ABSTRACT:
The calcium homeostasis modulator 1 gene (CALHM1), which is located on chromosome 10 in humans and on chromosome 26 in cattle, is a transmembrane glycoprotein that controls the cytosolic calcium concentrations. Altered calcium homeostasis has been associated with several neurodegenerative disorders, including Alzheimer’s disease (AD). In a recent study, single nucleotide polymorphisms (SNPs) of CALHM1 have been associated with sporadic Creutzfeldt-Jakob disease (CJD). The protein sequence of human CALHM1 shows 93% homology with bovine CALHM1. Although SNPs of human CALHM1 have been correlated with human prion disease, polymorphisms of the bovine CALHM1 gene have not been reported in cattle thus far. To investigate polymorphisms of the bovine CALHM1 gene in Korean native cattle, we analyzed the open reading frame (ORF) of this gene in 175 Hanwoo and 141 Holstein cattle. We observed five SNPs: c.219C>T (rs380966453), c.357C>T (rs385969338), and c.869A>G (rs516301908) within the ORF region of two exons; and c.552+92A>G (rs481706737) and c.553-3A>C (rs448524869) in the intron of bovine CALHM1. Among the three SNPs that are in the ORF region of bovine CALHM1, the genotype and allele frequencies of the c.869A>G (p.His290Arg) and c.219C>T (p.Asn73Asn) SNPs were significantly different between Hanwoo and Holstein cattle (P<0.0001). Haplotype analysis showed that haplotypes ht2, ht3 and ht5 were also significantly different in these two cattle breeds. This study provides the first genetic analysis of the bovine CALHM1 gene in cattle.
INDEX TERMS:
CALHM1; calcium homeostasis; single nucleotide polymorphism; cattle; Hanwoo; neurodegenerative disorders.
Introduction
Transmissible spongiform encephalopathies (TSEs), also known as prion diseases, are a type of neurodegenerative disorder causing Creutzfeldt-Jakob disease (CJD) in humans, bovine spongiform encephalopathy (BSE) in cattle, scrapie in sheep and chronic wasting disease (CWD) in deer and elk (Prusiner 1998). BSE is characterized by the accumulation of an abnormal protease-resistant isoform (PrPSc) of the prion protein in the brain, spongiform degeneration, astrocytosis, and neuronal cell loss (Collinge 1997, Prusiner 1997). BSE epidemics are caused by the ingestion of meat and bone meal produced from scrapie-infected sheep or BSE-infected cattle in the United Kingdom (UK) (Wilesmith et al. 1991).
The Hanwoo breed (Han means Korean, and woo means cattle), which originated from crossbreeding between Bos indicus and Bos primigenius, is widely raised as a beef breed in Korea (Jeong et al. 2005b). In Korea, the majority of dairy cattle are Holstein bred. All 36 BSE cases reported in Japan were diagnosed in 2010 or earlier. Among them, 33 cases were reported in Holstein-Friesian cattle and 3 cases were reported in the Japanese Black (JB) cattle (Msalya et al. 2011). In the UK, most of the diagnosed cases of BSE were in Holstein Friesian dairy cattle (Bradley and Wilesmith 1993). However, BSE has not been reported in Korean native cattle thus far (Lee et al. 2012).
In previous studies, the polymorphisms in the prion protein gene (PRNP) have been known to influence the susceptibility/resistance to prion diseases in humans, cattle, and sheep (Palmer et al. 1991, Belt et al. 1995, Clouscard et al. 1995, Jeong et al. 2004, Jeong et al. 2005a). The PRNP gene is located on chromosome 13q17 in cattle (Ryan and Womack 1993). Although polymorphisms associated with BSE susceptibility have not been reported in the open reading frame (ORF) region of bovine PRNP, two insertion/deletion (indel) polymorphisms consisting of a 23-bp indel in the promoter region and a 12-bp indel in intron 1 of bovine PRNP, have been associated with BSE susceptibility (Sander et al. 2004, Juling et al. 2006). In several recent studies, two polymorphisms (snp 4136 and snp 13861) in non-coding regions of bovine PRNP have been correlated with BSE susceptibility in European Holstein cattle (Murdoch et al. 2010a, Murdoch et al. 2010b). Additionally, association studies on genes such as the prion-like protein gene (PRND) and shadow of prion protein (SPRN) have been performed to identify genetic susceptibility to BSE (Comincini et al. 2001, Balbus et al. 2005, Gurgul et al. 2012).
