Morphological and molecular characterization of Pleopodias species (Isopoda, Cymothoidae) collected from Japanese waters

Abstract

Cymothoidae are parasitic isopods that infest fishes inhabiting marine, brackish, and freshwater environments. The cymothoids of the genus Pleopodias Richardson, 1910 are crustaceans that parasitize on the body surface of fish. Four species are known in the genus, of which Pleopodias diaphus Avdeev, 1975 is the only species recorded from Japanese waters. In this study, morphological observations and molecular analyses based on cytochrome c oxidase subunit I and 16S rRNA sequences were conducted on P. diaphus and Pleopodias sp. from Diaphus schmidti Tåning, 1932. Pleopodias diaphus and Pleopodias sp. were included in the same clade in the 16S rRNA tree, but there was a 16.14% genetic difference between the two species, so Pleopodias sp. may be an unrecorded species in Japan. In this study, molecular biological analysis of Pleopodias was provided for the first time. In the phylogenetic tree, Pleopodias diverged earlier than other cymothoid species that are externally attaching species, so it is possible that it is closer to the ancestor of externally attaching species.

Keywords:
Fish parasite; morphological features; parasitic isopod; phylogenetic tree; Pleopodias diaphus

INTRODUCTION

The family Cymothoidae is a group of crustaceans that mainly parasitize the branchial cavity, buccal cavity, abdominal cavity, or external body surfaces of fish (Smit et al., 2014). Recently, DNA information on Cymothoidae has begun to accumulate, and it is being used in molecular phylogenetic analysis (Hata et al., 2017), as well as for species identification of immature individuals with underdeveloped taxonomic traits. However, there are still many species for which the nucleotide sequence is unknown, and there is also a lot of data in DNA databases for which the basis for species identification is unclear (Shen et al., 2013). For this reason, there is a need to accumulate DNA information for individuals that have been reliably identified and linked to morphological information.

The cymothoid genus PleopodiasRichardson, 1910 (Crustacea: Isopoda) comprises four species: Pleopodias diaphusAvdeev, 1975, Pleopodias elongatusRichardson, 1910 (type species), Pleopodias nielbruceiHadfield and Smit, 2017, and Pleopodias vigilansRichardson, 1911. Only P. diaphus, which is known from around Japan, has a known host, and this species is known to parasitize Diaphus caeruleus (Klunzinger, 1871) (Myctophiformes: Myctophidae) (Avdeev, 1975). Pleopodias is an externally attaching cymothoid, and there are also AmblycephalonPillai, 1954, AnilocraLeach, 1818, BambalocraBruce, Welicky, Hadfield and Smit, 2019, CreniolaBruce, 1987, Nerocila Leach, 1818, PlotorSchioedte and Meinert, 1881, and RenocilaMiers, 1880 (Bruce et al., 2019). Pleopodias can be identified from other genera by the long antennae, with the antennula shorter than the antenna, narrow pleon with the width of the pleonites decreasing from pleonite 1 to 5, pereopod 7 longer and more elongate than other pereopods, uropods extending past the posterior margin of the pleotelson, and a longer than wide pleotelson (Hadfield and Smit, 2017). In addition, only Anilocra, Nerocila, and Renocila of the externally attaching genera, have DNA information in GenBank.

In this study, we conducted morphological observations and molecular analysis of two species of Pleopodias and examined the phylogenetic relationships between this genus and other species in the family Cymothoidae.

MATERIAL AND METHODS

A non-ovigerous female of P. diaphus was collected by beam trawl (3 m width) using the research vessel “Nagasaki-Maru” in the East China Sea off Okinawa (depth: 343-345 m, substrate: sandy mud) on 20 November 2009. A transitional stage of Pleopodias sp. was obtained from Diaphus schmidtiTåning, 1932 caught in a fixed net off Odawara, Kanagawa, Japan on 25 November 2022.

The morphological descriptions were made with the aid of a Nikon SMZ800 (Tokyo, Japan) stereomicroscope with a Nikon P-IDT drawing tube. The drawings were digitally inked using Adobe Illustrator 2024 (version 28.4.1) (San Jose, CA, USA) and a Wacom DTC133 pen display (Saitama, Japan). The measurements and terminology essentially follow Hadfield and Smit (2017). The specimens are deposited in the Seto Marine Biological Laboratory (SMBL), Field Science Education and Research Center, Kyoto University.

