The complete mitochondrial genome of <i>Corydoras nattereri</i> (Callichthyidae: Corydoradinae)

Moreira, Daniel A.; Buckup, Paulo A.; Britto, Marcelo R.; Magalhães, Maithê G. P.; Andrade, Paula C. C. de; Furtado, Carolina; Parente, Thiago E.

doi:10.1590/1982-0224-20150167

Daniel A. Moreira

Laboratório de Toxicologia Ambiental, Fundação Oswaldo Cruz (FIOCRUZ), Avenida Brasil, 4036 sala 101, 2104-031 Rio de Janeiro, RJ, Brazil. (DAM) daniel.moreira@ioc.fiocruz.br, (MGPM) magalhaes.maithe@gmail.com, (PCCA) paula.andrade.bio@gmail.com, (TEP) parente@ensp.fiocruz.br

Paulo A. Buckup

Departamento de Vertebrados, Museu Nacional, Universidade Federal do Rio de Janeiro (UFRJ), Quinta da Boa Vista, 20940-040 Rio de Janeiro, RJ, Brazil. (PAB) buckup@acd.ufrj.br (corresponding author), (MRB) mrbritto2002@yahoo.com.br

Marcelo R. Britto

Departamento de Vertebrados, Museu Nacional, Universidade Federal do Rio de Janeiro (UFRJ), Quinta da Boa Vista, 20940-040 Rio de Janeiro, RJ, Brazil. (PAB) buckup@acd.ufrj.br (corresponding author), (MRB) mrbritto2002@yahoo.com.br

Maithê G. P. Magalhães

Laboratório de Toxicologia Ambiental, Fundação Oswaldo Cruz (FIOCRUZ), Avenida Brasil, 4036 sala 101, 2104-031 Rio de Janeiro, RJ, Brazil. (DAM) daniel.moreira@ioc.fiocruz.br, (MGPM) magalhaes.maithe@gmail.com, (PCCA) paula.andrade.bio@gmail.com, (TEP) parente@ensp.fiocruz.br

Paula C. C. de Andrade

Laboratório de Toxicologia Ambiental, Fundação Oswaldo Cruz (FIOCRUZ), Avenida Brasil, 4036 sala 101, 2104-031 Rio de Janeiro, RJ, Brazil. (DAM) daniel.moreira@ioc.fiocruz.br, (MGPM) magalhaes.maithe@gmail.com, (PCCA) paula.andrade.bio@gmail.com, (TEP) parente@ensp.fiocruz.br

Carolina Furtado

Divisão de Genética, Instituto Nacional do Câncer (INCA), André Cavalcanti, 37, 4º andar, 20231-050 Rio de Janeiro, RJ, Brazil. (CF) cfurtado@inca.gov.br

Thiago E. Parente

Laboratório de Toxicologia Ambiental, Fundação Oswaldo Cruz (FIOCRUZ), Avenida Brasil, 4036 sala 101, 2104-031 Rio de Janeiro, RJ, Brazil. (DAM) daniel.moreira@ioc.fiocruz.br, (MGPM) magalhaes.maithe@gmail.com, (PCCA) paula.andrade.bio@gmail.com, (TEP) parente@ensp.fiocruz.br

Figures (3)
Tables (3)

Thumbnail

Fig. 1
Circular representation of the mitochondrial genome of Corydoras nattereri . Genes encoded in the heavy strand are shown in the outer circle and genes encoded in the light strand are offset inwards. The inner circle represents the CG-content. Figure was generated by the online server MitoFish, http://mitofish.aori.u-tokyo.ac.jp (Iwasaki et al ., 2012).

