Neospora caninum em bovinos em matadouros de Pernambuco e Alagoas

Neospora caninum in cattle slaughter in the states of Pernambuco and Alagoas, Brazil

Rodolfo L.G. Amaral Leonildo B.G. Silva José W. Pinheiro Júnior Orestes L. Souza Neto Carlos A.S. Leal Wagnner J.N. Porto José M.P. Barbosa Rinaldo A. Mota Sobre os autores

Resumos

A neosporose bovina é uma doença infecciosa causada pelo Neospora caninum, parasito intracelular obrigatório, sendo considerada uma das principais causas de aborto na espécie bovina em diversos países. Objetivou-se estudar a ocorrência de N. caninum em vacas e fetos nos Estados de Pernambuco e Alagoas, Brasil. Foram coletadas 306 amostras de soro sanguíneo de vacas abatidas causada pelo Neospora caninum, parasito intracelular obri-e 30 fetos nos Estados de Pernambuco e Alagoas. Para o gatório, sendo considerada uma das principais causas de diagnóstico sorológico utilizou-se a técnica de Reação de aborto na espécie bovina em diversos países. Objetivou-se Imunoflurescência Indireta (RIFI) com ponto de corte estudar a ocorrência de N. caninum em vacas e fetos nos 1:200 para os soros das vacas e para os soros fetais utilizou Estados de Pernambuco e Alagoas, Brasil. Foram coletadas 306 amostras de soro sanguíneo de vacas abatidas e 30 fetos nos Estados de Pernambuco e Alagoas. Para o diagnóstico sorológico utilizou-se a técnica de Reação de Imunoflurescência Indireta (RIFI) com ponto de corte 1:200 para os soros das vacas e para os soros fetais utilizou ponto de corte 1:25. Para a pesquisa do DNA parasitário utilizaram-se tecidos fetais submetidos à técnica da Reação em Cadeia da Polimerase (PCR). Na sorologia, observou-se 39/306 (12,6%) das vacas positivas e 5/30 (16,7%) dos fetos positivos. Na detecção do parasito 8/30 (26,6%) dos fetos foram positivos na PCR. Os resultados obtidos neste estudo quanto à presença do parasito nos fetos são inéditos para a região estudada e permitem concluir que este agente deve ser incluído no estudo das causas de aborto na espécie bovina nesta região do Brasil.

Neospora caninum; neosporose; diagnóstico; bovinos


Bovine neosporosis is an infectious disease caused by Neospora caninum, obligate intracellular parasite, and is considered a major cause of abortion in cattle in various countries. The objective was to study the occurrence of N. caninum in cows and fetuses in the states of Pernambuco and Alagoas, Brazil. We collected 306 blood serum samples from slaughtered cows and 30 fetuses in the states of Pernambuco and Alagoas. For serological diagnosis, we used the technique of immunofluorescence reaction (RIFI) with a cutoff 1:200 for sera of cows and fetal sera used cutoff 1:25 parasitic DNA research, we used tissue fetal submitted to the technique of Polymerase Chain Reaction (PCR). Serological assays, we observed 39/306(12.6%) of the positive cows and 5/30 (16.7%) of positive fetuses. To detect the parasite 8/30 (26.6%) of fetuses were PCR positive. The results of this study as the presence of parasites in fetuses are unprecedented for this region and allow us to conclude that this agent should be included in the study of causes of bovine abortion in this region of Brazil.

