s-1 and temperature of 22 °C.
Chemicals
NPA and ABA were purchased from Sigma and dissolved in dimethyl sulfoxide (DMSO). In control treatments, DMSO was used in equal amounts as present in the greatest concentration of each compound tested.
Analysis of growth
Arabidopsis roots and hypocotyls were analyzed using a stereoscopic microscope (Leica MZ6). Images were captured with a Samsung SCC 131-A digital color camera adapted to the microscope. Primary root length was determined for each root using a ruler. Lateral root number was determined by counting the lateral roots per seedling, and lateral root density was calculated by dividing the lateral root number by the primary root length for each analyzed seedling. Hypocotyl length was determined from images using the software NIH ImageJ version 1.48 (Schneider et al., 2012). For all experiments with WT and transgenic lines, the overall data were statistically analyzed using the SPSS 10 program.
Free IAA determination
Whole seedlings were grown on agar solidified 0.2x MS medium for 10 d, then collected and frozen in liquid N2. 100 mg of tissue was pooled per sample. IAA was quantified using the Varian Saturn 2000 GC-MS/MS system as previously described (Pollmann et al., 2009).
Histochemical analysis
For histochemical analysis of β-glucuronidase, Arabidopsis seedlings were incubated overnight at 37 °C in a GUS reaction buffer (0.5 mg mL-1 5-bromo-4-chloro-3-indolyl-β-D-glucuronide in 100 mM sodium phosphate, pH7). The stained plants were cleared with 0.24 N in 20% HCl (v/v) methanol and incubated for 60 min at 62 °C. The solution was substituted by 7% NaOH (w/v) in 60% ethanol (v/v) for 20 min at room temperature. Plants were hydrated with ethanol treatments at 40, 20 and 10% (v/v) for 24 h each, and fixed in 50% glycerol (v/v). The processed roots were placed on glass slides and sealed with commercial nail varnish. For each marker line and for each treatment, at least 15 transgenic plants were analyzed.
Seed germination assays
For germination assay, seeds from WT, 35S::YUCCA4, abi4 and abi4/35S::YUCCA4 were disinfected and placed into 0.2x MS medium supplemented with DMSO, 0.5, 1 and 2 μM ABA, and incubated in a plant growth chamber to register germination at the time when radicle was completely emerged.
Northern blotting
For RNA hybridization analysis, 10 d seedlings were grinded in liquid N2, total RNA was extracted from 50 mg of grinded tissue using TRIzol according to the manufacturers protocol (Invitrogen). RNA (10 μg) was separated in 1.2% formaldehyde agarose gel electrophoresis according to the protocol adapted from Rneasy Mini Handbook (QIAGEN), transferred to Hybond-N nylon membrane (GE Healthcare) and fixed in an UV crosslinker at 70,000 microjoules/cm2. Probes were 32P radiolabeled with α-32P dCTP (Perkin Elmer Life Science Inc.) using Klenow DNA polymerase I according to the protocol of the manufacturer (New England Biolabs). Membranes containing RNA were hybridized for 4 h with the probes tested and washed with a sodium chloride solution (7.5 mM)/sodium citrate (8.75 mM). The probe was detected after 8 h of exposure in an X-Ray film (GE Healthcare). The assayed probes were amplified by PCR reactions from DNA using the indicated oligonucleotides, YUC4 forward 5 GGAAATTCCGGTATGGAGGT 3’ and reverse 5’ GCTCAATTGGTCCGGTCTTA 3’.
Data materials availability
Plant lines reported are available for research purposes.
Results
35S::YUC4 Arabidopsis plants show phenotypes related to auxin overproduction
The cDNA of YUC4 gene was cloned under control of the constitutive CaMV 35S promoter (Figure 1A). Seventeen transformed plants from independent transformation events were selected from glufosinate ammonium (Figure 1B) and five of them were molecularly characterized (Figure 1C). To corroborate the YUC4 overexpression in all five lines RNA hybridization via Northern blotting was performed; all selected lines showed higher levels of YUC4 expression than the WT (Figure 1D). Quantification of free IAA content in seedlings of WT and the now denominated 35S::YUC4 line indicated a roughly 25% increase of IAA level in both roots and shoots (Figure 1E). The determined IAA proportion was conserved in all the lines used in this work (Figure S1).
Generation of 35S::YUC4 transgenic plants. (A) Fragment of plasmid map carrying YUC4 sequence under CaMV35S promoter. Location of forward primer on 35S and reverse on YUC4 are shown as well as length of flanking sequence. (B) Plants grown on MS media supplemented with glufosinate-ammonium and showing resistance. Bar = 1 cm. (C) PCR gel of five transformed plants (L1-5) showing bands of 2363 bp corresponding to YUC4 gene and 35S promoter. Line C shows a band from a PCR using cloned plasmid as control. (D) Northern blot indicating transcription levels of YUC4 in Col-0 and five 35S::YUC4 (L1-5) lines. (E) IAA levels in roots and shoots of Col-0 and 35S::YUC4 L1 in 10 dag plants determined by GC-MS. Bars in (E) show standard errors and different letters indicate statistical differences at P < 0.05.
Noteworthy, the 35S::YUC4 transgenic plants exhibited auxin-related phenotypes including epinastic cotyledons and elongated hypocotyls. Adult plants showed characteristic twisted cauline leaves, narrow rosette leaves with long petioles and increased apical dominance and this phenotype was common to the initially identified seventeen lines (Data not shown). 35S::YUC4 seedlings also developed longer and narrower primary roots, and produced more lateral roots that the WT. Due to this combined situation, the lateral root density of the WT and YUC4 overexpressing seedlings was comparable (Figure S2). Thus, overexpression of YUC4 promotes hypocotyl and root elongation and lead plants to develop more exploratory root systems, all consistent with changes in auxin homeostasis.