Thumbnail

Fig. 2
Sequencing depth over the complete mitogenomes of the three individuals of Corydoras nattereri: KT239008 (A), KT239009 (B), and KT239010 (C). Read counts (y-axis) are shown in logarithmic scale and sharp decreases correspond to the punctuation model of mitochondrial transcription (positions correspond to those shown in and ). Black vertical bars indicate position of gaps that were filled with Sanger sequencing (). Reads were mapped to the mitogenomes using Bowtie and visualized at the Integrative Genome Viewer (IGV, Bernt et al., 2013Bernt, M., A. Donath, F. Jühling, F. Externbrink, C. Florentz, G. Fritzsch, J. Pütz, M. Middendorf & P. F. Stadler. 2013. MITOS: improved de novo metazoan mitochondrial genome annotation. Molecular Phylogenetics and Evolution, 69: 313-319.; Thorvaldsdóttir et al ., 2013Thorvaldsdóttir, H., J. T. Robinson & J. P. Mesirov. 2012. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in Bioinformatics, 14: 178-192.).

Thumbnail

Fig. 3
Maximum likelihood tree (log likelihood = -2410.0522) of Corydoras samples with at least 90% similarity to the mitochondrial cytochrome oxidase I sequences of C. nattereri from the rio Suruí. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Bootstrap robustness is indicated next to selected branches. Samples of C. nattereri have the locality name appended to the sample ID (those for which mitogenomes were produced are from de rio "Surui"), outgroups have the genus name and other samples of Corydoras have the species epithet name appended to the ID code ().

Thumbnail

Table 1
List of samples used in this study, ordered according to GenBank Accession codes. Voucher museum catalog number is provided only for specimens that are being made available for the first time.

Thumbnail

Table 2
Positions and lengths of the five gaps in the mitogenome assembled using mitochondrial transcripts sequenced using Illumina HiSeq2500. These gaps were filled using conventional PCR and Sanger sequencing with the species-specific primers listed.

Thumbnail

Table 3
Positioning of genes in the mitochondrial genome of Corydoras nattereri . Negative gap values indicate overlap.