Calcium homeostasis modulator 1 (CALHM1) plays an important role in calcium homeostasis. Altered calcium homeostasis has been linked to several neurodegenerative disorders, including Alzheimer’s disease (AD) and prion diseases (Green and LaFerla 2008, Kawamata and Manfredi 2010, Surmeier et al. 2010, Fedrizzi and Carafoli 2011, Giacomello et al. 2011, Peggion et al. 2011). In humans, a previous study suggested that the rs2986017 polymorphism (Pro86Leu) of the human CALHM1 gene leads to loss of Ca2+ permeability and increases amyloid β (Aβ) levels (Dreses-Werringloer et al. 2008). In addition, this single nucleotide polymorphism (SNP) is a genetic risk factor for susceptibility to AD (Dreses-Werringloer et al. 2008, Aqdam et al. 2010, Cui et al. 2010, Lambert et al. 2010, Koppel et al. 2011). However, several studies of the relationship between the rs2986017 polymorphism of human CALHM1 and increased risk for AD have led to divergent findings (Beecham et al. 2009, Minster et al. 2009, Sleegers et al. 2009, Inoue et al. 2010, Lambert et al. 2010, Nacmias et al. 2010, Feher et al. 2011, Tan et al. 2011). Recently, three polymorphisms and the haplotype frequency of human CALHM1 have been shown to be associated with sporadic CJD (Calero et al. 2012). These results suggest that human CALHM1 can play a role in the development of human prion diseases such as sporadic CJD. The CALHM1 gene is located on chromosome 26 in cattle. Although SNPs of this gene have been associated with human prion disease, no polymorphisms of the bovine CALHM1 gene, which shares 93% protein sequence identity with human CALHM1, have been reported in cattle thus far.
The aim of the present study was to investigate the genotype, allele, and haplotype frequencies of bovine CALHM1 SNPs in 175 Korean Hanwoo and 141 Holstein cattle.
Materials and Methods
Genetic analysis. Blood samples were taken from 175 Hanwoo and 141 Holstein cattle in South Korea. Genomic DNA was isolated from 200μl of blood using the QIAamp DNA blood mini kit (Qiagen, USA) following the manufacturer’s instructions.
Polymerase chain reaction (PCR) was performed with the following forward and reverse primers: bovine CALHM1-1F (TGTCTCAGCCATGACGTG) and bovine CALHM1-1R (ATGGGTCTGTCCACTCAGAT) were designed to amplify a 817 bp products including exon 1 (554 bp) of bovine CALHM1 gene; bovine CALHM1-2F (TCTTTTCCCTAAAGGCCCTG) and bovine CALHM1-2R (CCATTTGAGGCGGGAAATTT) were designed to amplify a 743 bp products including ORF region (480 bp) of exon 2. The PCR reagents included 50 pmole of each primer, 5 μl of 10 × Taq DNA polymerase buffer, 1 μl of a 10 mM dNTP mixture and 2.5 units of Taq DNA polymerase (Promega, USA). The PCR conditions were as follows: denaturing at 94°C for 2 min, followed by 35 cycles of 94°C for 45 sec, 58°C for 45 sec, and 72°C for 1 min 30 sec, and then 1 cycle of 72°C for 10 min for final extension using an S-1000 Thermal Cycler (Bio-Rad Laboratories, USA).
Purification of the PCR products for DNA sequencing was performed using a QIAquick gel extraction kit (Qiagen, USA). The PCR products were directly sequenced with an ABI 3730 automatic sequencer using a Taq dideoxy terminator cycle sequencing kit (ABI, USA).
Polymorphism Phenotyping v2 (PolyPhen-2) software was used to predict the possible impact of an amino acid substitution on the non-synonymous SNPs found in this study (http://genetics.bwh.harvard.edu/pph2/).
Statistical analysis. Statistical analyses were performed using Statistical Analysis Software (SAS), version 9.3 (SAS Institute Inc., Cary, NC., USA). The differences in genotype or allele frequencies between the groups of Korean native cattle were measured with the χ2-test or Fisher’s exact test. We also examined Lewontin’s D’ (|D’|) between five SNPs of the PRNP gene in Hanwoo and Holstein cattle. The Hardy-Weinberg Equilibrium test and haplotype analysis were carried out with SNP Analyzer 1.2A (http://snp.istech21.com/snpanalyzer/1.2A/).