DNA was extracted from the left pleopods 4 or 5 of the cymothoids using the alkaline lysis method according to the recommended protocol for Toyobo KOD FX Neo DNA polymerase (Osaka, Japan). The pleopods were mixed with 45 µL of NaOH (50 mM) and incubated at 95 °C for 10 min. Each tube containing 5 µL of Tris-HCl (1 M, pH 8.0) was extensively vortexed and centrifuged at 12,000 rpm for 5 min. The supernatant (DNA) was separated and frozen at -30 °C until used in PCR. The cytochrome c oxidase subunit I (COI) was amplified using the primers LCO1490 (5′- GGTCAACAAATCATAAAGATATTGG3′) and HCO2198 (5′TAAACTTCAGGGTGACCAAAAAATCA3′) (Folmer et al., 1994). The 16S rRNA region was amplified using the primers 16Sar (5'-CGCCTGTTTAACAAAAACAT-3') and 16Sbr (5'-CCGGTCTGAACTCAGATCATGT-3') (Simon et al., 1994). The total volume for each PCR was 8.1 μL, which was composed of 1 μL of DNA, 0.78 μL of ultra-pure water, 4.06 μL of 2× PCR buffer, 1.62 μL of dNTP mix, 0.24 μL of each primer (10 μM solutions), and 0.16 μL of KOD FX Neo DNA polymerase. The PCR conditions for COI were step-down PCR, with an initial denaturation step of 94.0 °C for 2 min; 5 cycles of 98.0 °C for 10 sec, 50.5 °C for 30 sec, 68.0 °C for 45 sec; 5 cycles of 98.0 °C for 10 sec, 47.5 °C for 30 sec, 68.0 °C for 45 sec; 5 cycles of 98.0 °C for 10 sec, 44.5 °C for 30 sec, 68.0 °C for 45 sec; 20 cycles of 98.0 °C for 10 sec, 42.5 °C for 30 sec, 68.0 °C for 45 sec. The PCR conditions for 16S rRNA were initial denaturation at 94 °C for 2 min; 35 cycles of 98.0 °C for 10 sec, 50.0 °C for 30 sec, and 68.0 °C for 45 sec. The PCR products were sequenced by the dye terminator method using an ABI 3130xl Genetic Analyzer (Applied Biosystems, CA, USA), and the nucleotide sequences were registered in GenBank (accession numbers: LC855043-LC855045).

A phylogenetic tree was constructed to show the phylogenetic relationships between Pleopodias and its related cymothoid species. The nucleotide sequences of individuals registered in GenBank for both the COI and 16S rRNA of the family Cymothoidae were downloaded and added to the phylogenetic analysis as much as possible. Ceratothoa sp. 2 (LC159552, LC 159439) (Hata et al., 2017) was identified as Cinusa nippon Nagasawa, 2021, according to Fujita et al. (2023b). The Aegidae was used as an outgroup. The downloaded sequences are shown in the Appendix. These nucleotide sequences were aligned using the software MEGA 10 (Kumar et al., 2018) and MUSCLE (Edgar, 2004). Phylogenetic trees were constructed using the maximum likelihood method for the COI (602 bp) and the 16S rRNA (448 bp), respectively. The GTR+G model was adopted for phylogenetic analysis according to the model test in MEGA 10. In addition, the COI (645 bp) and the 16S rRNA (571 bp) were combined, and a phylogenetic tree was created using the maximum likelihood method with the software IQ-TREE 2 v1.6.12 (Minh et al., 2020). For the phylogenetic analysis, the TIM2+F+I+G4 model was used for the COI and the TVM+F+I+G4 model was used for the 16S rRNA, according to the model test in IQ-TREE in the combined tree. In 16S rRNA sequences, the genetic distance was calculated using the Kimura two-parameter model (Kimura, 1980) between P. diaphus and Pleopodias sp.

RESULTS

Taxonomy

Order Isopoda Latreille, 1816

Superfamily Cymothooidea Leach, 1814

Family Cymothoidae Leach, 1814

Genus Pleopodias Richardson, 1910

Pleopodias diaphus Avdeev, 1975

(Figs. 1A, B, 2)

Figure 1.
A, B, Pleopodias diaphusAvdeev, 1975, non-ovigerous female (TL 15.7 mm), SMBL-V0813; C, D, Pleopodias sp., transitional (TL 11.4 mm), SMBL-V0814. A, C, dorsal view, B, D, ventral view. Scale bars: 5 mm.

Figure 2.
Pleopodias diaphusAvdeev, 1975, non-ovigerous female (TL 15.7 mm), SMBL-V0813. A, Dorsal view; B, pleotelson and uropod; C, ventral view of cephalon; D, pereopod 1; E, pereopod 7; F, pleopod 2. Scale bars: A, 5 mm; B, C, 1 mm; D, E, 0.3 mm; F, 0.5 mm.