Neospora caninum; neoporosis; diagnosis; cattle


ANIMAIS DE PRODUÇÃO

Neospora caninum em bovinos em matadouros de Pernambuco e Alagoas

Neospora caninum in cattle slaughter in the states of Pernambuco and Alagoas, Brazil

Rodolfo L.G. AmaralI; Leonildo B.G. SilvaII; José W. Pinheiro JúniorIII; Orestes L. Souza NetoIV; Carlos A.S. LealI; Wagnner J.N. PortoV; José M.P. BarbosaVI; Rinaldo A. MotaII,* * Autor para correspondencia: rinaldo.mota@pq.cnpq.br

IPós-Graduação em Ciência Veterinária, Departamento de Medicina Veterinária, Universidade Federal Rural de Pernambuco (UFRPE), Av. Dom Manoel de Medeiros s/n, Dois Irmãos, Recife, PE 52171-900, Brasil

IIDocente do Departamento de Medicina Veterinária, UFRPE, Dois Irmãos, Recife, PE

IIIDocente da Unidade Acadêmica de Garanhuns (UAG), UFRPE, Av. Bom Pastor s/n, Boa Vista, Garanhuns, PE 55296-901, Brasil

IVPós-Graduação em Ciência Animal Tropical, Departamento de Morfologia e Fisiologia Animal, UFRPE, Av. Dom Manoel de Medeiros s/n, Dois Irmãos, Recife, PE 52171-900, Brasil

VDocente da Unidade Educacional Viçosa, Campus Arapiraca, UFAL, Fazenda São Luiz, S/N, Zona Rural, Viçosa, AL 57700-000, Brasil

VIAcadêmico de Medicina Veterinária, Unidade Educacional Viçosa, Campus Arapiraca, UFAL, Fazenda São Luiz, s/n, Zona Rural, Viçosa, AL 57700- 000, Brasil

RESUMO

A neosporose bovina é uma doença infecciosa causada pelo Neospora caninum, parasito intracelular obrigatório, sendo considerada uma das principais causas de aborto na espécie bovina em diversos países. Objetivou-se estudar a ocorrência de N. caninum em vacas e fetos nos Estados de Pernambuco e Alagoas, Brasil. Foram coletadas 306 amostras de soro sanguíneo de vacas abatidas causada pelo Neospora caninum, parasito intracelular obri-e 30 fetos nos Estados de Pernambuco e Alagoas. Para o gatório, sendo considerada uma das principais causas de diagnóstico sorológico utilizou-se a técnica de Reação de aborto na espécie bovina em diversos países. Objetivou-se Imunoflurescência Indireta (RIFI) com ponto de corte estudar a ocorrência de N. caninum em vacas e fetos nos 1:200 para os soros das vacas e para os soros fetais utilizou Estados de Pernambuco e Alagoas, Brasil. Foram coletadas 306 amostras de soro sanguíneo de vacas abatidas e 30 fetos nos Estados de Pernambuco e Alagoas. Para o diagnóstico sorológico utilizou-se a técnica de Reação de Imunoflurescência Indireta (RIFI) com ponto de corte 1:200 para os soros das vacas e para os soros fetais utilizou ponto de corte 1:25. Para a pesquisa do DNA parasitário utilizaram-se tecidos fetais submetidos à técnica da Reação em Cadeia da Polimerase (PCR). Na sorologia, observou-se 39/306 (12,6%) das vacas positivas e 5/30 (16,7%) dos fetos positivos. Na detecção do parasito 8/30 (26,6%) dos fetos foram positivos na PCR. Os resultados obtidos neste estudo quanto à presença do parasito nos fetos são inéditos para a região estudada e permitem concluir que este agente deve ser incluído no estudo das causas de aborto na espécie bovina nesta região do Brasil.

termos de indexação:Neospora caninum, neosporose, diagnóstico, bovinos.

ABSTRACT

Bovine neosporosis is an infectious disease caused by Neospora caninum, obligate intracellular parasite, and is considered a major cause of abortion in cattle in various countries. The objective was to study the occurrence of N. caninum in cows and fetuses in the states of Pernambuco and Alagoas, Brazil. We collected 306 blood serum samples from slaughtered cows and 30 fetuses in the states of Pernambuco and Alagoas. For serological diagnosis, we used the technique of immunofluorescence reaction (RIFI) with a cutoff 1:200 for sera of cows and fetal sera used cutoff 1:25 parasitic DNA research, we used tissue fetal submitted to the technique of Polymerase Chain Reaction (PCR). Serological assays, we observed 39/306(12.6%) of the positive cows and 5/30 (16.7%) of positive fetuses. To detect the parasite 8/30 (26.6%) of fetuses were PCR positive. The results of this study as the presence of parasites in fetuses are unprecedented for this region and allow us to conclude that this agent should be included in the study of causes of bovine abortion in this region of Brazil.