Overexpression of YUCCA4 enhances auxin responsiveness and modulates auxin transporters
To investigate if the observed changes in 35S::YUC4 seedlings could be related to an altered auxin response and/or transport, different genetic markers were mobilized into 35S::YUC4, via outcrossing. The auxin reporter gene DR5::GFP showed a higher expression in primary root tips of 35S::YUC4 seedlings than in the WT (Figure 2A, 2B). Next, we evaluated the effect of overexpression of YUC4 on Aux/IAA degradation. WT and 35S::YUC4 seedlings expressing the HS::AXR3NT-GUS (Gray et al., 2001) gene construct were heat shocked at 37 °C for 2 h. After heat shock, seedlings were incubated with and without IAA for a subsequent GUS histochemical detection. In WT seedlings, blue coloration was observed showing AXR3 localization in petioles, root vasculature and root meristem; such coloration was decreased in control treatment with IAA; a similar behavior was observed in the case of HS::AXR3NT-GUS/35S::YUC4 and the expression was further decreased with IAA (Figure 2C), those results suggest an increased degradation of AXR3 in 35S::YUC4.
The Arabidopsis thaliana 35S::YUC4 seedlings show an increased auxin response. (A) DR5::GFP in root tips of WT and DR5::GFP/35S::YUC4 seedlings, (B) Relative quantification of GFP fluorescence (n = 10 ? standard error), different letters indicate statistical differences at P < 0.05. (C) HS::AXR3NT-GUS expression in shoots and roots of WT and YUC4 overexpressing seedlings. Seedlings were germinated and grown 10d on 0.2X MS medium, transferred to 0.2X MS liquid medium and heat shocked for 2 h at 37 °C to induce expression of the transgene. Seedlings then were transferred to 20 °C medium containing mock and 2 μM IAA and incubated for 1 hr before staining for β-glucuronidase activity. Photographs show representative individuals from at least 10 stained seedlings. Scale bar in A 100 μm; scale bars in C 500 μm. The experiment was repeated three times with similar results.
PIN auxin transporters mediate IAA distribution within root tissues (Adamowski and Friml, 2015). To evaluate whether PIN auxin transporters are influenced by auxin overproduction, we crossed 35S::YUC4 plants with pollen of plants carrying PIN-GFP protein fusions (Benková et al., 2003; Vieten et al., 2005), and the expression was analyzed in roots. PIN1 is expressed at the basal side of stele and endodermis in the WT, and a reduction of its expression is observed in 35S::YUC4 seedlings (Figure 3A). PIN2 expression is localized in membranes of cortical and epidermal cells in WT plants and it was induced in 35S::YUC4 seedlings; similarly both PIN3 and PIN7 that are expressed in columella and stele of the elongation zone of the primary root showed an enhanced expression in 35S::YUC4 transgenic line (Figure 3A, 3B). From these results, we conclude that overexpression of YUC4 and its consequent auxin overproduction differentially modulate expression of PIN proteins in the Arabidopsis primary root.
Expression of PIN auxin transporters in WT and 35S::YUC4 seedlings. (A) Confocal microscopy images of WT and 35S::YUC4 seedlings showing PIN1::PIN1-GFP, PIN2::PIN2-GFP, PIN3::PIN3-GFP and PIN7::PIN-GFP fluorescence. Bar = 100 μM. (B) Quantification of relative GFP expression of PIN transporters in WT and 35S::YUC4 backgrounds. Plants were grown on MS 0.2X and analyzed at 10 d. Bars in graphics indicate standard error and different letters indicate statistical differences at P = 0.05. The analysis was repeated three times with similar results.
Inhibition of auxin transport normalizes hypocotyl elongation and auxin accumulation in 35S::YUC4 seedlings
To correlate auxin overproduction and hypocotyl elongation with auxin redistribution as a possible consequence of YUC4 overexpression, a pharmacological strategy was employed. The response to the auxin transport inhibitor 1-naphthylphthalamic acid (NPA) was compared between WT (Col-0) and 35S::YUC4 seedlings grown side by side in Petri plates containing agar solidified MS 0.2x medium supplemented with DMSO (solvent control) or 1, 2, 4 and 8 μM NPA. After 10 d, the hypocotyl length in WT seedlings remained practically equal in control and NPA treatments. However, in 35S::YUC4 seedlings a dose-dependent shortening of hypocotyls occurred, and at 8 μM NPA 35S::YUC4 hypocotyls were similar to the WT (Figure 4A, 4B). These results suggest that the higher hypocotyl elongation observed in 35S::YUC4 correlates with more auxin being transported to growth zones.
NPA decreases hypocotyl length in 35S::YUC4 seedlings. (A) WT (Col-0) and 35S::YUC4 seedlings were germinated and grown in MS 0.2X media supplemented with different NPA concentrations, representative images of control, 2 and 8 μM of NPA are shown. Bar = 1 mm. (B) Mean hypocotyl length. Error bars represent standard error from 30 seedlings analyzed. Different letters indicate means that are statistically different (P < 0.05). The experiment was repeated three times with similar results.