Pleopodias diaphusAvdeev, 1975: 254-256, figs. 1-11.- Bruce and Harrison-Nelson, 1988: 600. - Trilles, 1994: 109 (list) - Yamauchi, 2009: 477, figs. 7, 8. - Hadfield and Smit, 2017: 24, fig. 1.

Pleopodias superatusWilliams and Bunkley-Williams, 1986: 656, figs. 62-68.

Material examined. SMBL-V0813, non-ovigerous female (TL 15.7 mm), the East China Sea off Okinawa (28°31.372'N, 126°57.719'E - 28°32.045'N, 126°57.905'E), depth 343-345 m, 3 m beam trawl, 20 November 2009, Nagasaki-Maru.

Description of female (Fig. 2). Body elliptical, 2.6 times as long as greatest width. Cephalon 0.7 times longer than wide, subtriangular. Eyes oval with distinct margins; one eye 0.3 times width of cephalon, 0.4 times length of cephalon. Pereonite 1 anterior margin indented. Posterior margins of pereonites 1-6 straight, posterior margin of pereonite 7 produced medially. Coxae 2-6 narrow, slightly visible or invisible in dorsal view; coxae 7 invisible in dorsal view. Pleonites posterior margin smooth, concave. Widest at pleonite 1. Pleotelson 1.5 times as long as width, posterior margin concave.

Antennula consisting of 8 articles; bases in contact. Antenna consisting of 12 articles. Pereopod 1 basis 1.9 times as long as greatest width; ischium 0.6 times as long as basis; merus 0.5 times as long as ischium; carpus 0.4 times as long as merus; propodus 3.1 times as long as carpus, without robust seta; dactylus 1.2 times as long as propodus. Pereopod 7 basis 2.5 times as long as greatest width; ischium 0.8 times as long as basis; merus 0.5 times as long as ischium; carpus as long as merus; propodus 1.5 times as long as carpus, with 18 acute robust setae; dactylus 0.7 times as long as propodus. With oostegites. Pleopod 2 endopod with appendix masculine. Uropod longer than pleotelson, rami subequal, endopod and exopod narrowly rounded.

Distribution. Known only from the seas around Japan. The type locality is the Sea of Japan (Avdeev, 1975). In addition, it has been reported from the Pacific Ocean off the northeast coast of Honshu at depths of 310-380 m (Yamauchi, 2009), Suruga Bay (Williams and Bunkley-Williams, 1986), and the East China Sea off Okinawa (this study).

Host. The type host is Diaphus caeruleus (Avdeev, 1975). The host of the individual collected in this study is unknown.

DNA sequences. The COI sequence could not be obtained. 16S rRNA: LC855043.

Remarks. This species was described by Avdeev (1975) and is distinguished from congener species by its large eyes, the antennula bases making contact, the posterior margin of the pleotelson concave, the uropodal endopod as long as exopod, and the uropodal rami longer than the pleotelson (Hadfield and Smit, 2017). The non-ovigerous female collected in this study was almost consistent with these characteristics, but the uropodal rami are subequal (endopod is slightly shorter than exopod).

Pleopodias sp.

(Figs. 1C, D, 3)

Material examined. SMBL-V0814, transitional (TL 11.4 mm), from the off Odawara, Kanagawa Prefecture, Sagami Bay, Pacific coast of central Japan, on a body surface of Diaphus schmidtiTåning, 1932, 25 November 2022, coll. S. Aiba.

Figure 3.
Pleopodias sp., transitional (TL 11.4 mm), SMBL-V0814. A, Dorsal view; B, pleotelson and uropod; C, ventral view of cephalon; D, pereopod 1; E, pereopod 7; F, pleopod 2. Scale bars: A, 5 mm; B, C, 1 mm; D, E, 0.3 mm; F, 0.5 mm.

Description of early transitional (Fig. 3). Body elliptical, 2.7 times as long as greatest width. Cephalon 0.7 times longer than wide, subtriangular. Eyes oval with distinct margins; one eye 0.5 times width of cephalon, 0.3 times length of cephalon. Posterior margins of pereonites 1-6 straight, posterior margin of pereonite 7 produced medially. Coxae 2-7 narrow, slightly visible or invisible in dorsal view; coxae 7 invisible in dorsal view. Widest at pleonite 1. Pleotelson 1.5 times as long as width.

Antennula consisting of 8 articles; bases separated. Antenna consisting of 12 articles. Pereopod 1 basis 1.8 times as long as greatest width; ischium 0.7 times as long as basis; merus 0.3 times as long as ischium; carpus 0.6 times as long as merus; propodus 3.6 times as long as carpus, without robust seta; dactylus as long as propodus. Pereopod 7 basis 2.3 times as long as greatest width; ischium 0.9 times as long as basis; merus 0.5 times as long as ischium; carpus as long as merus; propodus 1.6 times as long as carpus, without robust seta; dactylus 0.8 times as long as propodus. Without oostegite. Pleopod 2 endopod without appendix masculine. Uropod slightly longer than pleotelson, exopod longer than endopod.

