Open-access Survival in soil and detection of co-transformed Trichoderma harzianum by nested PCR

Sobrevivência em solo e detecção de co-transformantes de Trichoderma harzianum por PCR "nested"

Abstract

The objective of this work was to evaluate the survival of two Trichoderma harzianum co-transformants, TE 10 and TE 41, carrying genes for green fluorescent protein (egfp) and for resistance to benomyl, during four weeks in a contained soil microcosm. Selective culture media were used to detect viable fungal material, whose identity was confirmed by the observation of the fluorescent phenotype by direct epifluorence microscopy. PCR using two nested primer pairs specific to the egfp gene was also used to detect the transformed fungi. Although it was not possible to reliably detect the egfp gene directly from soil extracts, an enrichment step involving selective culture of soil samples in liquid medium prior to DNA extraction enabled the consistent detection of the T. harzianum co-transformants by nested PCR for the duration of the incubation period.

biological control; transformation; egfp; benomyl resistance


Resumo

O objetivo deste trabalho foi avaliar a sobrevivência de dois co-transformantes de Trichoderma harzianum, TE 10 e TE 41, expressando o gene da proteína de fluorescência verde (egfp) e resistência a benomil, por um período de quatro semanas em microcosmo de solo, sob condições controladas. Foi utilizado um meio seletivo para detecção de material fúngico viável, o qual foi confirmado por observação quanto ao fenótipo de fluorescência em microscópio de epifluorescência direta. O fungo transformado foi detectado por PCR "nested", utilizando-se dois pares de primers específicos para o gene egfp. Foram utilizados meios líquidos enriquecidos no cultivo de amostras de solo, permitindo uma detecção consistente de co-transformantes de T. harzianum, uma vez que não foi possível a detecção do gene egfp por PCR de amostras de DNA extraídas diretamente de solo.

controle biológico; transformação; egfp; resistência a benomil


NOTAS CIENTÍFICAS

Survival in soil and detection of co-transformed Trichoderma harzianum by nested PCR

Sobrevivência em solo e detecção de co-transformantes de Trichoderma harzianum por PCR "nested"

Paulo Roberto Queiroz; Maria Cléria Valadares-Inglis; Peter Ward Inglis

Embrapa Recursos Genéticos e Biotecnologia, Caixa Postal 02371, CEP 70770-900 Brasília, DF. E-mail: cleria@cenargen.embrapa.br

ABSTRACT

The objective of this work was to evaluate the survival of two Trichoderma harzianum co-transformants, TE 10 and TE 41, carrying genes for green fluorescent protein (egfp) and for resistance to benomyl, during four weeks in a contained soil microcosm. Selective culture media were used to detect viable fungal material, whose identity was confirmed by the observation of the fluorescent phenotype by direct epifluorence microscopy. PCR using two nested primer pairs specific to the egfp gene was also used to detect the transformed fungi. Although it was not possible to reliably detect the egfp gene directly from soil extracts, an enrichment step involving selective culture of soil samples in liquid medium prior to DNA extraction enabled the consistent detection of the T. harzianum co-transformants by nested PCR for the duration of the incubation period.

Index terms: biological control, transformation, egfp, benomyl resistance.

RESUMO

O objetivo deste trabalho foi avaliar a sobrevivência de dois co-transformantes de Trichoderma harzianum, TE 10 e TE 41, expressando o gene da proteína de fluorescência verde (egfp) e resistência a benomil, por um período de quatro semanas em microcosmo de solo, sob condições controladas. Foi utilizado um meio seletivo para detecção de material fúngico viável, o qual foi confirmado por observação quanto ao fenótipo de fluorescência em microscópio de epifluorescência direta. O fungo transformado foi detectado por PCR "nested", utilizando-se dois pares de primers específicos para o gene egfp. Foram utilizados meios líquidos enriquecidos no cultivo de amostras de solo, permitindo uma detecção consistente de co-transformantes de T. harzianum, uma vez que não foi possível a detecção do gene egfp por PCR de amostras de DNA extraídas diretamente de solo.

Termos para indexação: controle biológico, transformação, egfp, resistência a benomil.

Trichoderma species and strains have received much attention because of their potential as biocontrol agents of many plant pathogenic fungi. Results from field trials testing the biocontrol effect of Trichoderma harzianum indicate that this fungus functions efficiently under different environmental conditions, protecting several crops and controlling various plant pathogens (Chet, 1987). However, many antagonistic microorganisms do not show consistent biocontrol effects when released to the environment, making the careful monitoring of these strains an essential part of their evaluation.

Phenotypic or genotypic monitoring of random environmental isolates requires large sample sizes and is potentially difficult and laborious. Introduction of heterologous markers to an antagonist allows easy differentiation from indigenous fungi in the environment (Thrane et al., 1995). Lo et al. (1998) used a co-transformed strain of T. harzianum expressing hygromycin resistance and b-glucuronidase (GUS) activity as tools for assessing population development, colonization, and interactions with plant pathogens. Green fluorescent protein (GFP) from the jellyfish, Aequorea victoria, is recognised as a sensitive and non-invasive reporter and an efficient marker (Chalfie et al., 1994).