To understand how NPA could be affecting overall auxin response and/or distribution, we next compared the expression of DR5::GUS reporter construct in leaves and in root tips of WT and 35S::YUC4 seedlings. NPA led to an increased auxin-responsiveness in leaves and root tip of WT seedlings, which was exacerbated in 35S::YUC4 (Figure 5, Figure S3, Figure S4). Another auxin responsive promoter construct, BA3::GUS normally expressed in petioles, hypocotyl and slightly in vascular tissues of WT seedlings was also up-regulated in 35S::YUC4 background in a dose-dependent manner (Figure S5). Taken together, these data reinforce the idea that overall auxin accumulation increases as a consequence of YUC4 overexpression.
Auxin responsive gene expression is exacerbated in shoots and roots of 35S::YUC4 seedlings upon NPA treatment. DR5::GUS expression in WT and DR5::GUS/35S::YUC4 seedlings germinated and grown for 10 d on MS 0.2x medium supplemented with indicated NPA concentrations. Images show representative seedlings for each treatment (n = 15). The seedlings were processed for histochemical detection of GUS expression, cleared, and photographed. Note the dose-dependent exacerbated expression of the marker in 35S::YUC4 seedlings treated with NPA. The experiment was repeated three times with similar results.
35S::YUC4 expression up-regulates the ABI4 transcription factor
ABA signaling mediates adaptation to several stressing conditions and also accounts for growth and root architecture modulation (Tiwari et al., 2017). To assess the possible interaction of auxin overproduction in 35S::YUC4 seedlings and ABA signaling, the expression of ABI4::GUS, an ABA-related reporter gene that reflects the endogenous ABI4 transcript level (Bossi et al., 2009; Soderman et al., 2000) was evaluated. GUS expression was monitored 1 to 7 d after germination on ABI4::GUS and 35S::YUC4/ABI4::GUS seedlings grown under standard conditions. GUS expression was evident in WT seedlings since the first day, reaching a maximum by day 2 then gradually decreasing in the subsequent days until practically disappearing on day. Interestingly, in 35S::YUC4 seedlings GUS expression was increased during the kinetic experiment and remained detectable even at day 7 on cotyledons and hypocotyl. In root tips, ABI4::GUS expression was also stronger in 35S::YUC4 seedlings than in the WT. However, in both cases it decreased and even disappeared at comparable times (4 and 7 days, respectively; Figure 6). These observations suggest that overexpression of YUC4 affect ABA signaling through ABI4 at early stages of plant development.
ABI4::GUS expression in WT and 35S::YUC4 seedlings. ABI4::GUS and ABI4::GUS/35S::YUC4 seedlings were grown for 7 days and histochemical detection of GUS activity performed daily. Photographs show representative hypocotyls and roots of at least 15 stained seedlings. The experiment was repeated three times with similar results.
ABA antagonizes auxin response in WT and 35S::YUC4 seedlings
ABA antagonizes auxin signaling during the formation of lateral roots (De Smet et al., 2003). To test if ABA could affect auxin-inducible gene expression in the shoot and roots systems, the expression of DR5::GUS and BA3::GUS was assessed in transfer experiments of WT and 35S::YUC4 seedlings grown in medium supplemented with DMSO (control), 10 or 20 μM ABA. An ABA-dependent inhibition of DR5::GUS and BA3::GUS was clearly observed in the WT and 35S::YUC4 (Figure 7), suggesting that ABA antagonizes auxin responsive gene expression in shoots and in roots.
ABA impairs auxin-inducible gene expression in shoots and roots. DR5::GUS and BA3::GUS gene expression in WT and 35S::YUC4 seedlings germinated and grown for 5 d in agar solidified 0.2x MS medium, then transferred for 5 additional days to fresh medium supplemented with the solvent, 10 or 20 μM ABA. Seedlings were stained for GUS activity and cleared for microscopical analysis. Photographs show representative shoots and roots from at least 15 stained plants. The experiment was repeated three times with similar results.
35S::YUC4 seedlings are hypersensitive to ABA
ABA inhibits both germination and primary root growth (Gimeno-Giles et al., 2009; Luo et al., 2014), making these responses useful to characterize its potential interaction with auxin via YUC4. So, we outcrossed 35S::YUC4 with the abi4 mutant to further analyze a possible genetic relationship between auxin and ABA signaling mediated by YUC4. WT, 35S::YUC4, abi4 and abi4/35S::YUC4 seedlings were grown side by side over agar-solidified 0.2x MS medium, supplemented with DMSO or increasing ABA concentrations. Six days after germination plants were analyzed and found that when germinated and grown on control medium, all genotypes behaved similarly (Figure 8A). However, 35S::YUC4 seedlings are hypersensitive to 1 and 2 μM ABA that inhibited primary root growth in the WT, (Figure 8A). As expected, abi4 mutants were less sensitive to ABA and developed longer primary roots than the WT, whereas abi4/35S::YUC4 displayed a root length comparable to the WT at higher ABA concentrations.
ABI4 loss of function reduces 35S::YUC4 root hypersensitivity to ABA. (A) Representative images of plates with Arabidopsis lines Col-0, 35S::YUC4, abi4 and abi4/35S::YUC4 sown on MS media supplemented with the solvent or indicated ABA concentrations. (B) Root length of 6 dag WT, 35S::YUC4, abi4 and abi4/35S::YUC4 at 0, 0.25. 0.5, 1 and 2 μM ABA. Error bars represent standard errors from 15 seedlings analyzed and letters indicate means that are statistically different (P < 0.05). The experiment was repeated three times with similar results.