GenBank Accession	BOLD ProcessID	Sample	Voucher	Species	Publication/Source	Latitude	Longitude	Locality
GU701815	FUPR517-09	LBP-32757		Corydoras ehrhardti	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701816	FUPR516-09	LBP-32756		Corydoras ehrhardti	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701817	FUPR818-09	LBP-36128		Corydoras ehrhardti	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701818	FUPR817-09	LBP-36126		Corydoras ehrhardti	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701819	FUPR816-09	LBP-36124		Corydoras ehrhardti	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701809	FUPR819-09	LBP-36114		Corydoras paleatus	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-	-	Upper Parana basin, Brazil
GU701810	FUPR822-09	LBP-36119		Corydoras paleatus	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-	-	Upper Parana basin, Brazil
GU701812	FUPR824-09	LBP-36122		Corydoras paleatus	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-	-	Upper Parana basin, Brazil
GU701813	FUPR823-09	LBP-36121		Corydoras paleatus	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-	-	Upper Parana basin, Brazil
GU701814	FUPR515-09	LBP-32755		Corydoras ehrhardti	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701871	FUPR820-09	LBP-36116		Corydoras paleatus	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-	-	Upper Parana basin, Brazil
GU702213	FPSR082-09	LBP-29094		Corydoras nattereri	Pereira et al., 2011Pereira, L. H. G., G. M. G. Maia, R. Hanner, F. Foresti & C. Oliveira. 2011. DNA barcodes discriminate freshwater fishes from the Paraíba do Sul River Basin, São Paulo, Brazil. Mitochondrial DNA, 22(S1): 71-79.	-23,3690	-46,0240	[Rio Paraíba do Sul upstream from Jacareí], SP, Brazil
JN988818	FUPR285-09	LBP-32330		Corydoras nattereri	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,5112	-45,8591	[rio Paraitinguinha, Tietê drainage], upper Paraná Basin, SP, Brazil
JN988819	FUPR286-09	LBP-32331		Corydoras nattereri	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,5112	-45,8591	[rio Paraitinguinha, Tietê drainage], upper Paraná Basin, SP, Brazil
JN988821	FUPR288-09	LBP-32333		Corydoras nattereri	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,5112	-45,8591	[rio Paraitinguinha, Tietê drainage], upper Paraná Basin, SP, Brazil
JN988822	FUPR289-09	LBP-32334		Corydoras nattereri	Pereira et al., 2013Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).	-23,5112	-45,8591	[rio Paraitinguinha, Tietê drainage], upper Paraná Basin, SP, Brazil
JX111730	FARGB202-11	UNMDP-T 0370		Corydoras paleatus	Rosso et al., 2012Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.	-36,2680	-59,9800	Arroio Tapalque, Buenos Aires, Argentina
JX111731	FARGB238-11	UNMDP-T 0406		Corydoras paleatus	Rosso et al., 2012Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.	-38,3350	-61,6014	El Divisorio Stream, Buenos Aires, Argentina
JX111732	FARGB358-11	UNMDP-T 0526		Corydoras paleatus	Rosso et al., 2012Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.	-34,9700	-61,0433	Adeg Puente Santa Cruz (Ascencion), Buenos Aires, Argentina
JX111733	FARGB239-11	UNMDP-T 0407		Corydoras paleatus	Rosso et al., 2012Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.	-38,3350	-61,6014	El Divisorio Stream, Buenos Aires, Argentina
JX111734	FARGB201-11	UNMDP-T 0369		Corydoras paleatus	Rosso et al., 2012Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.	-36,2680	-59,9800	Arroyo Tapalque, Buenos Aires, Argentina
JX111735	FARGB200-11	UNMDP-T 0368		Corydoras paleatus	Rosso et al., 2012Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.	-36,2680	-59,9800	Arroyo Tapalque, Buenos Aires, Argentina
JX111736	FARGB184-11	UNMDP-T 0352		Corydoras paleatus	Rosso et al., 2012Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.	-35,6056	-59,9914	Chascomus lagoon, Buenos Aires, Argentina
JX111737	FARGB183-11	UNMDP-T 0351		Corydoras paleatus	Rosso et al., 2012Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.	-35,6056	-59,9914	Chascomus lagoon, Buenos Aires, Argentina
JX111738	FARGB172-11	UNMDP-T 0340		Corydoras paleatus	Rosso et al., 2012Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.	-35,5411	-58,0894	Vitel lagoon, Buenos Aires, Argentina
KT874579	MNRJ531-15	MNTI9093/MNLM5113	MNRJ41901	Callichthys callichthys	This study	-19,9753	-40,5478	rio Valssungana Velha, Reis Magos drainage, near bridge of Santa Teresa - Santa Leopoldina road, Santa Teresa, ES, Brazil
KT874580	MNRJ533-15	MNTI554/MNL1354	MNRJ31639	Aspidoras lakoi	This study	-20,7500	-46,2122	Left bank tributary of ribeirão do Turvo, between Fazenda da Serra de Cima and Fazenda Baixadão, Capitólio, MG, Brazil
KT874581	MNRJ538-15	MNTI8665/MNLM5103	MNRJ41520	Corydoras nattereri	This study	-22,6006	-43,0917	Tributary of rio Suruí and rio Suruí downstream of Piabeta - Santo Aleixo road, Magé, RJ, Brazil
KT874582	MNRJ532-15	MNTI7422/MNLM4992	MNRJ40948	Scleromystax barbatus	This study	-26,1972	-49,9219	Rio Lindo (right margin tributary of rio Cubatão), SC-301, bairro Dona Francisca, Joinville, SC, Brazil
KT874583	MNRJ534-15	MNTI3387/MNLM935	MNRJ37470	Corydoras nattereri	This study	-22,4675	-42,2975	Córrego Aldeia Velha, under bridge on road Aldeia Velha, near RPPN Fazenda do Bom Retiro, Casimiro de Abreu, RJ, Brazil
KT874584	MNRJ539-15	MNTI8666/MNLM5104	MNRJ41520	Corydoras nattereri	This study	-22,6006	-43,0917	Tributary of rio Suruí and rio Suruí downstream of Piabeta - Santo Aleixo road, Magé, RJ, Brazil
KT874585	MNRJ537-15	MNTI8664/MNLM5102	MNRJ41520	Corydoras nattereri	This study	-22,6006	-43,0917	Tributary of rio Suruí and rio Suruí downstream of Piabeta - Santo Aleixo road, Magé, RJ, Brazil
KT874586	MNRJ536-15	MNTI7464/MNLM5000	MNRJ41030	Corydoras ehrhardti	This study	-26,2803	-49,3244	rio Vermelho, Itapocu drainage, downstream of dam, upstream of aqueduct, São Bento do Sul, SC, Brazil
KT874587	MNRJ535-15	MNTI3832	MNRJ37693	Corydoras nattereri	This study	-18,3106	-40,2411	rio do Sul under bridge of ES-130 between Vinhático and Pinheiros, on municipal border between Montanha and Pinheiros, ES, Brazil