Index terms:Neospora caninum, neoporosis, diagnosis, cattle.

INTRODUÇÃO

Neosporose bovina é uma doença cosmopolita causada por Neospora caninum (Dubey et al. 1988). Essa doença é considerada uma das principais causas de aborto em bovinos no mundo, sendo responsável por grandes prejuízos econômicos em rebanhos de corte e leite (Dubey & Lindsay 1996).

Na América do Sul, rebanhos positivos para N. caninum foram notificados na Argentina, Brasil, Chile, Paraguai, Peru, Uruguai e Venezuela (Moore 2005).

A transmissão vertical é considerada a principal forma de manutenção do parasito nos rebanhos bovinos (Dubey et al. 1988).

O primeiro relato de infecção por N. caninum em bovinos com sinais de aborto no Brasil foi feito no ano de 1996 no Estado de São Paulo (Brautigam et al., 1996).

Guedes et al. (2008) realizaram estudo sobre a ocorrência de anticorpos anti-N. caninum em soros de vacas e fetos em matadouro e concluíram que N. caninum deve ser incluído no diagnóstico diferencial em casos de abortamento em bovinos no Estado de Minas Gerais, Brasil.

Quando essa infecção atinge o feto em um período em que seu sistema imune ainda não está suficientemente desenvolvido ocorre a multiplicação do protozoário, levando-o à morte geralmente até o 6 mês de prenhes (Linday & Dubey, 1990).

Considerando a escassez de informações sobre a infecção por este parasito nos Estados de Pernambuco e Alagoas, objetivou-se estudar a ocorrência de infecção por N. caninum em vacas e fetos em matadouros.

MATERIAL E MÉTODOS

Área de estudo

As amostras foram coletadas em dois matadouros com Inspeção Municipal, sendo um localizado na cidade de São Joaquim do Monte, Pernambuco e outro na cidade de Viçosa, Alagoas. A cidade de São Joaquim do Monte encontra-se na Mesorregião do Agreste, Microrregião do Brejo Pernambucano. Situa-se a uma latitude 08º25'57" Sul e a uma longitude 35º48'16" Oeste, com uma população bovina de 23.504 cabeças (IBGE 2010). A cidade de Viçosa está localizada na Mesorregião do Leste Alagoano na Microrregião Serrana dos Quilombos, possui referências geográficas: 9º22'17'' Sul e longitude 36º14'27''Oeste. Possui um efetivo de bovinos 31.900 cabeças (IBGE 2010).

Obtenções das amostras biológicas

Foram colhidas um total de 306 amostras de sangue de vacas, onde 133 pertencentes ao estado de Pernambuco e 173 ao Estado de Alagoas e 30 amostras de sangue fetal, sendo três do Estado de Pernambuco e 27 do Estado de Alagoas, independente do estágio de gestação e histórico de problema reprodutivo. A coleta das amostras foi realizada na linha de abate por meio de punção da veia jugular (vacas) ou diretamente do coração (fetos). Após a retração do coágulo sanguíneo, as amostras séricas foram armazenadas em temperatura de freezer até o momento do processamento. Além disso, também foram colhidas amostras de coração e cérebro de 30 fetos que foram mantidos congelados até o seu processamento.

