Open-access Toxoplasma gondii in experimentally infected Bos taurus and Bos indicus semen and tissues

Toxoplasma gondii em semen e tecidos de Bos taurus and Bos indicus experimentalmente infectados

Abstract

Eighteen young steers were inoculated with Toxoplasma gondii and randomly distributed into three groups of six animals each: GI, 2.5x10(5) "P" strain oocysts, GII, 5.0x10(6) "RH" strain tachyzoites, and GIII (Control). Clinical, serological and parasitemia exams were realized. Parasite investigation by bioassay and PCR was realized on semen and fragments of skeletal musculature, lymph nodes, brain, retina, spleen, liver, lung, testicle, epididymis and seminal vesicle. Blood and semen samples were collected on days -2, -1, 1, 3, 5, 7, 14 and weekly thereafter, up to postinfection day (PID) 84. The inoculated steers (GI and GII) presented hyperthermia from PID 3 to 16. Antibodies against T. gondii were detected through the indirect fluorescence antibody test (IFAT) on PID 5 (1:16) in both inoculated groups (oocysts and tachyzoites), reaching peaks of 1:4096 on PID 7. Parasitemia outbursts occurred in all infected bovines, principally from PID 7 to 28, independent of the strain and inoculate used. Bioassays revealed the presence of parasites in semen samples of animals infected with oocysts (GI) and tachyzoites (GII) on several experimental days between PID 7 and 84. Tissue parasitism by T. gondii was diagnosed by bioassay and the PCR technique in several organ and tissue fragments. These findings suggest the possibility of sexual transmission of T. gondii in the bovine species.

Cattle; PCR; semen; Toxoplasma gondii; Apicomplexa


Resumo

Dezoito bovinos foram inoculados com Toxoplasma gondii e distribuídos aleatoriamente em três grupos de seis bovinos cada: GI (2,5x10(5) oocistos da cepa "P"), GII (5,0x10(6) taquizoítos da cepa "RH") e GIII (controle). Exames clínicos, sorológicos e parasitêmicos foram realizados. Pesquisas do parasito, por meio da bioprova e pela técnica de Reação em Cadeia pela Polimerase (PCR), foram realizadas no sêmen e em fragmentos de musculatura esquelética, linfonodos, cérebro, retina, baço, fígado, pulmão, testículo, epidídimo e vesícula seminal. Amostras de sangue e sêmen foram colhidas nos dias -2, -1, 1, 3, 5, 7, 14 e, semanalmente, até o 84º dia pós-infecção (DPI). Os bovinos inoculados (GI e GII) apresentaram hipertermia do 3º ao 16º DPI. Anticorpos contra T. gondii foram detectados (IFI) no 5º DPI (1:16), em ambos grupos inoculados (oocistos e taquizoítos), atingindo picos de 1:4096 no 7º DPI. Surtos parasitêmicos ocorreram em todos os bovinos infectados, principalmente do 7º ao 28º DPI, independente da cepa e inóculo utilizados. O bioensaio revelou a presença do parasito em amostras seminais dos bovinos infectados com oocistos (GI) e taquizoítos (GII), em diversas datas experimentais, entre o 7º e 84º DPI. Parasitismo tissular por T. gondii foi diagnosticado por meio da bioprova e pela técnica da PCR, em vários fragmentos de tecidos e/ou órgãos. Os achados sugerem a possibilidade da ocorrência da transmissão sexual do T. gondii na espécie bovina.