To examine the impact that ABA could have on the WT and 35S::YUC4 seedlings on germination, 100 seeds of WT, 35S::YUC4, abi4 and abi4/35S::YUC4 were sown on MS plates containing DMSO, or 0.5, 1 and 2 μM of ABA. Plates were placed in darkness and radicle protrusion was evaluated every eight hours until all seeds germinated. In control medium, WT, abi4 and abi4/35S::YUC4 germinated in around 56 h meanwhile 35S::YUC4 showed a slight delay in germination (Figure 9A). When seeds were sown in medium supplemented with 0.5, 1 and 2 μM ABA, a delayed germination in all four lines already occurred, but interestingly abi4 and 35S::YUC4 had the opposite performance, germinating earlier or later, respectively, when compared to the WT and abi4/35S::YUC4 (Figure 9B-D). These results demonstrate the critical role of ABI4 in mediating an auxin-ABA crosstalk for primary root growth and germination.
Effects of ABA on germination. Arabidopsis seeds of Col-0, abi4, 35S::YUC4 and abi4/35S::YUC4 were sown on MS plates containing different ABA concentrations: (A) Mock, (B) 0.5 μM, (C) 1 μM and (D) 2 μM ABA. Radicle protrusion of 100 seedlings of each line was registered every 8 hours. Note the contrasting effects of the ABA over 35S::YUCCA4 and abi4 seedlings. The experiment was repeated three times with similar results.
Discussion
In this work, five 35S::YUC4 Arabidopsis lines were characterized, which showed elevated transcript of YUC4 and up to 25% greater IAA levels than the WT, similar to previous reports in which other members of the YUC family were overexpressed (Zhao et al., 2001; Hentrich et al., 2013a). The phenotype observed in 35S::YUC4 included changes in shoots and roots, and were typified by an enhancement of growth. The alterations in root architecture included the formation of longer primary roots with more lateral roots, and to the best of our knowledge, have been not previously reported. Thus, via increasing the endogenous auxin pool more exploratory root systems can be developed.
The auxin-inducible DR5::GUS gene construct is expressed in the quiescent center, the adjacent columella cells and root cap (Sabatini et al., 1999). Such expression pattern was found in WT, but in 35S::YUC4 seedlings there was an increased DR5 induction. In addition, the HS::AXR3NT-GUS construct was more rapidly degraded in 35S::YUC4 seedlings. Altogether, these results demonstrate the relationship of the 35S::YUC4 phenotype, degradation of the AUX/IAA AXR3 repressor and the underlying auxin-response in roots and in shoots.
Auxin regulates PIN levels and re-localization (Vieten et al., 2005; Omelyanchuk et al., 2016). In our research, a decreased PIN1::PIN1-GFP expression in 35S:YUC4 lines, indicates that auxin overproduction down-regulates PIN1; in contrast, PIN2, PIN3 and PIN7 were up-regulated in 35S::YUC4 seedlings in a tissue-specific context, in concordance with the induction already reported for these transporters by auxin treatment (Vieten et al., 2005; Lewis et al., 2011). A dual role for auxin in the regulation of both PIN transcription and degradation has been proposed, since application of high auxin concentrations decreases PIN7::GFP and PIN2::GFP signal intensity, whereas at low concentrations, the PIN2 and PIN7 protein amounts are increased (Vieten et al., 2005). Our results show that the 35S:YUC4 significantly increases the endogenous auxin pool, which in roots is high enough to differentially regulate PIN proteins.
Auxin is mainly synthesized in the shoot apex and then transported to the stem and root systems where it regulates growth and tropisms (Spalding, 2013). Although plants that overproduce auxin have long hypocotyls, this effect cannot be mimicked by exogenous application of IAA or synthetic analogs to WT plants. The possibility that an increased auxin transport could be responsible for greater hypocotyl elongation in 35S::YUC4 seedlings is supported from data obtained from the use of NPA, an auxin transport inhibitor, which diminished hypocotyl length in the YUC4 overexpressors in a dose-dependent manner until the plants attained similar hypocotyl lengths to the untreated WT seedlings. These data suggests that the increased auxin production in the 35S:YUC4 lines inherently changes auxin redistribution, causing elongation of hypocotyls. Consistently, in a recent report NPA antagonized the shade-induced hypocotyl elongation in Arabidopsis, presumably because free IAA is prevented from being transported to the growth zones (Zhao, 2018), but also causes IAA accumulation in shoot and root apical meristems (Casimiro et al., 2001; Himanen et al., 2002; Nishimura et al., 2012).
To clarify how auxins are distributed before and after the application of NPA in WT and 35S::YUC4 seedlings, the DR5::GUS, DR5::GFP and BA3::GUS construct were used. Auxin-driven expression of these constructs was more evident in leaf margins as well as root meristems as a response to NPA treatments, as such DR5::GUS histochemical detection was most remarkable in the 35S::YUC4 seedlings, suggesting that auxin accumulates in vascular bundles until filling the whole leaf al high NPA concentrations. Moreover, in the root meristem a characteristic widening of the root was caused by NPA consistent with previous reports (Sabatini et al., 1999; Casimiro et al., 2001), this being more noticeable for 35S::YUC4 seedlings. BA3::GUS expression also increased in the 35S::YUC4 lines principally in vascular tissues, and under NPA treatment auxin response exacerbated in leaf veins and root meristem.