Distribution. Sagami Bay.

Host. Diaphus schmidtiTåning, 1932.

DNA sequences. COI: LC855045, 16S rRNA: LC855044.

Remarks. This individual does not have an oostegite, so it is transitional. This specimen matches P. diaphus in characteristics such as the shape of the pleotelson and the length of the uropodal rami, but differs in other characteristics such as antennula bases (close in P. diaphus, but apart in Pleopodias sp.), robust setae of pereopod 7 propodus (exists in P. diaphus, but not in Pleopodias sp.), pleopod 2 endopod (with appendix masculine in P. diaphus, but without appendix masculine in Pleopodias sp.), and the length of the uropodal endopod (same length as the exopod in P. diaphus, shorter than the exopod in Pleopodias sp.).

Phylogenetic analysis

The phylogenetic trees for COI, 16S rRNA, and combination of these are shown (Figs. 4-6). In the phylogenetic tree using 16S rRNA, P. diaphus and Pleopodias sp. formed a clade (Fig. 5), but showed 16.14% genetic distance between them. In the combined phylogenetic tree, Pleopodias diverged earlier than the other externally attaching genera; Anilocra and Nerocila (no COI sequence of Renocila) (Fig. 6).

Figure 4.
Maximum likelihood tree based on COI gene, sequenced from the Pleopodias sp. collected in this study along with cymothoid sequences downloaded from GenBank. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. Bootstrap support lower than 80% are not shown.

Figure 5.
Maximum likelihood tree based on 16S rRNA gene, sequenced from the Pleopodias diaphusAvdeev, 1975 and Pleopodias sp. collected in this study along with cymothoid sequences downloaded from GenBank. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. Bootstrap supports lower than 80% are not shown.

Figure 6.
Maximum likelihood tree based on COI and 16S rRNA genes, sequenced from the Pleopodias sp. collected in this study along with cymothoid sequences downloaded from GenBank. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. Bootstrap supports lower than 80% are not shown.

DISCUSSION

According to Fujita et al. (2023a), the maximum intraspecific variation in 16S rRNA of the Cymothoidae is 1.875%. This study found a genetic distance of 16.14% between P. diaphus and Pleopodias sp. Four morphological differences were also observed between P. diaphus and Pleopodias sp. As the Pleopodias sp. in this study is in the transitional stage, it is unclear whether the morphological differences are due to life stage or species differences. However, robust setae decrease as the life cycle stage advances in many species, and appendix masculine becomes shorter (or disappears) as it changes from male to female through a transitional stage (Aneesh et al., 2015; 2016; 2018; Fujita et al., 2025; Fujita and Ohnaka, in press), so it is more likely that these two are due to differences among species than life cycle stages. This individual may be a species not yet recorded in Japan, and it is hoped that an adult female can be collected.

The host of most Pleopodias species is unknown, and it is only known that P. diaphus parasitizes D. caeruleus (Hadfield and Smit, 2017). In this study, it was found that Pleopodias sp. parasitizes D. schmidti. This is the second host species of Pleopodias. Pleopodias sp. is the only cymothoid species that parasitizes D. schmidti. In addition, there is no record of D. caeruleus being collected in the seas around Japan (Motomura, 2024). As the original description of D. schmidti does not give any evidence for identifying the host, there are doubts about the identification of the type host species of P. diaphus.

Hata et al. (2017) analyzed the COI and 16S rRNA regions of 29 species in 15 genera in Cymothoidae, and examined the phylogenetic relationships of the Cymothoidae, the expansion of their habitats, and the evolution of parasitic sites on their hosts. They hypothesize that the Cymothoidae originated as parasitic in the branchial cavity of deep-sea eels and then expanded into shallower waters and freshwater. They hypothesize that the infestation type evolved multiple times from branchial cavity type to abdominal cavity and buccal cavity types and that it evolved from buccal cavity type to externally attaching type. Pleopodias is also an externally attaching type and is located near other groups of the same type (Anilocra and Nerocila) in a phylogenetic tree constructed using combined COI and 16S rRNA sequences. This supports the hypothesis of Hata et al. (2017) that externally attaching groups have recently diverged. In addition, Pleopodias diverged earlier than other externally attaching genera. Pleopodias may be close to the origin of the first externally attaching species. As in some previous studies (Hata et al., 2017; Fujita, 2023; Fujita et al., 2023b), phylogenetic trees constructed using combined COI and 16S rRNA sequences show that CeratothoaDana, 1852, ElthusaSchioedte and Meinert, 1884, and IchthyoxenosHerklots, 1870 are polyphyletic. In order to clarify these points, it is necessary to conduct a taxonomic review using morphological and molecular methods.