Processamento das amostras

Para a pesquisa de anticorpos anti-N caninum foi empregada a técnica de Imunofluorescência Indireta (RIFI). Como antígeno utilizou-se taquizoítos da cepa NC-1, mantidos em cultura de células VERO e utilizados para sensibilizar as lâminas. Como anticorpo secundário foi utilizado o conjugado comercial anti-bovino IgG (Sigma, USA, F7887) marcado com isotiocianato de fluoresceína. Foram utilizadas nas reações soros controle positivo e negativo. Considerou-se positivo, o soro que apresentou título 200 para vacas e 25 para fetos com completa fluorescência da superfície dos taquizoítos de N. caninum (Dubey & Schares 2008).

As amostras de cérebro e coração foram submetidas à extração de DNA, utilizando-se kit comercial Wizard Genomic DNA Purification (Promega®) de acordo com o protocolo do fabricante.

Para a PCR foram utilizados os pares de primers (Np21=5' GGGTGTGCGTCCAATCCTGTAAC 3') e (Np6=5' CTCGCCAGTCA-ACCTACGTCTTCT 3'). As reações de amplificação foram realizadas para volume final de 12,5µL contendo: 2,5µL de DNA genômico; 0,5µL de cada primer (Np21 e Np6); 2,75µL de Água Mili-Q ultrapura e 6,25µL de MasterMix (mistura para PCR - Promega®) de acordo com o protocolo do fornecedor. O perfil térmico das etapas de reações foi feito em um termociclador BIOER XP Thermal Cycler (Yamage et al. 1996).

Os produtos amplificados foram detectados por eletroforese em gel de agarose a 2%, corados com Blue Green (LGC®), visualizados através de luz ultravioleta e fotodocumentados.

RESULTADOS

Do total de amostras estudadas dos municípios para anticorpos anti-Neospora caninum em soros de vacas, observou-se 12,7% (39/306) de animais positivos, sendo 17,3% (23/133) em São Joaquim do Monte, PE e 9,3% (16/173) no município de Viçosa, AL (Quadro 1).


Na sorologia dos fetos observou-se 16,7% (5/30) de amostras positivas, sendo uma com título 200 e quatro com título 25. Todas as amostras positivas foram procedentes do Estado de Alagoas (Quadro 2).


Na PCR dos fetos em São Joaquim do Monte, observou-se (6/14) 42,85% das amostras teciduais positivas e em Viçosa (2/16) 12,5% de positivos. Nos tecidos fetais pesquisados (cérebro e coração) observaram-se dois fetos positivos no cérebro, quatro no coração e dois fetos positivos tanto no cérebro como no coração, totalizando oito fetos positivos.

DISCUSSÃO

A frequência média global de animais positivos observada neste estudo (12,7%) está dentro do limite de variação observado para outros estados do Brasil, 8,8% no estado do Amazonas (Aguiar et al. 2006) e 53,5% em Mato Grosso (Benetti et al. 2009). Respeitando alguns fatores que podem interferir diretamente na ocorrência de anticorpos nas populações de bovinos estudadas em diferentes regiões do Brasil. Destaca-se que a média observada para os municípios do estado de Pernambuco e Alagoas para vacas abatidas foi consideravelmente inferior àquela observada para vacas abatidas no estado de Minas Gerais (Guedes et al. 2008) que registraram frequência de 97,2%.

A variação observada entre os diferentes estudos pode estar relacionada ao perfil da população de vacas abatidas, pois na Microrregião de Lavras- MG, os animais eram constituídos por vacas mestiças e velhas, descartadas de fazendas produtoras de leite localizadas em oito municípios do Sul de Minas Gerais. Já neste estudo, as vacas eram na sua maioria de raça para corte e constituídos por animais mais jovens. De acordo com Dubey (1999), os animais mais velhos do rebanho apresentam maior risco de infecção pela possibilidade de ingestão de oocistos de N. caninum no ambiente, caracterizando a transmissão horizontal do parasito. Este fato também foi confirmado anteriormente por Sanderson et al. (2000) nos EUA e Guimarães Jr et al. (2004) no Brasil que observaram maior frequência de bovinos infectados por N. caninum com o aumento da idade dos animais.