Bovinos; PCR; sêmen; Toxoplasma gondii; Apicomplexa


ARTIGO DE REVISÃO

Toxoplasma gondii in experimentally infected Bos taurus and Bos indicus semen and tissues

Toxoplasma gondii em semen e tecidos de Bos taurus and Bos indicus experimentalmente infectados

Leslie ScarpelliI; Welber Daniel Zanetti LopesI; Matheus MiganiI; Katia Denise Saraiva BrescianiII; Alvimar José da CostaI

IDepartamento de Medicina Veterinária Preventiva/ Centro de Pesquisas em Sanidade Animal (CPPAR), Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista (Unesp), Via de Acesso Prof. Paulo Donatto Castellani s/n, Jaboticabal, SP 14884-900, Brazil. E-mail: wdzlopes@hotmail.com

IIDepartamento de Apoio, Produção e Saúde Animal, Unesp, Araçatuba, SP 16050-680

ABSTRACT

Eighteen young steers were inoculated with Toxoplasma gondii and randomly distributed into three groups of six animals each: GI, 2.5x105 "P" strain oocysts, GII, 5.0x106 "RH" strain tachyzoites, and GIII (Control). Clinical, serological and parasitemia exams were realized. Parasite investigation by bioassay and PCR was realized on semen and fragments of skeletal musculature, lymph nodes, brain, retina, spleen, liver, lung, testicle, epididymis and seminal vesicle. Blood and semen samples were collected on days -2, -1, 1, 3, 5, 7, 14 and weekly thereafter, up to postinfection day (PID) 84. The inoculated steers (GI and GII) presented hyperthermia from PID 3 to 16. Antibodies against T. gondii were detected through the indirect fluorescence antibody test (IFAT) on PID 5 (1:16) in both inoculated groups (oocysts and tachyzoites), reaching peaks of 1:4096 on PID 7. Parasitemia outbursts occurred in all infected bovines, principally from PID 7 to 28, independent of the strain and inoculate used. Bioassays revealed the presence of parasites in semen samples of animals infected with oocysts (GI) and tachyzoites (GII) on several experimental days between PID 7 and 84. Tissue parasitism by T. gondii was diagnosed by bioassay and the PCR technique in several organ and tissue fragments. These findings suggest the possibility of sexual transmission of T. gondii in the bovine species.

Index terms: Cattle, PCR, semen, Toxoplasma gondii, Apicomplexa.

RESUMO

Dezoito bovinos foram inoculados com Toxoplasma gondii e distribuídos aleatoriamente em três grupos de seis bovinos cada: GI (2,5x105 oocistos da cepa "P"), GII (5,0x106 taquizoítos da cepa "RH") e GIII (controle). Exames clínicos, sorológicos e parasitêmicos foram realizados. Pesquisas do parasito, por meio da bioprova e pela técnica de Reação em Cadeia pela Polimerase (PCR), foram realizadas no sêmen e em fragmentos de musculatura esquelética, linfonodos, cérebro, retina, baço, fígado, pulmão, testículo, epidídimo e vesícula seminal. Amostras de sangue e sêmen foram colhidas nos dias -2, -1, 1, 3, 5, 7, 14 e, semanalmente, até o 84º dia pós-infecção (DPI). Os bovinos inoculados (GI e GII) apresentaram hipertermia do 3º ao 16º DPI. Anticorpos contra T. gondii foram detectados (IFI) no 5º DPI (1:16), em ambos grupos inoculados (oocistos e taquizoítos), atingindo picos de 1:4096 no 7º DPI. Surtos parasitêmicos ocorreram em todos os bovinos infectados, principalmente do 7º ao 28º DPI, independente da cepa e inóculo utilizados. O bioensaio revelou a presença do parasito em amostras seminais dos bovinos infectados com oocistos (GI) e taquizoítos (GII), em diversas datas experimentais, entre o 7º e 84º DPI. Parasitismo tissular por T. gondii foi diagnosticado por meio da bioprova e pela técnica da PCR, em vários fragmentos de tecidos e/ou órgãos. Os achados sugerem a possibilidade da ocorrência da transmissão sexual do T. gondii na espécie bovina.

Termos de indexação: Bovinos, PCR, sêmen, Toxoplasma gondii, Apicomplexa.