Results
The bovine CALHM1 gene is composed of two exons. To investigate the genotype and allele frequencies of bovine CALHM1 polymorphisms in Korean native cattle, we screened SNPs within two exons of the bovine CALHM1 gene through automatic DNA sequencing in the genomic DNA of 175 Hanwoo and 141 Korean Holstein cattle. We identified a total of 5 SNPs: c.219C>T (p.Asn73Asn; rs380966453) and c.357C>T (p.Leu119Leu; rs385969338) in exon 1; c.869A>G (p.His290Arg; rs516301908) in exon 2; 552+92A>G (rs481706737) and 553-3A>C (rs448524869) in the intron of CALHM1 (Fig.1). Significant differences in ORF region of bovine CALHM1 gene between Hanwoo and Holstein cattle were observed in the genotype (P < 0.0001) and allele (P<0.0001) frequencies of c.219C>T (p.Asn73Asn) and c.869A>G (p.His290Arg) (Table 1). However, there were no significant differences in the genotype (P = 0.7508) or allele (P=0.8051) frequencies of c.357C>T (p.Leu119Leu) between the two groups (Table 1). In addition, the genotype and allele frequencies of the two SNPs located in the intron were significantly different between Hanwoo and Holstein cattle raised in Korea (Table 1). Moreover, PolyPhen-2 analysis predicted that the c.869A>G (p.His290Arg) SNP was benign with score of 0. The genotype frequencies of all of the identified SNPs followed Hardy-Weinberg equilibrium in Hanwoo and Holstein cattle.
Gene map and polymorphisms identified in bovine Calcium homeostasis modulator 1 gene (CALHM1) on chromosome 26. The open reading frame (ORF) within exons was marked by shaded blocks and 3’ untranslated region (UTR) by white blocks. Edged horizontal bars indicate the regions sequenced. The words in bold indicate five polymorphisms found in this study.
Genotype and allele frequencies of single nucleotide polymorphisms (SNPs) of the bovine CALHM1 gene in Korean Holstein and Hanwoo cattle
To examine whether there was strong linkage disequilibrium among the 5 SNPs of the bovine CALHM1 gene in Korean native cattle, linkage disequilibrium (LD) (|D’|) was calculated. All 5 SNPs of the bovine CALHM1 gene were found to be in strong LD in Korean native cattle with D’ values of 0.703-1.0 (Table 2).
Linkage disequilibrium (LD) among five single nucleotide polymorphisms (SNPs) of the CALHM1 gene in Hanwoo and Holstein cattle
Analysis of haplotype frequencies was carried out in Hanwoo and Korean Holstein cattle. As shown in Table 3, there are eight different haplotypes of the bovine CALHM1 polymorphisms. Among the eight haplotypes, the CCACA (ht1) haplotype was observed most frequently (43.18% for Holstein; 40% for Hanwoo). The haplotype frequencies of CCGCA (ht2), TCACA (ht3), and CCGCG (ht5) showed significant differences between the Hanwoo and Korean Holstein cattle.
Haplotype frequencies of five polymorphisms of the CALHM1 gene in Korean Holstein and Hanwoo cattle
Discussion
Polymorphisms of the PRNP gene have been shown to play an important role in susceptibility to prion diseases in human and sheep (Palmer et al. 1991, Belt et al. 1995, Clouscard et al. 1995, Jeong et al. 2004, Jeong et al. 2005a). Significant associations of classical BSE susceptibility and bovine PRNP genotypes involving a the 23 bp indel polymorphism in the putative promoter region and a 12 bp indel polymorphism within intron 1, have been demonstrated in large samples and various species of cattle (Sander et al. 2004, Juling et al. 2006, Haase et al. 2007, Kashkevich et al. 2007, Muramatsu et al. 2008, Murdoch et al. 2010b). Recently, PRNP haplotypes including snp 4136 and snp 13861 have been associated with susceptibility to classical and atypical BSE (Clawson et al. 2008, Murdoch et al. 2010a, Murdoch et al. 2010b).