Outro fator que deve ser considerado para as diferenças observadas é a raça dos animais, pois Munhoz et al. (2009) observaram em estudo realizado no Rio de Janeiro que vacas da raça Holandês preto e branco apresentaram mais chances de infecção quando comparado com animais de raça zebuína e consideraram que a raça é um importante fator de risco individual para a infecção de bovinos.

Quanto à sorologia fetal, observou-se que 16,7% das amostras analisadas foram positivas. Esses resultados são semelhantes àqueles obtidos por Cadore et al. (2010) que realizaram pesquisa de anticorpos em fetos no Sul do Brasil e detectaram 15% de amostras positivas. Ainda se assemelham aos resultados obtidos por Wouda et al. (1997) na Holanda que relataram 17% de positividade e por Sondgen et al. (2001) que detectaram 12,6% de fetos positivos na Alemanha. Outros estudos observaram resultados mais elevados como o de Morales et al. (2001), no México que relataram 77% dos fetos examinados positivos e nos Estados Unidos por Anderson et al. (1995) que observaram 42,5% de positivos. De acordo com Cadore et al.(2010), as variações observadas entre os diferentes estudos podem ser decorrentes principalmente do tipo de amostragem realizada, da técnica utilizada e da diluição do soro.

O resultado obtido na sorologia permite confirmar a infecção fetal por Neospora caninum uma vez que anticorpos detectados contra o parasito indicam que o feto produziu anticorpos, já que nos bovinos não existe a transferência de anticorpos maternos via placenta (Cardoso et al., 2008). Contudo, outros fetos deste estudo também poderiam estar infectados, sem apresentar anticorpos detectáveis, pois de acordo com Dubey (2003), amostras de soro fetal podem apresentar resultado falso-negativo na dependência de fatores como o estágio de desenvolvimento fetal, nível de exposição e tempo entre a infecção e a coleta de sangue. Por outro lado, a presença de anticorpos assegura a ocorrência da infecção congênita sem a interferência da imunidade passiva. Neste estudo, a idade fetal não foi determinada, mas esses resultados indicam que a gestação no caso dos fetos positivos encontrava-se em estágio mais avançado, pois nesse período (terço final da gestação), o sistema imunológico do feto encontra-se apto a responder a estímulos antigênicos, favorecendo a sobrevivência fetal e o nascimento de bezerros sadios ou não (Buxton et al. 2002).

Os resultados deste estudo quanto à sorologia fetal divergem daqueles obtidos por Guedes et al. (2008) que relataram frequência de vacas positivas de 97,2% e somente 12,7% de amostras de soro fetal positivas para animais no estado de Minas Gerais, Brasil. Os autores discutem que a baixa frequência de anticorpos anti-N. caninum em soros fetais, se comparada com outros estudos, pode ser explicada, em parte, pela possibilidade da maioria dos fetos serem oriundos de vacas com idade avançada, que foram enviadas para abate, provavelmente pela baixa produção de leite ou problemas reprodutivos. Neste caso, de acordo com Romero et al. (2002) e Dijstra et al. (2003), a taxa de infecção congênita por N. caninum diminui com o aumento do número de gestações e consequentemente com a idade das vacas. Segundo os mesmos autores, a imunidade adquirida atenua a possibilidade de recrudescência da infecção, reduzindo a taxa de transmissão vertical do N. caninum.

Quanto aos resultados da PCR, observou-se que 26,6% (8/30) dos fetos foram positivos. Os resultados demonstraram que a frequência de amostras positivas nessa técnica foi maior em fetos no matadouro de Pernambuco quando comparado à Alagoas, seguindo a mesma tendência do resultado da sorologia das vacas. Neste estudo, destaca-se, ainda que foram observadas vacas negativas na sorologia e com fetos positivos na sorologia fetal e PCR.