The objective of this work was to evaluate the survival of two Trichoderma harzianum co-transformants, TE 10 and TE 41, carrying genes for green fluorescent protein (egfp) and for resistance to benomyl, during four weeks in a contained soil microcosm.

The co-transformants, TE 10 and TE 41 (Inglis et al., 1999), were grown on potato dextrose agar (Difco, Detroit, Michigan, USA) containing 1.5 µg mL-1 benomyl at 28oC for about five days until conidiation. Five mililiters conidial suspension (5.0x107 conidia mL-1) of TE 10 and TE 41 were mixed with 50 g non-sterile soil (sandy loam from the Brazilian cerrado) in 100 mL plastic pots with lids to preserve humidity. Controls consisted of pots containing soil treated with 5 mL sterile water. Pots were then incubated at 28oC for four weeks. One gram of soil from each pot was sampled 24 hours after inoculation and at weekly intervals for four weeks (Lo et al., 1998). Soil samples were diluted in 10 mL 0.1% tween 80 and plated on Aspergillus complete medium (ACM) (Pontecorvo, 1952), supplemented with 1.5 µg mL-1 benomyl, 20 µg mL-1 tetracycline and 100 µg mL-1 ampicillin until colony formation at 28oC. Three plates were prepared for each sample and colonies examined directly for EGFP fluorescence using an inverted microscope (Axiovert, Carl Zeiss, Oberkochen, Germany) with excitation filter of 450–490 nm and emission filter at 520 nm.

Soil samples (200 mg) were inoculated into 100 mL YG liquid medium (2.5% glucose; 0.5% yeast extract; 3 µg mL-1 benlate; 20 µg mL-1 tetracycline; 100 µg mL-1 ampicillin) and incubated at 28oC and 150 rpm for 48 hours. Mycelia were harvested by filtration, washed with distilled water and frozen in liquid nitrogen. Total DNA was extracted using a modified miniprep method (Porteous & Armstrong, 1993). Mycelium (100 mg) was placed in 800 µL extraction buffer (25 mM EDTA; 250 mM NaCl; 0.5% SDS; 200 mM Tris-HCl pH 8.0) and subjected to three alternating cycles of one minute in liquid nitrogen and one minute at 65oC. The nucleic acids were extracted twice with phenol/chloroform then precipitated with isopropanol and resuspended in 100 µL milliQ water. To remove any soil PCR inhibitor, 20 µL nucleic acid extract was treated with RNase A and DNA, then purified using a glass binding kit (Geneclean; Bio 101 Inc., Vista CA, USA). Attempts were also made to extract DNA directly from soil samples (200 mg) using the above protocol.

To detect the presence of the egfp gene by PCR, four egfp specific primers were used in two sets. The first primer pair consisted of EGFP1: 5' CACCGGGGTGGTGCCCATCC and EGFP2: 5' GGCGGCGGTCACGAACTCCAG. Each 25 µL PCR reaction in a reaction buffer (50 mM KCl; 0.1% tween 20; 10 mM Tris-HCl pH 9.2) which also contained 1.5 mM MgCl2, 0.35 µM each primer, 30 µM dNTP's, 2U Taq DNA polymerase and approximately 20 ng DNA. The reaction mixture was overlaid with 30 µL mineral oil and placed in a thermocycler (Model PTC-100, MJ Research, Watertown, Massachusetts, USA) using an initial denaturing time of 3 min at 94oC, followed by 30 cycles of denaturation for 1 min at 94oC, annealing at 62oC for 1 min and extension for 1 min at 72oC. A final extension for 5 min at 72oC was also utilized. A 5 µL product from the first reaction was used in a second reaction, identical to the first, but with the primers replaced by the nested pairs EGFP3: 5' TGAACCGCATCGAGCTGAAG and EGFP4: 5' CAGCAGGACCATGTGATCG. After the amplifications, the products were separated and visualized in 1.5% agarose gels stained with ethidium bromide (0.5 µg mL-1).

The two T. harzianum co-transformants were both found to be recoverable from soil using simple selective culture techniques, where the possession of a heterologous gene for resistance to the fungicide benomyl by these transformants enabled direct selection. Moreover, the green fluorescent phenotype allowed in vivo identification, by epifluorescence microscopy, of the transformants on the recovery plates. Almost no contaminating fungi were recovered during the tests showing different growth characteristics to the applied Trichoderma transformants.

Numbers of transformant colony forming units (cfu) recovered from pots, including time 0 samples, were higher than the conidium concentration originally applied (5x106 conidia g-1) (Table 1). This discrepancy is probably due to uneven mixing of conidia and soil at the time of inoculation. Despite this, numbers of recovered CFU were found to rise during the period of monitoring, most likely due to the ability of the transformants to grow and sporulate in the soil medium. For both transformants TE 10 and TE 41, analysis of EGFP fluorescence allowed instant confirmation of the recovered colonies identity, in which 100% of recovered benomyl-resistant colonies were brightly fluorescent when examined microscopically.