Several genetic studies have been performed to identify candidate genes related to BSE other than the PRNP gene, including PRND and SPRN (Comincini et al. 2001, Balbus et al. 2005, Gurgul et al. 2012). In humans, the SNPs and the haplotype frequency of the human CALHM1 gene were shown to be associated with sporadic CJD in a Spanish population (Calero et al. 2012), suggesting that human CALHM1 plays a role in the development of human prion diseases. The sequence of the bovine CALHM1 protein shares 93% identity with human CALHM1. This result suggests that bovine CALHM1 could play a role in the pathogenesis of BSE in cattle.
In this study, we analyzed the genotype and allele frequencies of five SNPs, including c.869A>G (p.His290Arg), between Hanwoo and Korean Holstein cattle (Table 1). The genotype and allele frequencies of c.219C>T and c.869A>G showed significant differences between the two groups. Among SNPs found in ORF region of bovine CALHM1 gene, it is possible that nonsynonymous SNPs are involved in phenotype differences by amino acid substitution of protein. Thus, the predicted damaging effect of c.869A>G (p.His290Arg) SNP was determined using PolyPhen-2 software program, which was used to predict the effect of the SNPs and mutations on the function of protein with a scale of 0-1 (Adzhubei et al. 2010). However, this SNP has been predicted as benign with a score of 0. Moreover, the CCGCA (ht2), TCACA (ht3), and CCGCG (ht5) haplotype frequencies exhibited significant differences between the Hanwoo and Korean Holstein cattle (Table 3).
Holstein dairy cattle have been reported to develop BSE in many countries including UK, Canada, United States (US), and Japan (Bradley & Wilesmith 1993, Msalya et al. 2011, Dudas et al. 2010, Richt & Hall 2008, Kim and Jeong 2017). However, BSE has never been diagnosed in Korean native cattle, Hanwoo (Lee et al. 2012). These results suggest the possibility that there are significant differences in the genetic distribution of SNPs in certain BSE-related genes including PRNP.
In our previous studies, we showed that there is a significant difference in the allele frequency of the 23 bp indel PRNP polymorphism between BSE-affected German cattle and Hanwoo (Jeong et al. 2006). In addition, we reported that the T and G allele frequencies at snp 4136 and snp 13861 SNPs of PRNP, which have been correlated with BSE resistance, are higher in Hanwoo than in Holstein cattle (Jeong et al. 2013). These results suggest that there is potential difference in BSE susceptibility between Hanwoo and Holstein cattle. Based on data of this study, future studies on polymorphisms of CALHM1 gene in BSE-affected cattle will be necessary to evaluate the correlation between SNPs and susceptibility to BSE. To our knowledge, the present study provides the first genetic analysis of bovine CALHM1 in cattle.
Acknowledgements
This research was supported by Basic Science Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2015R1D1A1A010599). Ms. C.-H. Yun were supported by the BK21 Plus program in the Department of Bioactive Material Sciences.
References
- Aqdam M.J., Kamali K., Rahgozar M., Ohadi M., Manoochehri M., Tahami A., Bostanshirin L. & Khorshid H.R. 2010. Association of CALHM1 Gene Polymorphism with Late Onset Alzheimer’s Disease in Iranian Population. Avicenna J. Med. Biotechnol. 2:153-157.
- Adzhubei I.A., Schmidt S., Peshkin L., Ramensky V.E., Gerasimova A., Bork P., Kondrashov A.S. & Sunyaev S.R. 2010. A method and server for predicting damaging missense mutations. Nat. Methods 7:248-249.
- Balbus N., Humeny A., Kashkevich K., Henz I., Fischer C., Becker C.M. & Schiebel K. 2005. DNA polymorphisms of the prion doppel gene region in four different German cattle breeds and cows tested positive for bovine spongiform encephalopathy. Mamm. Genome 16:884-892.
- Beecham G.W., Schnetz-Boutaud N., Haines J.L. & Pericak-Vance M.A. 2009. CALHM1 polymorphism is not associated with late-onset Alzheimer disease. Ann. Hum. Genet. 73:379-381.
- Belt P.B., Muileman I.H., Schreuder B.E., Bos-de Ruijter J., Gielkens A.L. & Smits M.A. 1995. Identification of five allelic variants of the sheep PrP gene and their association with natural scrapie. J. Gen. Virol. 76:509-517.
- Bradley R. & Wilesmith J.W. 1993. Epidemiology and control of bovine spongiform encephalopathy (BSE). Brit. Med. Bull. 49:932-959.