Santos et al. (2011) analisaram amostras de tecidos de 24 fetos no estado de Minas Gerais, Brasil e detectaram que 33.3% apresentaram lesões histológicas compatíveis no encéfalo e coração e dois também no músculo esquelético e fígado. As amostras de cérebro apresentaram resultados na PCR semelhantes ao percentual de positivos obtido neste estudo, mesmo sendo amostras de propriedades com distúrbios reprodutivos. Moore et al. (2002) e Corbellini et al. (2002) também observaram na imuno-histoquímica positividade de 12,1% e 81,8%, respectivamente para os fetos analisados. A diferença observada entre os estudos pode ser justificada, pois o tipo de amostra foi distinta em propriedades com histórico de problemas reprodutivos e ainda de acordo com a sensibilidade da técnica de diagnóstico utilizada.

CONCLUSÃO

Os resultados obtidos neste estudo quanto à presença do parasito nos fetos são inéditos para a região estudada e permitem concluir que este agente deve ser incluído no estudo das causas de aborto na espécie bovina nesta região do Brasil.

Recebido em 29 de fevereiro de 2012.

Aceito para publicação em 12 de junho de 2012.

  • *
    Autor para correspondencia:
    • Anderson M.L., Palmer C.W., Thurmond M.C., Picanso J.P., Blanchard P.C., Breitmeyer R.E., Layton A.W., McAllister M., Daft B., Read D.H., Dubey J.P. & Conrad P.A. 1995. Evaluation of abortions in cattle attributable to neosporosis in selected dairy herds in California. J. Am. Vet. Med. Assoc. 207:1206-1210.
    • Brautigam F.E., Hietala S.K. & Glass R. 1996. Resultados de levantamento sorológico para espécie Neospora em bovinos de corte e leite. Anais 15ş Congresso Panamericano de Ciências Veterinárias, Campo Grande, MS, p.284
    • Buxton D., Maley S.W., Wright S., Thomsom K.M., Rae A.G. & Innes E.A. 2002. The comparative pathogenesis of neosporosis. Trends Parasitol. 18:546-552.
    • Cadore G.C., Vogel F.S.F., Sangioni L.A., Pena H.F.J. & Gennari S.M. 2010. IgM e IgG como marcadores da infecção transplacentária por Neospora caninum em fetos bovinos. Pesq. Vet. Bras. 30:551-553.
    • Cardoso J.M., Funada M.R., Soares R.M. & Gennari S.M. 2008. Perfil sorológico dos anticorpos colostrais para Neospora caninum em bezerros livres da infecção. Braz. J. Vet. Res. Anim. Sci. 45:379-384.
    • Corbellini L.G., Driemeier D., Cruz C.F.E., Gondim L.F.P. & Wald V. 2002. Neosporosis as a cause of abortion in dairy cattle in Rio Grande do Sul, southern Brazil. Vet. Parasitol. 103:195.
    • Dijkstra T., Barkena H., Eysker M., Beiboer M.l. & Wouda W. 2003. Evaluation of a single sorological screening of dairy herds for Neospora caninum antibodies. Vet. Parasitol. 110:161-169.
    • Dubey J.P. 2003. Review of Neospora caninum and Neosporosis in animals. Korean J. Parasitol. 41:1-16.
    • Dubey J.P. & Lindsay D.S. 1996. A review of Neospora caninum and neosporosis. Vet. Parasitol. 67:1-59.
    • Dubey J.P. & Schares G. 2003. Diagnosis of bovine neosporosis. Vet. Parasitol. 141:1-34.
    • Dubey J.P., Carpenter J.L., Speer C.A., Topper M.J. & Uggla A. 1988. Newly recognized fatal protozoan disease of dogs. J. Am. Vet. Med. Assoc. 192:1269-1285.