The ABI4 gene encodes an AP2/ERF transcription factor that is expressed in discrete developmental windows, mainly during seed maturation and in young seedlings after germination, during the establishment of autotrophic growth (Finkelstein et al., 1998; Soderman et al., 2000; Arroyo et al., 2003; Shkolnik-Inbar and Bar-Zvi, 2011). Noteworthy, we found an increased expression of ABI4::GUS in 35S::YUC4 seedlings. Although it was described that ABI4 expression is repressed by auxin in roots (Bossi et al., 2009; Shkolnik-Inbar and Bar-Zvi, 2010), the difference with our work is probably due to the different experimental conditions employed; while others exposed plants to high exogenous auxin concentrations during few hours, we tested ABI4 expression in 35S::YUC4 lines, with moderate and sustained increase in endogenous concentrations of auxin.
Increasing evidence shows that ABA possesses dual functions acting as a growth inhibitor at high concentrations and as a growth promoter at low concentrations. ABA treatment appears to reduce auxin biosynthesis or reduce auxin signaling via decreasing IAA2, and concomitantly, DR5 expression is reduced (Wang et al., 2011; He et al., 2012). We observed that ABA dramatically decreases DR5::GUS and BA3::GUS expression in shoots and roots of 35S::YUC4 seedlings. This result reinforces the notion of an antagonist role of ABA decreasing auxin biosynthesis, signaling or both these processes.
ABA regulates root elongation through the activities of auxin and ethylene in Arabidopsis (Thole et al., 2014; Rowe et al., 2016). An ABA element involved in root architecture regulation is ABI4; abi4 mutants develop increased numbers of lateral roots, and ABI4-overexpressing plants have a reduced number of lateral roots (Shkolnik-Inbar and Bar-Zvi, 2010). In our experiments, increasing ABA concentrations, delay primary root growth in a dose-dependent manner in WT plants. Moreover a strong hypersensitivity to ABA on seedling growth was observed in 35S::YUC4, indicating that increased content of endogenous auxin acts in a synergic manner with ABA to repress root growth. On the other hand, abi4 mutants showed resistance to ABA inhibitory effect, while abi4/35S::YUC4 showed similar root elongation to the WT, demonstrating that 35S::YUC4 hypersensitivity to ABA during early root growth involves the ABI4 transcription factor.
The increased expression of ABI4::GUS in 35S::YUC4 seedlings could be an important factor for delayed germination in the auxin overproducing line; to test this, we performed germination assays under increasing ABA concentrations, observing that 35S::YUC4 germinated at a later time in agreement with a previous report, where Arabidopsis plants overexpressing YUC genes from wheat also underwent delayed germination (Li et al., 2014). Besides, when ABA concentrations increased, delayed germination was more noticeable in 35S::YUC4; in contrast abi4 showed resistance to ABA on germination. Previously, abi4 was shown to be insensitive to auxin and resistant to its combination with ABA during germination (Chen et al., 2014b). Accordingly, in our work, abi4/35S::YUC4 showed similar germination times to the WT, indicating that ABI4 is a required factor for ABA hypersensitivity of 35S::YUC4 during germination, being a convergence element in ABA and auxin mediated control of germination.
The mechanism of interaction between auxins and the ABA is still not fully understood. Previous studies indicate that ABA inhibits seedling growth through enhancing auxin signaling, and the role of auxin signaling elements in ABA responses had been described (Wilson et al., 1990; Fukaki et al., 2002; Tiryaki and Staswick, 2002; Belin et al., 2009; Wang et al., 2011; Rinaldi et al., 2012; Thole et al., 2014). On the other hand, high levels of auxinic compounds enhance the ABA inhibition of germination; besides, ABA elements including ABI3, ABI4 and ABI5 are important regulators of auxin-mediated inhibition of seed germination (Tognetti et al., 2010; Liu et al., 2013; Chen et al., 2014b,c).
Here, we generated a new 35::YUCCA line to provide more information about physiology of auxin producer plants and we use it as a tool to address the auxin-ABA interaction. Our data strengthen the notion that elevated endogenous auxin levels influence the regulation of seed dormancy, germination and post-embryonic growth in Arabidopsis, and functional evidence is provided that ABI4 is involved in an ABA-auxin interaction important for germination and root growth. The generation and management of knowledge about phytohormone biosynthesis, homeostasis and interactions should assist in developing new tools towards a much needed improvement of certain agronomic traits.
Acknowledgments
This work was financially supported by grants from Consejo Nacional de Ciencia y Tecnología (CONACYT, México, Grant No. 177775) and the Consejo de la Investigación Científica UMSNH (CIC 2.26) to J.L-B. A-G.M.R. is indebted to CONACYT for a Ph. D. fellowship.
Conflict of Interest
The authors declare that there is no conflict of interest that could be perceived as prejudicial to the impartiality of the reported research.
Authors Contributions
AGMR, JLB, NMM, JSLB, AAGG and MMT designed experiments; AGMR, JSLB, ROC and LFRH performed experiments; MMT, NMM. and JLB analyzed data; AGMR, JLB and MMT wrote the manuscript. All authors read and approved the manuscript.
References
- Adamowski M and Friml J (2015) PIN-dependent auxin transport: action, regulation, and evolution. Plant Cell 27:20-32.
- Arroyo A, Bossi F, Finkelstein RR and Leon P (2003) Three genes that affect sugar sensing (abscisic acid insensitive 4, abscisic acid insensitive 5, and constitutive triple response 1) are differentially regulated by glucose in Arabidopsis. Plant Physiol 133:231-242.
- Belin C, Megies C, Hauserova E and Lopez-Molina L (2009) Abscisic acid represses growth of the Arabidopsis embryonic axis after germination by enhancing auxin signaling. Plant Cell 21:2253-2268.
- Benjamins R and Scheres B (2008) Auxin: the looping star in plant development. Annu Rev Plant Biol 59:443-465.