INTRODUCTION

Toxoplasma gondii (Nicolle & Manceaux 1909), an intra-cellular parasite presenting a complex biological cycle, attacks practically all warm-blooded species (Dubey & Beattie 1988), with felines being the only hosts that eliminate oocysts through the feces. All other mammals maintain the asexual biological phase and perform the role of intermediate hosts (Dubey 1995).

Natural infection in cattle was first diagnosed in Germany by Houersdorf & Holtz (1952) and quoted by Sanger et al. (1953). Although oocyst ingestion is the most frequent infection via for T. gondii, other possible disseminating vias for this zoonosis were studied by Dubey (1999).

Data concerning infection by T. gondii in cattle is limited to seroprevalence studies and parasite isolates in tissue, certifying its possible transmission to humans (Dubey & Thulliez, 1993).

Since it is a practically asymptomatic infectious disease, diagnosis is difficult. Besides the conventional laboratory techniques used to detect parasite and antibody presence (bioassay, IFAT and ELISA), Polymerase Chain Reaction (PCR) can significantly contribute to toxoplasmic research, especially in association with the above mentioned techniques (Esteban Redondo et al. 1999).

Although the isolation of T. gondii in the semen of sheep (Spence et al., 1978), goats (Dubey & Sharma, 1980) and swine (Moura et al., 2007) has been successfully realized, there are no studies in the literature that prove the isolation of this protozoan in the semen of cattle presenting toxoplasmic infection. The present study aimed to diagnose the eventual presence of T. gondii in semen samples of experimentally infected steers.

MATERIALS AND METHODS

Toxoplasma gondii strains

Toxoplasma gondii "P" (Jamara & Vieira 1991) and "RH" strains (Sabin 1941) were used in this study.

The inoculants were obtained by means of periodic inoculations of brain cysts ("P" strain) and/or tachyzoites ("RH") in albino mice. T. gondii oocysts were obtained according Dubey et al. (1970).

Eighteen 11 to 12-month-old cattle, 9 Bos taurus and 9 Bos indicus, serologically negative for T. gondii, were selected, identified, randomized and inoculated according to the experimental outline (Table 1). All the animals were maintained in individual bays, where they received water and feed ad libitum.

Serological tests

Serological exams to detect antibodies against other infectious diseases that could provoke reproductive disorders, such as brucellosis, neosporosis and leptospirosis, were realized on all the experimental bovine, both pre and pos inoculation.

Parasitemia was determined by inoculation of the leukocyte layer in mice, in accordance with the technique described by Oliveira et al. (2001).

Blood samples were collected two days prior the inoculation and on 1, 3, 5 and 7, pos inoculation (DPI) then weekly up to 84 (DPI), to obtain serum and investigate the presence of antibodies against T. gondii, using indirect fluorescence antibody test (IFAT) according Camargo (1964).

Bioassay and Polymerase chain reaction (semen and tissues of cattle)

Concurrently, semen samples of the 18 steers were obtained by electroejaculator. Investigation of T. gondii in bovine semen was realized by bioassay, in mice (Teale et al. 1982) and by PCR (Fuents et al., 1996). For the bioassay, 1.0mL aliquot of each semen sample was inoculated into five mice that were examined in accordance with the criteria adopted by Oliveira et al. (2001). The inoculated mice that survived until the 42nd DPI, were euthanized to research T. gondii cysts.

After the experimental period of the semen collection (84 post inoculation days), all of the cattle (inoculated groups and control) were necropsied, in order to carry out research by bioassay (Dubey 1998) and Polymerase chain reaction (Fuents et al. 1996), on tissue parasitism of these animals.