- Calero O., Bullido M.J., Clarimon J., Hortiguela R., Frank-Garcia A., Martinez-Martin P., Lleo A., Rey M.J., Sastre I., Rabano A., de Pedro-Cuesta J., Ferrer I. & Calero M. 2012. Genetic variability of the gene cluster CALHM 1-3 in sporadic Creutzfeldt-Jakob disease. Prion 6:407-412.
- Clawson M.L., Richt J.A., Baron T., Biacabe A.G., Czub S., Heaton M.P., Smith T.P. & Laegreid W.W. 2008. Association of a bovine prion gene haplotype with atypical BSE. PLoS One 3:e1830.
- Clouscard C., Beaudry P., Elsen J.M., Milan D., Dussaucy M., Bounneau C., Schelcher F., Chatelain J., Launay J.M. & Laplanche J.L. 1995. Different allelic effects of the codons 136 and 171 of the prion protein gene in sheep with natural scrapie. J. Gen. Virol. 76:2097-2101.
- Collinge J. 1997. Human prion diseases and bovine spongiform encephalopathy (BSE). Hum. Mol. Genet. 6:1699-1705.
- Comincini S., Foti M.G., Tranulis M.A., Hills D., Di Guardo G., Vaccari G., Williams J.L., Harbitz I. & Ferretti L. 2001. Genomic organization, comparative analysis, and genetic polymorphisms of the bovine and ovine prion Doppel genes (PRND). Mamm. Genome 12:729-733.
- Cui P.J., Zheng L., Cao L., Wang Y., Deng Y.L., Wang G., Xu W., Tang H.D., Ma J.F., Zhang T., Ding J.Q., Cheng Q. & Chen S.D. 2010. CALHM1 P86L polymorphism is a risk factor for Alzheimer’s disease in the Chinese population. J. Alzheimers Dis. 19:31-35.
- Dreses-Werringloer U., Lambert J.C., Vingtdeux V., Zhao H., Vais H., Siebert A., Jain A., Koppel J., Rovelet-Lecrux A., Hannequin D., Pasquier F., Galimberti D., Scarpini E., Mann D., Lendon C., Campion D., Amouyel P., Davies P., Foskett J.K., Campagne F. & Marambaud P. 2008. A polymorphism in CALHM1 influences Ca2+ homeostasis, Abeta levels, and Alzheimer’s disease risk. Cell 133:1149-1161.
- Dudas S., Yang J., Graham C., Czub M., McAllister T.A., Coulthart M.B. & Czub S. 2010. Molecular, biochemical and genetic characteristics of BSE in Canada. PLoS One 5:e10638.
- Fedrizzi L. & Carafoli E. 2011. Ca2+ dysfunction in neurodegenerative disorders: Alzheimer’s disease. Biofactors 37:189-196.
- Feher A., Juhasz A., Rimanoczy A., Pakaski M., Kalman J. & Janka Z. 2011. No association between CALHM1 polymorphism and Alzheimer’s disease risk in a Hungarian population. Psychiatr. Genet. 21:249-252.
- Giacomello M., Hudec R. & Lopreiato R. 2011. Huntington’s disease, calcium, and mitochondria. Biofactors 37:206-218.
- Green K.N. & LaFerla F.M. 2008. Linking calcium to Abeta and Alzheimer’s disease. Neuron 59:190-194.
- Gurgul A., Polak M.P., Larska M. & Slota E. 2012. PRNP and SPRN genes polymorphism in atypical bovine spongiform encephalopathy cases diagnosed in Polish cattle. J. Appl. Genet. 53:337-342.
- Haase B., Doherr M.G., Seuberlich T., Drogemuller C., Dolf G., Nicken P., Schiebel K., Ziegler U., Groschup M.H., Zurbriggen A. & Leeb T. 2007. PRNP promoter polymorphisms are associated with BSE susceptibility in Swiss and German cattle. BMC Genet. 8:15.
- Inoue K., Tanaka N., Yamashita F., Sawano Y., Asada T. & Goto Y. 2010. The P86L common allele of CALHM1 does not influence risk for Alzheimer disease in Japanese cohorts. Am. J. Med. Genet. B Neuropsychiatr. Genet. 153:532-535.