- Benková E, Michniewicz M, Sauer M, Teichmann T, Seifertova D, Jürgens G and Friml J (2003) Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell 115:591-602.
- Blilou I, Xu J, Wildwater M, Willemsen V, Paponov I, Friml J, Heidstra R, Aida M, Palme K and Scheres B (2005) The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature 433:39-44.
- Bossi F, Cordoba E, Dupre P, Mendoza MS, Roman CS and Leon P (2009) The Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as a central transcription activator of the expression of its own gene, and for the induction of ABI5 and SBE2.2 genes during sugar signaling. Plant J 59:359-374.
- Boursiac Y, Leran S, Corratge-Faillie C, Gojon A, Krouk G and Lacombe B (2013) ABA transport and transporters. Trends Plant Sci 18:325-333.
- Casimiro I, Marchant A, Bhalerao RP, Beeckman T, Dhooge S, Swarup R, Graham N, Inzé D, Sandberg G, Casero PJ et al. (2001) Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell 13:843-852.
- Cha JY, Kim WY, Kang SB, Kim JI, Baek D, Jung IJ, Kim MR, Li N, Kim HJ, Nakajima M et al. (2015) A novel thiol-reductase activity of Arabidopsis YUC6 confers drought tolerance independently of auxin biosynthesis. Nat Commun 6:8041.
- Chandler JW (2016) Auxin response factors. Plant Cell Environ 39:1014-1028.
- Chen Q, Dai X, De-Paoli H, Cheng Y, Takebayashi Y, Kasahara H, Kamiya Y and Zhao Y (2014a) Auxin overproduction in shoots cannot rescue auxin deficiencies in Arabidopsis roots. Plant Cell Physiol 55:1072-1079.
- Chen C, Twito S and Miller G (2014b) New cross talk between ROS, ABA and auxin controlling seed maturation and germination unraveled in APX6 deficient Arabidopsis seeds. Plant Signal Behav 9:e976489.
- Chen C, Letnik I, Hacham Y, Dobrev P, Ben-Daniel BH, Vanková R, Amir R and Miller G (2014c) ASCORBATE PEROXIDASE6 protects Arabidopsis desiccating and germinating seeds from stress and mediates cross talk between reactive oxygen species, abscisic acid, and auxin. Plant Physiol 166:370-383.
- Cheng Y, Dai X and Zhao Y (2006) Auxin biosynthesis by the YUCCA flavin monooxygenases controls the formation of floral organs and vascular tissues in Arabidopsis. Genes Dev 20:1790-1799.
- Cutler SR, Rodriguez PL, Finkelstein RR and Abrams SR (2010) Abscisic acid: emergence of a core signaling network. Annu Review Plant Biol 61:651-679.
- De Smet I, Signora L, Beeckman T, Inze D, Foyer CH and Zhang H (2003) An abscisic acid-sensitive checkpoint in lateral root development of Arabidopsis. Plant J 33:543-555.
- Exposito-Rodriguez M, Borges AA, Borges-Perez A and Perez JA (2011) Gene structure and spatiotemporal expression profile of tomato genes encoding YUCCA-like flavin monooxygenases: the ToFZY gene family. Plant Physiol Biochem 49:782-791.
- Finkelstein RR (1994) Mutations at two new Arabidopsis ABA response loci are similar to the abi3 mutations. Plant J 5:765-771.
- Finkelstein RR, Gampala SS and Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell 14:S15-S45.
- Finkelstein RR, Wang ML, Lynch TJ, Rao S and Goodman HM (1998) The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell 10:1043-1054.
- Fukaki H, Tameda S, Masuda H and Tasaka M (2002) Lateral root formation is blocked by a gain-of-function mutation in the SOLITARY-ROOT/IAA14 gene of Arabidopsis. Plant J 29:153-168.
- Galweiler L, Guan C, Muller A, Wisman E, Mendgen K, Yephremov A and Palme K (1998) Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science 282:2226-2230.
- Ghanashyam C and Jain M (2009) Role of auxin-responsive genes in biotic stress responses. Plant Signal Behav 4:846-848.
- Gimeno-Gilles C, Lelièvre E, Viau L, Malik-Ghulam M, Ricoult C, Niebel A, Leduc N and Limami AM (2009) ABA-mediated inhibition of germination is related to the inhibition of genes encoding cell-wall biosynthetic and architecture: modifying enzymes and structural proteins in Medicago truncatula embryo axis. Mol Plant 2:108-119.
- Gray WM, Kepinski S, Rouse D, Leyser O and Estelle M (2001) Auxin regulates SCF(TIR1)-dependent degradation of AUX/IAA proteins. Nature 414:271-276.
- Hagen G and Guilfoyle T (2002) Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol Biol 49:373-385.
- He J, Duan Y, Hua D, Fan G, Wang L, Liu Y, Chen Z, Han L, Qu LJ and Gong Z (2012) DEXH box RNA helicase-mediated mitochondrial reactive oxygen species production in Arabidopsis mediates crosstalk between abscisic acid and auxin signaling. Plant Cell 24:1815-1833.
- Hentrich M, Böttcher C, Düchting P, Cheng Y, Zhao Y, Berkowitz O, Masle J, Medina J and Pollmann S (2013a) The jasmonic acid signaling pathway is linked to auxin homeostasis through the modulation of YUCCA8 and YUCCA9 gene expression. Plant J 74:626-637.