DNA from the semen and tissue (skeletal musculature, lymph nodes, brain, retina, spleen, liver, lung, testicle, epididymis and seminal vesicle) of cattle and positive control samples ("RH") was extracted in accordance the methodology described by Sambrook & Russell (2001). For detection of T. gondii in these samples, a 194 base pair (bp) fragment of the T. gondii B1 gene was amplified using the primers 5'-GGAACTGCATCCGT TCATGAG-3' (B11) and 5'TCTTTAAAGCGTTCGTGGTC -3' (B12) described by Fuentes et al. (1996). PCR was realized by addition of 500ng of DNA in a reaction medium containing 2mM MgCl2, 50mM KCl, 10mM Tris-HCl (pH 9), 0.01% Triton X-100, 0.2mM dNTPs, 10pmoles of initiator and 5.0 units of TaqDNA polymerase.

Analysis of the amplified products was performed by electrophorese on 2% agarose gel containing restriction fragments separated by electrophorese, stained in 0.5µg/mL ethidium bromide solution dissolved in water for 20 min and observed in transilluminator UV.

Tissue parasitism, in cattle, by T. gondii was also investigated by bioassay (Dubey 1998) and PCR (Fuentes et al.1996) in fragments of skeletal musculature, lymph nodes, brain, retina, spleen, liver, lung, testicle, epididymis and seminal vesicle.

Statistical analysis of the post-inoculation Bos taurus and Bos indicus were evaluated using Split Plot in Time analysis, considering the inoculated groups (GI and GII). All statistical analyses were conducted using SAS software (2001).

RESULTS AND DISCUSSION

Experimental toxoplasmic infection of cattle, after inoculation with T. gondii oocysts or tachyzoites, was confirmed by parasitemia and by seroconversion of the animals inoculated with the different strains. Based on the vital signs analyzed, observation showed that animals of GI (oocysts) and GII (tachyzoites) presented hyperthermia from day to 16 PI, independent of the strain and form of the inoculums. These results are similar to those obtained by Esteban Redondo et al. (1999) and Dubey (1983), who reported hyperthermia in cattle experimentally infected with T. gondii from day 5 to 8 PI and 2 to 7 PI, respectively.

Experimental infection triggered a rapid immunological response, with antibody detection occurring from day 5 PI (Table 2). This early humoral immune response in experimental infections of T. gondii was also detected by Berverley & Waston (1971) in sheep and by Moura et al. (2007) in swine. In this study, antibody were firstly detected on day 5 PI and remained at high levels from 7 to 35 DPI, when a gradual reduction in humoral immune response occurred; however, none of the steers were sero-negative by the end of the experimental period.

T. gondii detection in the blood stream, by means of parasitemia, was verified by the seroconversion of mice inoculated with leukocyte layers. Parasitemia outbursts occurred in all the inoculated bovines (Table 3). It should be highlighted that all the cattle of both subspecies studied presented parasitemia (T. gondii), mainly from 7 to 28 PI, independent of the form of infection used. Esteban Redondo et al. (1999) also in cattle, detected parasitemia outbursts similar to those identified in the present research.

While working with calves and cows experimentally infected with T. gondii oocysts, Dubey (1983) detected no parasitemia through the use of mice.

The first report regarding the isolation of T. gondii in semen was a reference cited by Spence et al. (1978), in which Disko et al. (1971) were successful in their attempt to recuperating this agent from semen samples in three out of 125 men who contracted toxoplasmic infection naturally. Later, numerous authors obtained positive results using experimentally infected animal semen samples: Spence et al. (1978), Teale et al. (1982) and Aganga et al. (1988) studying sheep, Dubey & Sharma (1980) studying goats, and Moura et al. (2007), studying swine.

The results of this study report the first description of T. gondii isolated from semen samples of experimentally infected bovines, detected both indirectly (IFAT) and directly (T. gondii brain cysts) in mice inoculated with aliquots of semen from diverse bovine ejaculates collected between 7 and 84 DPI (Table 4). It should be noted that the results obtained by PCR did not fully agree with the bioassays, which presented much greater sensitivity, in comparison with PCR, regarding T. gondii isolation in the experimentally infected bovine reproducers. Hitt & Filice (1992) affirmed that despite presenting minimal practica-bility in the laboratory, the efficacy of the bioassay at isola-ting T. gondii is far greater in relation to the PCR technique. This conclusion was also ratified by Esteban Redondo et al. (1999) regarding the isolation of this protozoan in sheep and bovine.