Pots inoculated with wild-type T. harzianum strain 1051, a second Trichoderma strain, designated TVC and uninoculated pots were used to provide negative control soil samples for PCR. In these controls, no amplification products were detected with any combination of egfp-specific primers.

PCR detection of the egfp gene in DNA samples, extracted directly from inoculated soil, proved to be highly inconsistent, even from freshly inoculated samples. This difficulty is probably related to inhibition of PCR by soil components that may be difficult to remove by standard extraction protocols (Tsai & Olson, 1992; Romanowski et al., 1993; Jansson, 1995; Thrane et al., 1995). Soil DNA extracts used were usually brown colored, indicating significant levels of persistent contaminants (Porteous & Armstrong, 1993). Problems faced in direct extraction of amplifiable DNA from soil led to the adop-tion of a liquid culture enrichment step prior to PCR. DNA minipreps of these enriched samples were found to be consistent and effective templates for PCR detection of the egfp gene using both primer pairs in nested PCR (Figure 1).


Both standard culture techniques and PCR monitoring of the egfp gene indicated the ability of the two T. harzianum transformants to persist in soil for at least four weeks in a culturable state. Counts of fluorescent colonies suggest that the introduced traits are stable in the two co-transformants studied, which are therefore potential candidates for biocontrol trials against C. perniciosa on cocoa.

Acknowledgements

To Conselho Nacional de Desenvolvimento Científico e Tecnológico for a Master degree studentship for the first author and for a post-doctoral scholarship for the third author.

Received on October 14, 2003 and accepted on January 26, 2004

References

  • CHALFIE, M.; TU, Y.; EUSKIRCHEN, G.; WARD, W.W.; PRASHER, D.C. Green fluorescent protein as a marker for gene expression. Science, v.263, p.802-805, 1994.
  • CHET, I. Trichoderma: application, mode of action, and potential as a biocontrol agent of soilborne plant pathogenic fungi. In: CHET, I. (Ed.). Innovative approaches to plant disease control New York: J. Wiley, 1987. p.137-160.
  • INGLIS, P.W.; QUEIROZ, P.R.; VALADARES-INGLIS, M.C. Transformation with green fluorescent protein of Trichoderma harzianum 1051, a strain with biocontrol activity against Crinipellis perniciosa, the agent of witches' broom disease of cocoa. Journal of General and Applied Microbiology, v.45, p.63-67, 1999.
  • JANSSON, J.K. Tracking genetically engineered microorganisms in nature. Current Opinion in Biotechnology, v.6, p.275-283, 1995.
  • LO, C.T.; NELSON, E.B.; HAYES, C.K.; HARMAN, G.E. Ecological studies of transformed Trichoderma harzianum strain 1295-22 in the rhizosphere and on phylloplane of creeping bentgrass. Phytopathlogy, v.88, p.129-136, 1998.
  • PONTECORVO, G. The genetics of Aspergillus nidulans Advances in Genetics, v.5, p.141-238, 1952.
  • PORTEOUS, L.A.; ARMSTRONG, J.L. A simple mini-method to extract DNA directly from soil for use with polymerase chain reaction amplification. Current Microbiology, v.27, p.115-118, 1993.
  • ROMANOWSKI, G.; LORENZ, M.G.; WACKERNAGEL, W. Use of polymerase chain reaction and electroporation of Escherichia coli to monitor the persistence of extracellular plasmid DNA introduced into natural soils. Applied and Environmental Microbiology, v.59, p.3438-3446, 1993.
  • THRANE, C.; LÜBECK, M.; GREEN, H.; DEGEFU, Y.; ALLERUP, S.; THRANE, U.; FUNCK-JENSEN, D. A tool for monitoring Trichoderma harzianum: I. Transformation with the GUS gene by protoplast technology. Phytopathology, v.85, p.1428-1435, 1995.
  • TSAI, Y.L.; OLSON, B.H. Rapid method for separation of bacterial DNA from humic substances in sediments by polymerase chain reaction. Applied and Environmental Microbiology, v.58, p.2292-2295, 1992.

Publication Dates

  • Publication in this collection
    24 June 2004
  • Date of issue
    Apr 2004

History

  • Accepted
    26 Jan 2004
  • Received
    14 Oct 2003
location_on
Embrapa Secretaria de Pesquisa e Desenvolvimento; Pesquisa Agropecuária Brasileira Caixa Postal 040315, 70770-901 Brasília DF Brazil, Tel. +55 61 3448-1813, Fax +55 61 3340-5483 - Brasília - DF - Brazil
E-mail: pab@embrapa.br
rss_feed Acompañe los números de esta revista en su lector de RSS
Ir para arriba Notificar error