Gap position	Length (nucleotides)	Primers
Gap position	Length (nucleotides)	Forward	Reverse
1 - 81	81	CAGATTAGGCTCGACCGACG	GGCGTATGACGGCTTGGTAA
995 - 1085	91	CCCAAAACGTCAGGTCGAGG	TTTGCCACAGAGACGGGTTG
7836 - 7910	75	AAATCTGCGGTGCAAACCAC	GGCGGTTATTTTGTCAGCGG
9558 - 9579	22	GAGCCCACCACAGCATCATA	GCAGTCGTGCAGATCCTAGT
11720 - 11903	184	CCCCCGCTACCCAACTTAAT	TGCTTTCTGTTCCCTGGTCT

Gene	Start	End	Length	Gap	Direction	Start Codon	Stop Codon
tRNA-Phe	1	68	68	0
12S rRNA	69	1013	945	0
tRNA-Val	1014	1085	72	0
16S rRNA	1086	2752	1667	0
tRNA-Leu	2753	2827	75	0
ND1	2828	3799	972	8		ATG	TAG
tRNA-Ile	3808	3879	72	-2
tRNA-Gln	3878	3948	71	-1	complement
tRNA-Met	3948	4017	70	0
ND2	4018	5062	1045	0		ATG	T--
tRNA-Trp	5063	5133	71	1
tRNA-Ala	5135	5203	69	1	complement
tRNA-Asn	5205	5277	73	0	complement
origin-L	5278	5312	35	-3	complement
tRNA-Cys	5310	5377	68	-1	complement
tRNA-Tyr	5377	5446	70	1	complement
COI	5448	7007	1560	-13		GTG	AGG
tRNA-Ser	6995	7065	71	4	complement
tRNA-Asp	7070	7138	69	6
COII	7145	7835	691	0		ATG	T--
tRNA-Lys	7836	7909	74	1
ATPase 8	7911	8078	168	-10		ATG	TAA
ATPase 6	8069	8752	684	21		ATG	TAA
COIII	8774	9557	784	0		ATG	T--
tRNA-Gly	9558	9629	72	0
ND3	9630	9978	349	0		ATG	T--
tRNA-Arg	9979	10048	70	0
ND4L	10049	10345	297	-7		ATG	TAA
ND4	10339	11719	1381	0		ATG	T--
tRNA-His	11720	11789	70	0
tRNA-Ser	11790	11856	67	1
tRNA-Leu	11858	11930	73	0
ND5	11931	13757	1827	-4		ATG	TAA
ND6	13754	14269	516	0	complement	ATG	TAA
tRNA-Glu	14270	14337	68	3	complement
Cyt b	14341	15478	1138	0		ATG	T--
tRNA-Thr	15479	15550	72	-2
tRNA-Pro	15549	15618	70	0	complement
D-loop	15619	16557	939

Brasil

Brasil

The complete mitochondrial genome of Corydoras nattereri (Callichthyidae: Corydoradinae)

ABSTRACT