Tissue parasitism by T. gondii was diagnosed in all the bovines using the bioassay and in 11 out of 12 inoculated animals by the PCR technique. The organs diagnosed as infected by bioassay in decreasing order were the liver and spleen, retina, brain, lung, lymph nodes, testicles, skeletal musculature and seminal vesicle (Table 5). Similar results in cattle were found by Sanger et al. (1953), Jacob et al. (1960), Work (1967), Cata et al. (1969), and Oliveira et al. (2001). In this study the two breeds (Bos taurus and Bos indicus) evaluated showed, in inoculated groups, no statistical difference (P>0,05) between diagnostic (serological tests, bioassay and PCR).

In the present study, a 194 bp segment of the T. gondii B1 gene was amplified, since this gene is present on at least 35 loci in the T. gondii genome (Fuentes et al. 1996, Burg et al. 1989). Verification regarding the most affected organs by means of the PCR technique, in decreasing order, revealed: liver, spleen, brain, skeletal musculature, lung, seminal vesicle and lymph nodes (Table 5).

The absence of positivity for parasitism by PCR, found in genomic samples of semen and certain tissues, does not discard the possibility that the parasitic agent is present. In some of these samples, DNA could have been lost during the extraction technique; also the 500ng of genomic DNA (host + parasite) per reaction, could contain minimal quantities of parasite DNA, insufficient to visualize the amplification of the 194 bp segment of the B1 gene on 2% agarose gel (Aquizerate et al. 1993, Dubey & Thulliez 1993, Esteban Redondo et al. 1999).

Some authors affirm that the PCR technique can be a favorable method when associated with other diagnostic methods (Steuber et al. 1995, Ellis 1998).

CONCLUSION

The isolation of T. gondii in bovine semen associated with tissue parasitism in fragments parts of the reproductive system observed in the present work suggests the viability of sexual transmission of this protozoan in the bovine species.

REFERENCES

Aganga A.O., Umoh J.U., Kyewalabye E.K. & Ekwempu C.C. 1988. Comparative experimental transmission studies with Nigerian isolates and TS-I strain of Toxoplasma gondii in sheep. J. Anim. Prod. Res. 8(1):104-120.

Aquizerate F., Cazenave J., Poirier L., Verin P.H., Cheyrou A., Begueret J. & Lagoutte F. 1993. Detection of Toxoplasma gondii in aqueous humour by the polymerase chain reaction. Brit. J. Ophthalmol. 77(1):107-109.

Beverley J.K.A. & Waston W.A. 1971. Prevention of experimental and of naturally occurring ovine abortion due to toxoplasmosis. Vet. Res. 88(1):39-44.

Burg J.L., Grover C.M., Pouletty P. & Boothroyd J. 1989. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii by Polymerase Chain Reaction. J. Clin. Microbiol. 27(5):1787-1792.

Camargo M.E. 1964. Improvised technique of indirect immunofluores-cence for serological diagnosis of toxoplasmosis. Revta Inst. Med. Trop. São Paulo 6(3):117-118.

Cata G., Bergendi L. & Halkova R. 1969. Isolation of Toxoplasma gondii from swine andcattle. J. Parasitol. 55(9):952-955.

Dubey J.P., Miller N.L. & Frenkel J.K.A. 1970. Characterization of the new fecal from of Toxoplasma gondii. J. Parasitol. 56(4):447-450.

Dubey J.P. & Sharma S.P. 1980. Parasitemia and tissue infection in sheep fed Toxoplasma gondii oocysts. J. Parasitol. 66(1):111-119.

Dubey J.P. 1983. Distribution of cysts and tachyzoites in calves and pregnant cows inoculated with Toxoplasma gondii oocysts. Vet. Parasitol. 13(1):199-201.