- Hentrich M, Sánchez-Parra B, Pérez Alonso MM, Carrasco Loba V, Carrillo L, Vicente-Carbajosa J, Medina J and Pollmann S (2013b) YUCCA8 and YUCCA9 overexpression reveals a link between auxin signaling and lignification through the induction of ethylene biosynthesis. Plant Signal Behav 8:e26363.
- Himanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inzé D and Beeckman T (2002) Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14:2339-2351.
- Kasahara H (2015) Current aspects of auxin biosynthesis in plants. Biosci Biotechnol Biochem 80:34-42.
- Kim JI, Sharkhuu A, Jin JB, Li P, Jeong JC, Baek D, Lee SY, Blakeslee JJ, Murphy AS, Bohnert HJ et al. (2007) yucca6, a dominant mutation in Arabidopsis, affects auxin accumulation and auxin-related phenotypes. Plant Physiol 145:722-735.
- Kim JI, Murphy AS, Baek D, Lee SW, Yun DJ, Bressan RA and Narasimhan ML (2011) YUCCA6 over-expression demonstrates auxin function in delaying leaf senescence in Arabidopsis thaliana J Exp Bot 62:3981-3992.
- Kim JI, Baek D, Park HC, Chun HJ, Oh DH, Lee MK, Cha JY, Kim WY, Kim M and Chung WS (2013) Overexpression of Arabidopsis YUCCA6 in potato results in high auxin developmental phenotypes and enhanced resistance to water deficit. Mol Plant 6:337-349.
- Ke Q, Wang Z, Ji CY, Jeong JC, Lee HS, Li H, Xu B, Deng X and Kwak SS (2015) Transgenic poplar expressing Arabidopsis YUCCA6 exhibits auxin-overproduction phenotypes and increased tolerance to abiotic stress. Plant Physiol Biochem 94:19-27.
- Krecek P, Skupa P, Libus J, Naramoto S, Tejos R, Friml J and Zazimalova E (2009) The PIN-FORMED (PIN) protein family of auxin transporters. Genome Biol 10:249.
- Lee M, Jung JH, Han DY, Seo PJ, Park WJ and Park CM (2012) Activation of a flavin monooxygenase gene YUCCA7 enhances drought resistance in Arabidopsis. Planta 235:923-938.
- Lewis DR, Negi S, Sukumar P and Muday GK (2011) Ethylene inhibits lateral root development, increases IAA transport and expression of PIN3 and PIN7 auxin efflux carriers. Development 138:3485-3495.
- Li N, Yin N, Niu Z, Hui W, Song J, Huang C, Wang H, Kong L and Feng D (2014) Isolation and characterization of three TaYUC10genes from wheat. Gene 546:187-194.
- Liu H, Xie WF, Zhang L, Valpuesta V, Ye ZW, Gao QH and Duan K (2014) Auxin biosynthesis by the YUCCA6 flavin monooxygenase gene in woodland strawberry. J Int Plant Biol 56:350-363.
- Liu X, Zhang H, Zhao Y, Feng Z, Li Q, Yang HQ, Luan S, Li J and He ZH (2013) Auxin controls seed dormancy through stimulation of abscisic acid signaling by inducing ARF-mediated ABI3 activation in Arabidopsis. Proc Natl Acad Sci U S A 110:15485-15490.
- Ljung K, Bhalerao RP and Sandberg G (2001) Sites and homeostatic control of auxin biosynthesis in Arabidopsis during vegetative growth. Plant J 28:465-474.
- Luo X, Chen Z, Gao J and Gong Z (2014) Abscisic acid inhibits root growth in Arabidopsis through ethylene biosynthesis. Plant J 79:44-55.
- Marsch-Martinez N, Greco R, Van Arkel G, Herrera-Estrella L and Pereira A (2002) Activation tagging using the En-I maize transposon system in Arabidopsis. Plant Physiol 129:1544-1556.
- Martinez-Trujillo M, Limones-Briones V, Cabrera-Ponce JL and Herrera-Estrella L (2004) Improving transformation efficiency of Arabidopsis thaliana by modifying the floral dip method. Plant Mol Biol Rep 22:63-70.
- Michniewicz M, Brewer PB and Friml J (2007) Polar auxin transport and asymmetric auxin distribution. Arabidopsis Book 5:e0108.
- Muday GK and DeLong A (2001) Polar auxin transport: controlling where and how much. Trends Plant Sci 6:535-542.
- Müller A, Guan C, Gälweiler L, Tänzler P, Huijser P, Marchant A, Parry G, Bennett M, Wisman E and Palme K (1998) AtPIN2 defines a locus of Arabidopsis for root gravitropism control. EMBO J 17:6903-6911.
- Nishimura T, Matano N, Morishima T, Kakinuma C, Hayashi K, Komano T, Kubo M, Hasebe M, Kasahara H, Kamiya Y et al. (2012) Identification of IAA transport inhibitors including compounds affecting cellular PIN trafficking by two chemical screening approaches using maize coleoptile systems. Plant Cell Physiol 53:1671-1682.
- Omelyanchuk NA, Kovrizhnykh VV, Oshchepkova EA, Pasternak T, Palme K and Mironova VV (2016) A detailed expression map of the PIN1 auxin transporter in Arabidopsis thaliana root. BMC Plant Biol 16 Suppl 1:5.
- Oono Y, Chen QG, Overvoorde PJ, Kohler C and Theologis A (1998) age Mutants of Arabidopsis exhibit altered auxin-regulated gene expression. Plant Cell 10:1649-1662.
- Pollmann S, Duchting P and Weiler EW (2009) Tryptophan-dependent indole-3-acetic acid biosynthesis by ‘IAA-synthase’ proceeds via indole-3-acetamide. Phytochemistry 70:523-531.