- Jeong B.H., Jin H.T., Carp R.I. & Kim Y.S. 2013. Bovine spongiform encephalopathy (BSE)-associated polymorphisms of the prion protein (PRNP) gene in Korean native cattle. Anim. Genet. 44:356-357.
- Jeong B.H., Lee K.H., Kim N.H., Jin J.K., Kim J.I., Carp R.I. & Kim Y.S. 2005a. Association of sporadic Creutzfeldt-Jakob disease with homozygous genotypes at PRNP codons 129 and 219 in the Korean population. Neurogenetics 6:229-232.
- Jeong B.H., Lee Y.J., Kim N.H., Carp R.I. & Kim Y.S. 2006. Genotype distribution of the prion protein gene (PRNP) promoter polymorphisms in Korean cattle. Genome 49:1539-1544.
- Jeong B.H., Nam J.H., Lee Y.J., Lee K.H., Jang M.K., Carp R.I., Lee H.D., Ju Y.R., Ahn Jo S., Park K.Y. & Kim Y.S. 2004. Polymorphisms of the prion protein gene (PRNP) in a Korean population. J. Hum. Genet. 49:319-324.
- Jeong B.H., Sohn H.J., Lee J.O., Kim N.H., Kim J.I., Lee S.Y., Cho I.S., Joo Y.S., Carp R.I. & Kim Y.S. 2005b. Polymorphisms of the prion protein gene (PRNP) in Hanwoo (Bos taurus coreanae) and Holstein cattle. Genes Genet. Syst. 80:303-308.
- Kim Y.C. & Jeong B.H. 2017. Lack of germline mutation at codon 211 of the prion protein gene (PRNP) in Korean native cattle. Acta Vet. Hung. 65:147-152.
- Juling K., Schwarzenbacher H., Williams J.L. & Fries R. 2006. A major genetic component of BSE susceptibility. BMC Biol. 4:33.
- Kashkevich K., Humeny A., Ziegler U., Groschup M.H., Nicken P., Leeb T., Fischer C., Becker C.M. & Schiebel K. 2007. Functional relevance of DNA polymorphisms within the promoter region of the prion protein gene and their association to BSE infection. FASEB J. 21:1547-1555.
- Kawamata H. & Manfredi G. 2010. Mitochondrial dysfunction and intracellular calcium dysregulation in ALS. Mech. Ageing Dev. 131:517-526.
- Koppel J., Campagne F., Vingtdeux V., Dreses-Werringloer U., Ewers, M., Rujescu D., Hampel H., Gordon M.L., Christen E., Chapuis J., Greenwald B.S., Davies P. & Marambaud P. 2011. CALHM1 P86L polymorphism modulates CSF Abeta levels in cognitively healthy individuals at risk for Alzheimer’s disease. Mol. Med. 17:974-979.
- Lambert J.C., Sleegers K., González-Pérez A., Ingelsson M., Beecham G.W., Hiltunen M., Combarros O., Bullido M.J., Brouwers N., Bettens K., Berr C., Pasquier F., Richard F., Dekosky S.T., Hannequin D., Haines J.L., Tognoni G., Fiévet N., Dartigues J.F., Tzourio C., Engelborghs S., Arosio B., Coto E., De Deyn P., Del Zompo M., Mateo I., Boada M., Antunez C., Lopez-Arrieta J., Epelbaum J., Schjeide B.M., Frank-Garcia A., Giedraitis V., Helisalmi S., Porcellini E., Pilotto A., Forti P., Ferri R., Delepine M., Zelenika D., Lathrop M., Scarpini E., Siciliano G., Solfrizzi V., Sorbi S., Spalletta G., Ravaglia G., Valdivieso F., Vepsäläinen S., Alvarez V., Bosco P., Mancuso M., Panza F., Nacmias B., Bossù P., Hanon O., Piccardi P., Annoni G., Mann D., Marambaud P. , Seripa D., Galimberti D., Tanzi R.E., Bertram L., Lendon C., Lannfelt L., Licastro F., Campion D., Pericak-Vance M.A., Soininen H., Van Broeckhoven C., Alpérovitch A., Ruiz A., Kamboh M.I. & Amouyel P. 2010. The CALHM1 P86L polymorphism is a genetic modifier of age at onset in Alzheimer’s disease: a meta-analysis study. J. Alzheimers Dis. 22:247-255.