    • Guedes M.N.P., Guimarães A.M., Rocha M.B.M. & Hirsch C. 2008. Frequência de anticorpos anti-Neospora caninum em vacas e fetos provenientes de municipios do Sul de Minas Gerais. Revta Bras. Parasitol. Vet. 17:189-194.
    • Guimarães Jr J.S., Souza S.L.P., Bergamaschi D.P. & Gennari S.M. 2004. Prevalence of Neospora caninum antibodies and factors associated with their presence in dairy cattle of the north of Paraná state, Brazil. Vet. Parasitol. 124:1-8.
    • IBGE 2010. Instituto Brasileiro de Geografia e Estatística <http://www.ibge.gov.br/home/>
    • Lindsay D.S. & Dubey J.P. 1990. Infections in mice with tachyzoites and bradyzoites of Neospora caninum (Protozoa: Apicomplexa). J. Parasitol. 76:410-413.
    • Moore D.P. 2005. Neosporosis in South America. Vet. Parasitol. 127:87-97.
    • Moore D.P., Campero C.M., Odeón A.C., Posso M.A., Cano D., Luenda M.R., Basso W., Venturini M.C. & Spath E. 2002. Seroepidemiology of beef and dairy herds and fetal study of Neospora caninum in Argentina. Vet. Parasitol. 107:303-316.
    • Morales E., Trigo F.J., Ibarra F., Puente E. & Santa Cruz M. 2001. Neosporosis in Mexican dairy herds: Lesions and immunohistochemical detection of Neospora caninum in fetuses. J. Comp. Pathol. 125:58-63.
    • Munhoz K.F. 2009. Soro-ocorrência de anticorpos contra Neospora caninum em ovinos de propriedades rurais localizadas no norte do Paraná, Brasil. Dissertação de Mestrado em Sanidade Animal, Faculdade de Medicina Veterinária, Universidade Estadual de Londrina, Londrina, PA. 1040p.
    • Romero J.J., Perez E., Dolz G. & Frankena K. 2002. Factors associated with Neospora caninum serostatus in cattle of 20 specialized Costa Rican dairy herds. Prev. Vet. Med. 53:263-273.
    • Sanderson M.W., Gay J.M. & Baszler T.V. 2000. Neospora caninum seroprevalence and associated risk factors in beef cattle in the northwestern United States. Vet. Parasitol. 90:15-24.
    • Santos D.S., Andrade M.P., Varachin M.S. & Guimarães A.M. 2011. Neospora caninum in bovine fetuses of Minas Gerais, Brazil. Rev. Bras. Parasitol. Vet. 20:281-288.
    • Sondgen P., Peters M., Bärwald A., Wurm R., Holling F., Conraths F.J. & Schares G. 2001. Bovine neosporosis: immunoblot improves foetal serology. Vet. Parasitol. 24:279-290.
    • Wouda W., Moen A.R., Visser I.J.R. & Van K.F. 1997. Bovine fetal neosporosis: A comparison of epizootic and sporadic abortion cases and diferent age classes with regard to lesion severity and immunohistochemical identification of organisms in brain, heart and liver. J. Vet. Diagn. Invest. 9:180-18.
    • Yamage M., Flechtner O. & Gottstein B. 1996. Neospora caninum: specific oligonucleotide primers for the detection of brain "cyst" DNA of experimentally infected nude mice by the polymerase chain reaction (PCR). J. Parasitol. 66:272-279.

    * Autor para correspondencia: rinaldo.mota@pq.cnpq.br

    Datas de Publicação

    • Publicação nesta coleção
      24 Out 2012
    • Data do Fascículo
      Out 2012

    Histórico

    • Recebido
      29 Fev 2012
    • Aceito
      12 Jun 2012
    Colégio Brasileiro de Patologia Animal - CBPA Pesquisa Veterinária Brasileira, Caixa Postal 74.591, 23890-000 Rio de Janeiro, RJ, Brasil, Tel./Fax: (55 21) 2682-1081 - Rio de Janeiro - RJ - Brazil
    E-mail: pvb@pvb.com.br