- Quint M and Gray WM (2006) Auxin signaling. Curr Opin Plant Biol 9:448-453.
- Rahman A (2013) Auxin: a regulator of cold stress response. Physiol Plant 147:28-35.
- Rinaldi MA, Liu J, Enders TA, Bartel B and Strader LC (2012) A gain-of-function mutation in IAA16 confers reduced responses to auxin and abscisic acid and impedes plant growth and fertility. Plant Mol Biol 79:359-373.
- Rowe JH, Topping JF, Liu J and Lindsey K (2016) Abscisic acid regulates root growth under osmotic stress conditions via an interacting hormonal network with cytokinin, ethylene and auxin. New Phytol 211:225-239.
- Sabatini S, Beis D, Wolkenfelt H, Murfett J, Guilfoyle T, Malamy J, Benfey P, Leyser O, Bechtold N, Weisbeek P et al. (1999) An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root. Cell 99:463-472.
- Schneider CA, Rasband WS and Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9:671-675.
- Shkolnik-Inbar D and Bar-Zvi D (2010) ABI4 mediates abscisic acid and cytokinin inhibition of lateral root formation by reducing polar auxin transport in Arabidopsis. Plant Cell 22:3560-3573.
- Shkolnik-Inbar D and Bar-Zvi D (2011) Expression of ABSCISIC ACID INSENSITIVE 4 (ABI4) in developing Arabidopsis seedlings. Plant Signal Behav 6:694-696.
- Soderman EM, Brocard IM, Lynch TJ and Finkelstein RR (2000) Regulation and function of the Arabidopsis ABA-insensitive4 gene in seed and abscisic acid response signaling networks. Plant Physiol 124:1752-1765.
- Spalding EP (2013) Diverting the downhill flow of auxin to steer growth during tropisms. Amer J Bot 100:203-214.
- Thole JM, Beisner ER, Liu J, Venkova SV and Strader LC (2014) Abscisic acid regulates root elongation through the activities of auxin and ethylene in Arabidopsis thaliana. G3 (Bethesda) 4:1259-1274.
- Tiryaki I and Staswick PE (2002) An Arabidopsis mutant defective in jasmonate response is allelic to the auxin-signaling mutant axr1 Plant Physiol 130:887-894.
- Tiwari S, Lata C, Chauhan PS, Prasad V and Prasad M (2017) A functional genomic perspective on drought signalling and its crosstalk with phytohormone-mediated signalling pathways in plants. Curr Genomics 18:469-482.
- Tognetti VB, Van Aken O, Morreel K, Vandenbroucke K, van de Cotte B, De Clercq I, Chiwocha S, Fenske R, Prinsen E, Boerjan W et al. (2010) Perturbation of indole-3-butyric acid homeostasis by the UDP-glucosyltransferase UGT74E2 modulates Arabidopsis architecture and water stress tolerance. Plant Cell 22:2660-2679.
- Ulmasov T, Murfett J, Hagen G and Guilfoyle TJ (1997) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9:1963-1971.
- Vieten A, Vanneste S, Wisniewska J, Benková E, Benjamins R, Beeckman T, Luschnig C and Friml J (2005) Functional redundancy of PIN proteins is accompanied by auxin-dependent cross-regulation of PIN expression. Development 132:4521-4531.
- Wang L, Hua D, He J, Duan Y, Chen Z, Hong X and Gong Z (2011) Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis. PLoS Genet 7:e1002172.
- Wilson AK, Pickett FB, Turner JC and Estelle M (1990) A dominant mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic acid. Mol Gen Genet 222:377-383.
- Woodward C, Bemis SM, Hill EJ, Sawa S, Koshiba T and Torii KU (2005) Interaction of auxin and ERECTA in elaborating Arabidopsis inflorescence architecture revealed by the activation tagging of a new member of the YUCCA Family putative flavin monooxygenases. Plant Physiol 139:192-203.
- Yamamoto Y, Kamiya N, Morinaka Y, Matsuoka M and Sazuka T (2007) Auxin biosynthesis by the YUCCA genes in rice. Plant Physiol 143:1362-1371.
- Yan S, Che G, Ding L, Chen Z, Liu X, Wang H, Zhao W, Ning K, Zhao J, Tesfamichael K et al. (2016) Different cucumber CsYUC genes regulate response to abiotic stresses and flower development. Sci Rep 6:20760.
- Ye X, Kang BG, Osburn LD, Li Y and Zong-Ming C (2009) Identification of the flavin-dependent monooxygenase-encoding YUCCA gene family in Populus trichocarpa and their expression in vegetative tissues and in response to hormone and environmental stresses. Plant Cell Tissue Organ Cult 97:271-283.
- Zhao Y, Christensen SK, Fankhauser C, Cashman JR, Cohen JD, Weigel D and Chory J (2001) A role for flavin monooxygenase-like enzymes in auxin biosynthesis. Science 291:306-309.
- Zhao Y (2010) Auxin biosynthesis and its role in plant development. Annu Rev Plant Biol 61:49-64.
- Zhao Y (2012) Auxin biosynthesis: a simple two-step pathway converts tryptophan to indole-3-acetic acid in plants. Mol Plant 5:334-338.
- Zhao Y (2018) Essential roles of local auxin biosynthesis in plant development and in adaptation to environmental changes. Annu Rev Plant Biol 69:417-435.
Supplementary material
The following online material is available for this article:
Figure S1
Figure S2
Figure S3
Figure S4