Dubey J.P. & Beattie C.P. 1988. Toxoplasmosis of Animal and Man. CRC Press, Boca Raton. 200p.

Dubey J.P. & Thulliez P. 1993. Persistence of tissue cysts in edible tissues of cattle fed Toxoplasma gondii oocysts. Am. J. Vet. Res. 54(2): 270-273.

Dubey J.P. 1995. Duration of immunity to shedding of Toxoplasma gondii oocysts by cats. J. Parasitol. 81(3):410-415.

Dubey J.P. 1998. Refinement of pepsin digestion method for isolation of Toxoplasma gondii from infected tissues. Vet. Parasitol.74(1):75-77.

Dubey J.P., Shen S.K., Kwow O.C.H. & Frenkel J.K. 1999. Infection and immunity with the RH strain of Toxoplasma gondii in rats and mice. J. Parasitol. 85(5):657-662.

Ellis J.T. 1998. Polymerase chain reaction approaches for the detection of Neospora caninum and Toxoplasma gondii. Int. J. Parasitol. 28(9): 1053-1060.

Esteban Redondo, Maley S.W., Thomson K., Nicoli S., Wright S., Buxton D. & Innes E.A. 1999. Detection of Toxoplasma gondii in tissues of sheep and cattle following oral infection. Vet. Parasitol. 86(1):155-157.

Fuents S.I., Rodriguez M., Domingo C.J., Fernando C.C., Juncosa T. & Alvar J. 1996. Urine sample used for congenital toxoplasmosis diagnosis by PCR. J. Clin. Microbiol. 3(10):2368-2372.

Hitt J. & Filice G. 1992. Detection of Toxoplasma gondii parasitemia by gene amplification cell culture and mouse-inoculation. J. Clin. Microbiol. 30(10):3181-3184.

Jacobs L., Remington J.S. & Mecton M.L. 1960. A survey of meat samples from swine, cattle and sheep for the presence of encysted Toxoplasma. J. Parasitol. 46(1):23-28.

Jamara L.M.F. & Vieira M.P.L. 1991. Isolamento do Toxopalsma gondii de exudato peritoneal e órgãos de camundongos com infecção experimental. Revta Inst. Med. Trop. São Paulo 33(4):435-441.

Moura A.B., Costa A.J., Filho J.S., Paim B.B., Pinto F.R. & Di Mauro D.C. 2007. Toxoplasma gondii in semen of experimentally infected swine. Pesq. Vet. Bras. 27(10):430-434.

Nicolle C. & Manceaux L. 1909. Sur un protozoaire nouveau du gondii. Acad. Sci. 148:369.

Oliveira F.C.R., Costa A.J., Bechara G.H. & Sabatini G.A. 2001. Distribuição e viabilidade de cistos de Toxoplasma gondii (Apicomplexa: Toxoplasmatinae) em tecidos de Bos indicus, Bos taurus and Bubalus bubalis infectados com oocistos de. Revta Bras. Med. Vet. 23(1):28-34.

Sas, Institute. 2001. SASâ User's Guide: Estatistics. SAS Institute Inc., Cary, NC, USA.

Sabin A.B. 1941. Toxoplasmic encephalitis in children. J. Am. Med. Assoc. 116(5):801-807.

Sambrook J. & Russell D.W. 2001. Molecular Cloning. 3rd ed. Cold Spring Harbor Press, New York.

Sanger V.L., Chamberlani K.W., Cole C.R. & Farrell R.L. 1953. Toxo-plasmosis isolation of Toxoplasma gondii from cattle. J. Am. Vet. Med. Assoc. 123(1):87-91.

Spence J.B., Beattie J., Faulkner L. & Watson W.A. 1978. Toxoplasma gondii in the semen of rams. Vet. Rec. 102(1):38-39.