- Lee Y.H., Kim M.J., Tark D.S., Sohn H.J., Yun E.I., Cho I.S., Choi Y.P., Kim C.L., Lee J.H., Kweon C.H., Joo Y.S., Chung G.S. & Lee J.H. 2012. Bovine spongiform encephalopathy surveillance in the Republic of Korea. Rev. Sci. Tech. 31:861-870.
- Minster R.L., Demirci F.Y., DeKosky S.T. & Kamboh M.I. 2009. No association between CALHM1 variation and risk of Alzheimer disease. Hum. Mutat. 30:E566-569.
- Msalya G., Shimogiri T., Ohno S., Okamoto S., Kawabe K., Minezawa M. & Maeda Y. 2011. Evaluation of PRNP expression based on genotypes and alleles of two indel loci in the medulla oblongata of Japanese Black and Japanese Brown cattle. PLoS One 6:e18787.
- Muramatsu Y., Sakemi Y., Horiuchi M., Ogawa T., Suzuki K., Kanameda M., Hanh T.T. & Tamura Y. 2008. Frequencies of PRNP gene polymorphisms in Vietnamese dairy cattle for potential association with BSE. Zoonoses Public Health 55:267-273.
- Murdoch B.M., Clawson M.L., Laegreid W.W., Stothard P., Settles M., McKay S., Prasad A., Wang Z., Moore S.S. & Williams J.L. 2010a. A 2cM genome-wide scan of European Holstein cattle affected by classical BSE. BMC Genet. 11:20.
- Murdoch B.M., Clawson M.L., Yue S., Basu U., McKay S., Settles M., Capoferri R., Laegreid W.W., Williams J.L. & Moore S.S. 2010b. PRNP haplotype associated with classical BSE incidence in European Holstein cattle. PLoS One 5:e12786
- Nacmias B., Tedde A., Bagnoli S., Lucenteforte E., Cellini E., Piaceri I., Guarnieri B.M., Bessi V., Bracco L. & Sorbi S. 2010. Lack of implication for CALHM1 P86L common variation in Italian patients with early and late onset Alzheimer’s disease. J. Alzheimers Dis. 20:37-41.
- Palmer M.S., Dryden A.J., Hughes J.T. & Collinge J. 1991. Homozygous prion protein genotype predisposes to sporadic Creutzfeldt-Jakob disease. Nature 352:340-342.
- Peggion C., Bertoli A. & Sorgato M.C. 2011. Possible role for Ca2+ in the pathophysiology of the prion protein? Biofactors 37:241-249.
- Prusiner S.B. 1997. Prion diseases and the BSE crisis. Science 278:245-251.
- Prusiner S.B. 1998. Prions. Proc. Natl Acad. Sci. USA 95:13363-13383.
- Richt J.A. & Hall S.M. 2008. BSE case associated with prion protein gene mutation. PLoS Pathog. 4:e1000156.
- Ryan A.M. & Womack J.E. 1993. Somatic cell mapping of the bovine prion protein gene and restriction fragment length polymorphism studies in cattle and sheep. Anim. Genet. 24:23-26.
- Sander P., Hamann H., Pfeiffer I., Wemheuer W., Brenig B., Groschup M.H., Ziegler U., Distl O. & Leeb T. 2004. Analysis of sequence variability of the bovine prion protein gene (PRNP) in German cattle breeds. Neurogenetics 5:19-25.
- Sleegers K., Brouwers N., Bettens K., Engelborghs S., van Miegroet H., De Deyn P. P. & Van Broeckhoven C. 2009. No association between CALHM1 and risk for Alzheimer dementia in a Belgian population. Hum. Mutat. 30:E570-574.
- Surmeier D.J., Guzman J.N. & Sanchez-Padilla J. 2010. Calcium, cellular aging, and selective neuronal vulnerability in Parkinson’s disease. Cell Calcium 47:175-182.
- Tan E.K., Ho P., Cheng S.Y., Yih Y., Li H.H., Fook-Chong S., Lee W.L. & Zhao Y. 2011. CALHM1 variant is not associated with Alzheimer’s disease among Asians. Neurobiol. Aging 32:546 e511-542.
- Wilesmith J.W., Ryan J.B. & Atkinson M.J. 1991. Bovine spongiform encephalopathy: epidemiological studies on the origin. Vet. Rec. 128:199-203.