CONCLUSIONS

In this study, molecular phylogenetic analysis of the genus Pleopodias was conducted for the first time. Pleopodias sp., which could not be identified to species in this study, is likely to be a species not recorded in Japan based on the morphological characteristics and molecular phylogenetic tree, and it is necessary to collect adult females and conduct morphological and molecular analysis. In addition, the genus Pleopodias diverged from the ancestral species earlier than other externally attaching cymothoids, and it may be a key taxon in elucidating the evolution of cymothoids from branchial and buccal cavity types to externally attaching type.

ACKNOWLEDGMENTS

We are grateful to the captain and crew of the TR/V “Nagasaki-maru” (Nagasaki University) for sampling assistance. We are deeply thankful to an anonymous reviewer and Brenda Doti (Nauplius Associate Editor) for their helpful comments and suggestions.

REFERENCES

• Aneesh, PT; Kappalli, S; Kottarathil, HA and Gopinathan, A 2016. Mothocya renardi (Bleeker, 1857) (Crustacea: Isopoda: Cymothoidae) parasitising Strongylura leiura (Bleeker) (Belonidae) off the Malabar coast of India: redescription, occurrence and life-cycle. Systematic Parasitology, 93: 583-599. https://doi.org/10.1007/s11230-016-9646-8
  » https://doi.org/10.1007/s11230-016-9646-8
• Aneesh, PT; Sudha, K; Helna, AK and Anilkumar, G 2018. Agarna malayi Tiwari 1952 (Crustacea: Isopoda: Cymothoidae) parasitising the marine fish, Tenualosa toli (Clupeidae) from India: re-description/description of parasite life cycle and patterns of occurrence. Zoological Studies, 57: e25. https://doi.org/10.6620/ZS.2018.57-25
  » https://doi.org/10.6620/ZS.2018.57-25
• Aneesh, PT; Kappalli, S; Kottarathil, HA; Gopinathan, A and Paul, TJ 2015. Cymothoa frontalis, a cymothoid isopod parasitizing the belonid fish Strongylura strongylura from the Malabar Coast (Kerala, India): redescription, description, prevalence and life cycle. Zoological Studies, 54: e42. https://doi.org/10.1186/s40555-015-0118-7
  » https://doi.org/10.1186/s40555-015-0118-7
• Avdeev VV 1975. New representative of the parasitic isopod genus Pleopodias Richardson, 1910 (Cymothoidae). Fisheries, Oceanography, Hydrobiology and Fish Parasitology of the Pacific Ocean, 98: 254-256.
• Bruce NL 1987. Australian Pleopodias Richardson, 1910, and Anilocra Leach, 1818 (Isopoda: Cymothoidae), crustacean parasites of marine fishes. Records of the Australian Museum, 39: 85-130. https://doi.org/10.3853/j.0067-1975.39.1987.166
  » https://doi.org/10.3853/j.0067-1975.39.1987.166
• Bruce, NL and Harrison-Nelson, EB 1988. New records of fish parasitic marine isopod crustaceans (Cymothoidae, subfamily Anilocrinae) from the Indo-West Pacific. Proceedings of the Biological Society of Washington, 101: 585-560. https://isopods.nhm.org/pdfs/2608/2608.pdf
  » https://isopods.nhm.org/pdfs/2608/2608.pdf
• Bruce, NL; Welicky, R; Hadfield, KA and Smit, NJ 2019. A new genus and species of fish parasitic cymothoid Crustacea, Isopoda) from the Indian Ocean coast of South Africa, with a key to the externally attaching genera of Cymothoidae. Zookeys, 889: 1-15. https://doi.org/10.3897/zookeys.889.38638
  » https://doi.org/10.3897/zookeys.889.38638
• Dana JD 1852. On the classification of the Crustacea Choristopoda or Tetradecapoda. The American Journal of Science and Arts, Second Series, 14: 297-316.
• Edgar RC 2004. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics, 5: e113. https://doi.org/10.1186/1471-2105-5-113
  » https://doi.org/10.1186/1471-2105-5-113