Steuber V., Niu A., Bauer C., Reetz J., Roth A. & Janitschike K. 1995. Detection of Toxoplasma gondii in tissues of ovine abortions using the polymerase chain reaction. Dtsch. Tierãrztl. Wochenschr. 102(1):91-96.

Teale A.J., Blewett D.A., Miller J.K. & Buxton D. 1982. Experimentally induced toxoplasmosis in young rams: The clinical syndrome and semen secretion of Toxoplasma. Vet. Rec. 111(1):53-55.

Work K. 1967. Isolation of Toxoplasma gondii from the flesh of sheep, swine and cattle. Acta Pathol. Microbiol. Scand. 71(2):296-306.

Received on April 30, 2008.

Accepted for publication on August 19, 2008.

References

  • Aganga A.O., Umoh J.U., Kyewalabye E.K. & Ekwempu C.C. 1988. Comparative experimental transmission studies with Nigerian isolates and TS-I strain of Toxoplasma gondii in sheep. J. Anim. Prod. Res. 8(1):104-120.
  • Aquizerate F., Cazenave J., Poirier L., Verin P.H., Cheyrou A., Begueret J. & Lagoutte F. 1993. Detection of Toxoplasma gondii in aqueous humour by the polymerase chain reaction. Brit. J. Ophthalmol. 77(1):107-109.
  • Beverley J.K.A. & Waston W.A. 1971. Prevention of experimental and of naturally occurring ovine abortion due to toxoplasmosis. Vet. Res. 88(1):39-44.
  • Burg J.L., Grover C.M., Pouletty P. & Boothroyd J. 1989. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii by Polymerase Chain Reaction. J. Clin. Microbiol. 27(5):1787-1792.
  • Camargo M.E. 1964. Improvised technique of indirect immunofluores-cence for serological diagnosis of toxoplasmosis. Revta Inst. Med. Trop. São Paulo 6(3):117-118.
  • Cata G., Bergendi L. & Halkova R. 1969. Isolation of Toxoplasma gondii from swine andcattle. J. Parasitol. 55(9):952-955.
  • Dubey J.P., Miller N.L. & Frenkel J.K.A. 1970. Characterization of the new fecal from of Toxoplasma gondii J. Parasitol. 56(4):447-450.
  • Dubey J.P. & Sharma S.P. 1980. Parasitemia and tissue infection in sheep fed Toxoplasma gondii oocysts. J. Parasitol. 66(1):111-119.
  • Dubey J.P. 1983. Distribution of cysts and tachyzoites in calves and pregnant cows inoculated with Toxoplasma gondii oocysts. Vet. Parasitol. 13(1):199-201.
  • Dubey J.P. & Beattie C.P. 1988. Toxoplasmosis of Animal and Man. CRC Press, Boca Raton. 200p.
  • Dubey J.P. & Thulliez P. 1993. Persistence of tissue cysts in edible tissues of cattle fed Toxoplasma gondii oocysts. Am. J. Vet. Res. 54(2): 270-273.
  • Dubey J.P. 1995. Duration of immunity to shedding of Toxoplasma gondii oocysts by cats. J. Parasitol. 81(3):410-415.
  • Dubey J.P. 1998. Refinement of pepsin digestion method for isolation of Toxoplasma gondii from infected tissues. Vet. Parasitol.74(1):75-77.
  • Dubey J.P., Shen S.K., Kwow O.C.H. & Frenkel J.K. 1999. Infection and immunity with the RH strain of Toxoplasma gondii in rats and mice. J. Parasitol. 85(5):657-662.
  • Ellis J.T. 1998. Polymerase chain reaction approaches for the detection of Neospora caninum and Toxoplasma gondii Int. J. Parasitol. 28(9): 1053-1060.