• Folmer, O; Black, M; Hoeh, W; Lutz, R and Vrijenhoek, R 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3: 294-299. https://scispace.com/pdf/dna-primers-for-amplification-of-mitochondrial-cytochrome-c-46m2jyijnx.pdf
  » https://scispace.com/pdf/dna-primers-for-amplification-of-mitochondrial-cytochrome-c-46m2jyijnx.pdf
• Fujita H 2023. Morphological and molecular study of the fish parasitic crustaceans Cymothoa indica and Mothocya collettei (Isopoda: Cymothoidae), with new distribution records. Diversity, 15: e969. https://doi.org/10.3390/d15090969
  » https://doi.org/10.3390/d15090969
• Fujita, H and Ohnaka, T. 2025. First description of life stages of Anilocra prionuri Williams and Bunkley-Williams, 1986 (Isopoda: Cymothoidae) and growth-associated morphological changes. Zoological Studies, 64: e15. https://doi.org/10.6620/ZS.2025.64-15
  » https://doi.org/10.6620/ZS.2025.64-15
• Fujita, H; Okumura, Y and Shinoda, H 2025. Ceratothoa arimae (Isopoda: Cymothoidae) infesting buccal cavity of largescale blackfish, Girella punctata (Centrarchiformes: Kyphosidae), in Seto Inland Sea, Japan. Fishes, 10: e126. https://doi.org/10.3390/fishes10030126
  » https://doi.org/10.3390/fishes10030126
• Fujita, H; Kawai, K; Deville, D and Umino, T 2023a. Molecular and morphological characterizations of the fish parasitic isopod Mothocya parvostis (Crustacea: Cymothoidae) parasitizing optional intermediate hosts: juveniles of the cobaltcap silverside Hypoatherina tsurugae and yellowfin seabream Acanthopagrus latus Zoological Studies, 62: e21. https://doi.org/10.6620/ZS.2023.62-21
  » https://doi.org/10.6620/ZS.2023.62-21
• Fujita, H; Saito, N; Okuno, J; Moritaki, T and Yamauchi, T 2023b. New distribution record of the fish parasitic crustacean Cinusa nippon (Isopoda: Cymothoidae), with a description of the manca. Japanese Journal of Applied Entomology and Zoology, 67: 37-45. [in Japanese] https://doi.org/10.1303/jjaez.2023.37
  » https://doi.org/10.1303/jjaez.2023.37
• Hadfield, KA and Smit, NJ 2017. Revision of the fish parasitic genus Pleopodias Richardson, 1910 (Isopoda, Cymothoidae), with the description of a new species and key to the genus. ZooKeys, 667: 21-37. https://doi.org/10.3897/zookeys.667.11414
  » https://doi.org/10.3897/zookeys.667.11414
• Hata, H; Sogabe, A; Tada, S; Nishimoto, R; Nakano, R; Kohya, N; Takeshima, H and Kawanishi, R 2017. Molecular phylogeny of obligate fish parasites of the family Cymothoidae (Isopoda, Crustacea): evolution of the attachment mode to host fish and the habitat shift from saline water to freshwater. Marine Biology, 164: e105. https://doi.org/10.1007/s00227-017-3138-5
  » https://doi.org/10.1007/s00227-017-3138-5
• Herklots J 1870. Deux nouveaux genres de crustacés vivant en parasites sur des poissons, Epichthyes et Ichthyoxenos Archives Néerlandaise Sciences Exactes et Naturelles, 5: 120-137.
• Kimura M 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide-sequences. Journal of Molecular Evolution, 16: 111-120. https://doi.org/10.1007/bf01731581
  » https://doi.org/10.1007/bf01731581
• Klunzinger CB 1871. Synopsis der Fische des Rothen Meeres. II. Theil. Verhandlungen der K.-K. zoologisch-botanischen Gesellschaft in Wien, 21: 441-688.
• Kumar, S; Stecher, G; Li, M; Knyaz, C and Tamura, K 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35: 1547-1549. https://doi.org/10.1093/molbev/msy096
  » https://doi.org/10.1093/molbev/msy096
• Leach WE 1818. Cymothoadées, Cymothoadae. p. 338-354. In: Cuvier F. (Ed.), Dictionnaire des Sciences Naturelles, dans Lequel on Traite Methodiquement des Differens Etres de la Nature, Consideres Soit en Eux-memes, d'apres l'Etat Actuel de nos Connoissances, Soit Relativement a l'Utilite qu'en Peuvent Retirer la Medecine, l'Agriculture, le Commerce et les Artes, Vol. 12. Strasbourg, F.G. Levrault/Paris, Le Mormant. https://www.biodiversitylibrary.org/item/74437#page/346/mode/1up
  » https://www.biodiversitylibrary.org/item/74437#page/346/mode/1up
• Miers EJ 1880. On a collection of Crustacea from the Malaysian region.-Part IV. Penaeidea, Stomatopoda, Isopoda, Suctoria, and Xiphosura. The Annals and Magazine of Natural History, series 5, 5: 457-472.
• Minh, BQ; Schmidt, HA; Chernomor, O; Schrempf, D; Woodhams, MD; von Haeseler, A and Lanfear, R 2020. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution, 37: 1530-1534. https://doi.org/10.1093/molbev/msaa015
  » https://doi.org/10.1093/molbev/msaa015
• Motomura H 2024. List of Japan’s all fish species. Current standard Japanese and scientific names of all fish species recorded from Japanese waters. Available at https://www.museum.kagoshima-u.ac.jp/staff/motomura/jaf.html Accessed on 26 November 2024.
  » https://www.museum.kagoshima-u.ac.jp/staff/motomura/jaf.html
• Pillai NK 1954. A preliminary note on the Tanaidacea and Isopoda of Travancore. Bulletin of the Central Research Institute, University of Travancore, Trivandrum, Natural Sciences, 3: 1-21.
• Richardson H 1910. Marine isopods collected in the Philippines by the U.S. Fisheries steamer Albatross in 1907-8. Department of Commerce and Labor, Bureau of Fisheries Document, 736: 1-44.
• Richardson H 1911. Les Crustaces isopodes du Travailleur et du Talisman; formes nouvelles. Bulletin du Muséum National d´Histoire Naturelle., 17: 518-534.
• Schioedte, JC and Meinert, F.W. 1881. Symbolae ad monographiam cymothoarum crustaceorum isopodum familiae. I. Anilocridae. Naturhistorisk Tidsskrift Ser. III, 13: 1-166.
• Schioedte, JC and Meinert, F.W. 1884. Symbolae ad Monographiam Cymothoarum Isopodum Familiae 4. Cymothoidae. Trib. II. Cymothoinae. Trib. III. Livonecinae. Naturhistorisk Tidsskrift Ser. III, 14: 221-454.
• Shen, YY; Chen, X and Murphy, RW 2013. Assessing DNA barcoding as a tool for species identification and data quality control. Plos One, 8: e57125. https://doi.org/10.1371/journal.pone.0057125
  » https://doi.org/10.1371/journal.pone.0057125
• Simon, C; Frati, F; Beckenbach, A; Crespi, B; Liu H, and Flook, P 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene-sequences and a compilation of conserved polymerase chain-reaction primers. Annals of the Entomological Society of America, 87: 651-701. https://doi.org/10.1093/aesa/87.6.651
  » https://doi.org/10.1093/aesa/87.6.651
• Smit, NJ; Bruce, NL and Hadfield, KA 2014. Global diversity of fish parasitic isopod crustaceans of the family Cymothoidae. International Journal for Parasitology: Parasites and Wildlife, 3(2): 188-197. https://doi.org/10.1016/j.ijppaw.2014.03.004
  » https://doi.org/10.1016/j.ijppaw.2014.03.004
• Tåning AV 1932. Notes on scopelids from the Dana Expeditions. I. Videnskabelige Meddelelser fra Dansk Naturhistorisk Forening, Kjøbenhavn, 94: 125-146.
• Trilles J-P 1994. Les Cymothoidae (Crustacea, Isopoda) du monde (prodrome pour une faune). Studia Marina, 21/22: 1-288.
• Williams, EH and Bunkley-Williams, L 1986. The first Anilocra and Pleopodias isopods (Crustacea: Cymothoidae) parasitic on Japanese fishes, with three new species. Proceedings of the Biological Society of Washington, 99(4): 647-657.
• Yamauchi T 2009. Deep-sea cymothoid isopods (Crustacea: Isopoda: Cymothoidae) of Pacific coast of northern Honshu, Japan. National Museum of Nature and Science Monographs, 39: 467-481.