  • Esteban Redondo, Maley S.W., Thomson K., Nicoli S., Wright S., Buxton D. & Innes E.A. 1999. Detection of Toxoplasma gondii in tissues of sheep and cattle following oral infection. Vet. Parasitol. 86(1):155-157.
  • Fuents S.I., Rodriguez M., Domingo C.J., Fernando C.C., Juncosa T. & Alvar J. 1996. Urine sample used for congenital toxoplasmosis diagnosis by PCR. J. Clin. Microbiol. 3(10):2368-2372.
  • Hitt J. & Filice G. 1992. Detection of Toxoplasma gondii parasitemia by gene amplification cell culture and mouse-inoculation. J. Clin. Microbiol. 30(10):3181-3184.
  • Jacobs L., Remington J.S. & Mecton M.L. 1960. A survey of meat samples from swine, cattle and sheep for the presence of encysted Toxoplasma. J. Parasitol. 46(1):23-28.
  • Jamara L.M.F. & Vieira M.P.L. 1991. Isolamento do Toxopalsma gondii de exudato peritoneal e órgãos de camundongos com infecção experimental. Revta Inst. Med. Trop. São Paulo 33(4):435-441.
  • Moura A.B., Costa A.J., Filho J.S., Paim B.B., Pinto F.R. & Di Mauro D.C. 2007. Toxoplasma gondii in semen of experimentally infected swine. Pesq. Vet. Bras. 27(10):430-434.
  • Nicolle C. & Manceaux L. 1909. Sur un protozoaire nouveau du gondii Acad. Sci. 148:369.
  • Oliveira F.C.R., Costa A.J., Bechara G.H. & Sabatini G.A. 2001. Distribuição e viabilidade de cistos de Toxoplasma gondii (Apicomplexa: Toxoplasmatinae) em tecidos de Bos indicus, Bos taurus and Bubalus bubalis infectados com oocistos de. Revta Bras. Med. Vet. 23(1):28-34.
  • Sas, Institute. 2001. SASâ User's Guide: Estatistics. SAS Institute Inc., Cary, NC, USA.
  • Sabin A.B. 1941. Toxoplasmic encephalitis in children. J. Am. Med. Assoc. 116(5):801-807.
  • Sambrook J. & Russell D.W. 2001. Molecular Cloning. 3rd ed. Cold Spring Harbor Press, New York.
  • Sanger V.L., Chamberlani K.W., Cole C.R. & Farrell R.L. 1953. Toxo-plasmosis isolation of Toxoplasma gondii from cattle. J. Am. Vet. Med. Assoc. 123(1):87-91.
  • Spence J.B., Beattie J., Faulkner L. & Watson W.A. 1978. Toxoplasma gondii in the semen of rams. Vet. Rec. 102(1):38-39.
  • Steuber V., Niu A., Bauer C., Reetz J., Roth A. & Janitschike K. 1995. Detection of Toxoplasma gondii in tissues of ovine abortions using the polymerase chain reaction. Dtsch. Tierãrztl. Wochenschr. 102(1):91-96.
  • Teale A.J., Blewett D.A., Miller J.K. & Buxton D. 1982. Experimentally induced toxoplasmosis in young rams: The clinical syndrome and semen secretion of Toxoplasma. Vet. Rec. 111(1):53-55.
  • Work K. 1967. Isolation of Toxoplasma gondii from the flesh of sheep, swine and cattle. Acta Pathol. Microbiol. Scand. 71(2):296-306.

Publication Dates

  • Publication in this collection
    12 Mar 2009
  • Date of issue
    Jan 2009

History

  • Accepted
    19 Aug 2008
  • Received
    30 Apr 2008
location_on
Colégio Brasileiro de Patologia Animal - CBPA Pesquisa Veterinária Brasileira, Caixa Postal 74.591, 23890-000 Rio de Janeiro, RJ, Brasil, Tel./Fax: (55 21) 2682-1081 - Rio de Janeiro - RJ - Brazil
E-mail: pvb@pvb.com.br
rss_feed Acompañe los números de esta revista en su lector de RSS
Ir para arriba Notificar error