• Zoobank:
  http://zoobank.org/urn:lsid:zoobank.org:pub:F64F8C1C-0B6F-4B2A-90E7-443DE9B575E0
• Consent for publication:
  All authors declare that they have reviewed the content of the manuscript and gave their consent to submit the document.
• Funding and grant disclosures:
  This research was supported by the Japan Society of Promotion of Science (KAKENHI No. 23KJ1170) to HF.
• Study permits:
  Ethical review and approval were waived following Notice (No. 71) of the Japanese Ministry of Education, Culture, Sports, Science and Technology, as well as Regulations on Animal Experimentation at Kyoto University, because the research target species were invertebrates, and fish were collected commercially by fishermen.
• Data availability:
  The DNA sequences in this study were deposited in NCBI GenBank (accession numbers: LC855043-LC855045). The specimens used in this study are deposited in the Seto Marine Biological Laboratory (SMBL), Field Science Education and Research Center, Kyoto University (SMBL-V0813-V0814).

APPENDIX

List of sequences downloaded from GenBank for molecular analysis

Family	Species	COI	16S
Aegidae	Aega dofleini	LC616153
	Aega psora	FJ581463
	Alitropus typus	KT445864, OQ438521
	Rocinela angustata	EF432739, MH242961	LC767941
	Rocinela niponia	OM179771
	Rocinela tridens	MH242963
	Syscenus infelix	FJ581914, MG935349
	Aegidae spp.	LC159579, LC159580	LC159469, LC159470
Cymothoidae	Anilocra apogonae		EF422800
	Anilocra capensis	MK450443, MK450444
	Anilocra clupei	LC159540, LC604073	LC159426, LC604074
	Anilocra longicauda		EF422789, EF422797
	Anilocra physodes	MK652476
	Anilocra nemipteri		EF422790
	Anilocra prionuri	LC159541	LC159427
	Anilocra spp.	LC159542, MW803168	LC159428, EF422795
	Artystone sp.		LC159429
	Asotana magnifica	MK790137, MK790137	MK790137, MK790137
	Ceratothoa africanae	MK652477
	Ceratothoa arimae	LC159544	LC159430
	Ceratothoa carinata	LC724049, LC741986, MK652479	LC724051, LC742069, LC742070, LC742084, LC742085
	Ceratothoa oxyrrhynchaena	LC159545-LC159547, LC159548, LC159550, LC160311, LC160312	LC159431, LC159432-LC159434, LC159435, LC159437
	Ceratothoa parallela	MZ127219, MZ127225, MZ127227
	Ceratothoa retusa	MK652478
	Ceratothoa verrucosa	LC159556, LC159557, LC160318	LC159444, LC159445, LC742068
	Ceratothoa spp.	LC160313, LC160316, LC159551, LC159553-LC159555	EF422802, LC159438, LC159440, LC159441, LC159443
	Cinusa nippon	LC159552	LC159439
	Cinusa tetrodontis	MK652480
	Cterissa sakaii	LC159558, LC160320	LC159446
	Cymothoa eremita	LC159559, MK430019-MK430021, MK430024, MK430025, MK652481	LC159447
	Cymothoa indica	MH396438	EF422791, MH396438
	Cymothoa pulchrum	LC159450, LC159560, LC160322	LC159448, LC159449, LC159561
	Cymothoa sodwana	MK652482
	Cymothoidae spp.	LC159562	EF422792-EF422794, EF422798, EF422799, EF422804, LC159451
	Elthusa californica	MH242742
	Elthusa raynaudii	MK652487
	Elthusa vulgaris	AF260843, HQ941735, LC138010	AF260852
	Elthusa sacciger	LC159563	LC159452
	Elthusa spp.	LC159564-LC159568	LC159453-LC159457
	Glossobius auritus	LC159569	LC159458
	Glossobius impressus		MH384949
	Ichthyoxenos japonensis	MF419233, NC039713	KX671992, KX671993, NC039713
	Ichthyoxenus tanganyikae	LC159570	LC159459
	Joryma hilsae	KC896399, MT876659	JX413102
	Livoneca redmanii	KX360233, MW600095, OP430947	MW781920
	Lobothorax typus	MK672880
	Lobothorax sp.	LC159571	LC159460
	Mothocya affinis	MK652484
	Mothocya collettei	LC159572	LC159461
	Mothocya kaorui	LC652825	LC652826
	Mothocya melanosticta	MH395840
	Mothocya parvostis	LC159573	LC159462
	Mothocya plagulophora	MK652483
	Mothocya renardi	MK652485	EF422803
	Nerocila depressa	MH425627
	Nerocila japonica	LC159574, LC159575, LC160325, LC160330	LC159463, LC159464, LC710517
	Nerocila longispina	OK001962
	Nerocila orbignyi	MZ644982
	Nerocila phaiopleura	LC159576, LC160332, OP890359	LC159465
	Nerocila spp.	LC159577, MH235801	LC159466
	Norileca indica	MF628258, MF628259, OP811247
	Olencira praegustator	AF255791, KT959414, KT959415	AF259547
	Renocila ovata		EF422788
	Ryukyua globosa	LC159578	LC159467

Edited by

• Associate Editor:
  Brenda Doti

• Editor-in-chief
  Christopher Tudge

Data availability

The DNA sequences in this study were deposited in NCBI GenBank (accession numbers: LC855043-LC855045). The specimens used in this study are deposited in the Seto Marine Biological Laboratory (SMBL), Field Science Education and Research Center, Kyoto University (SMBL-V0813-V0814).

Publication Dates

• Publication in this collection
  10 Nov 2025
• Date of issue
  2025

History

• Received
  06 Jan 2025
• Accepted
  29 Apr 2025