Abstracts
Identification of Escherichia coli requires knowledge regarding the prevalent serotypes and virulence factors profiles allows the classification in pathogenic/non-pathogenic. However, some of these bacteria do not express flagellar antigen invitro. In this case the PCR-restriction fragment length polymorphism (RFLP-PCR) and sequencing of the fliC may be suitable for the identification of antigens by replacing the traditional serology. We studied 17 samples of E. coli isolated from animals and presenting antigen H nontypeable (HNT). The H antigens were characterized by PCR-RFLP and sequencing of fliC gene. Three new flagellin genes were identified, for which specific antisera were obtained. The PCR-RFLP was shown to be faster than the serotyping H antigen in E. coli, provided information on some characteristics of these antigens and indicated the presence of new genes fliC.
Escherichia coli; H antigen; PCR-RFLP; sequencing; serotyping
A identificação da Escherichia coli requer conhecimento sobre os sorotipos e fatores de virulência prevalentes permitindo a classificação em patogênico/não patogênico. No entanto, algumas destas bactérias não expressam o antígeno flagelar in vitro. Neste caso, o PCR-restriction fragment length polymorphism (RFLP-PCR) e o sequenciamento do gene fliC podem ser adequados para a identificação desses antígenos, substituindo a sorologia tradicional. Nesta pesquisa foram estudadas 17 amostras de E. coli isoladas de animais e que apresentavam antígeno H não tipável (HNT). Os antígenos H foram caracterizados por PCR-RFLP e sequenciamento do gene fliC. Três novos genes da flagelina foram identificados, para os quais anti-soros específicos foram obtidos. A técnica PCR-RFLP mostrou-se mais rápida que a sorotipagem do antígeno H em E. coli, fornecendo informações sobre algumas características desses antígenos e indicou a presença de novos genes fliC.
Escherichia coli; antígeno H; PCR-RFLP; sequenciamento; sorotipagem
LIVESTOCK DISEASES
Identification of new flagellin-encoding fliC genes in Escherichia coli isolated from domestic animals using RFLP-PCR and sequencing methods
Identificação de novas flagelinas codificadas por fliC em Escherichia coli isoladas de animais domésticos utilizando RFLP-PCR e sequenciamento
Cláudia de MouraI,* * Corresponding author: cmoura.bio@gmail.com ; Monique Ribeiro TibaII; Marcio José da SilvaIII; Domingos da Silva LeiteII
IInstituto de Ciências da Saúde, Universidade Paulista (UNIP), Av. Armando Giassetti 577, Vila Hortolândia, Trevo Itu/Itatiba, Jundiaí, SP 13214-525, Brazil
IILaboratório de Antígenos Bacterianos II, Departamento de Genética, Evolução e Bioagentes, Instituto de Biologia, Universidade Estadual de Campinas (Unicamp), Cx. Postal 6109, Campinas, SP 13083-970, Brazil
IIICentro de Biologia Molecular e Engenharia Genética, Instituto de Biologia, Unicamp, Cx. Postal 6109, Campinas, SP
ABSTRACT
Identification of Escherichia coli requires knowledge regarding the prevalent serotypes and virulence factors profiles allows the classification in pathogenic/non-pathogenic. However, some of these bacteria do not express flagellar antigen invitro. In this case the PCR-restriction fragment length polymorphism (RFLP-PCR) and sequencing of the fliC may be suitable for the identification of antigens by replacing the traditional serology. We studied 17 samples of E. coli isolated from animals and presenting antigen H nontypeable (HNT). The H antigens were characterized by PCR-RFLP and sequencing of fliC gene. Three new flagellin genes were identified, for which specific antisera were obtained. The PCR-RFLP was shown to be faster than the serotyping H antigen in E. coli, provided information on some characteristics of these antigens and indicated the presence of new genes fliC.
Index terms:Escherichia coli, H antigen, PCR-RFLP, sequencing, serotyping.
RESUMO
A identificação da Escherichia coli requer conhecimento sobre os sorotipos e fatores de virulência prevalentes permitindo a classificação em patogênico/não patogênico. No entanto, algumas destas bactérias não expressam o antígeno flagelar in vitro. Neste caso, o PCR-restriction fragment length polymorphism (RFLP-PCR) e o sequenciamento do gene fliC podem ser adequados para a identificação desses antígenos, substituindo a sorologia tradicional. Nesta pesquisa foram estudadas 17 amostras de E. coli isoladas de animais e que apresentavam antígeno H não tipável (HNT). Os antígenos H foram caracterizados por PCR-RFLP e sequenciamento do gene fliC. Três novos genes da flagelina foram identificados, para os quais anti-soros específicos foram obtidos. A técnica PCR-RFLP mostrou-se mais rápida que a sorotipagem do antígeno H em E. coli, fornecendo informações sobre algumas características desses antígenos e indicou a presença de novos genes fliC.
Termos de indexação:Escherichia coli, antígeno H, PCR-RFLP, sequenciamento, sorotipagem.
INTRODUCTION
Escherichia coli is the predominant member of normal human and animal intestinal flora. This species also includes different virulence factors and serotypes associated with intestinal and extraintestinal diseases. The antigen O and H (O polysaccharide and flagellin, respectively) are the two major antigens of Gram-negative bacteria (Blanco et al. 2003, Hussein 2007, Mattsson & Wallgren 2008). Since the early 1940s, the gold-standard technique for O and H characterization has been the agglutination test for E. coli serotyping, with 187 "O" and 53 "H" being characterized to date. Serology has been used to track strains in epidemiological studies and has allowed the characterization of pathogenic E. coli serotypes (Mattsson & Wallgren 2008).
Several serotypes are associated with human illnesses and all of them are pathotypes associated with animals: O2:H5, 6, 7, 29; O8:H2, 19, 21; O20:H19; O22:H8; O25:H2; O26:H11, HNT; O45:H2; O91:H10, 21; O103:H2; O105:H18; O111:H8; O112ac:H19, 5; O113:H21; O118:H16; O119:H2, 6; O121:H19; O128:H2; O128ab:H2, 6; O145:H25, 28, O146:H21; O153:H25; O157:H7; O163:H19; O165:H25; O174:H2; 721; ONT:H2, 8, 11, 25, 28, 33, and 41 (Blanco et al. 2003, Hussein 2007, Mattsson & Wallgren 2008). However, several difficulties have been observed in H antigen serotyping: (I) the expression of H-antigens can be dependent on various environmental signals; (II) the identification of H antigen is a time-consuming process and requires the use of 53 specific antisera; and (III) there are a high number of cross-reactions among E. coli strains (Blanco et al. 2003, Hussein 2007, Mattsson & Wallgren 2008). This procedure is important, because identification of a particular H antigen saves time and reduces the number of antisera required to identify the O antigens in E. coli strains (Blanco et al. 1992, Moreno et al. 2006).
The flagellum (the organelle responsible for motility) consists of repeated subunits of the protein flagellin that are expressed by fliC gene (Fields et al. 1997). Studies have demonstrated that PCR-restriction fragment length polymorphism (RFLP-PCR) analysis could be used for identifying these antigens, replacing serology as a traditional technique (Machado et al. 2000). The polymorphism of the fliC gene reflects the structure of the flagellin molecule. Amino-acid sequences among the flagellin proteins from different H serotypes are well conserved in their N- and C-terminal regions, which bear the essential functions for protein export through the flagellum specific type III secretion machinery and for polymerization into the filament (MacNab 1992). On the other hand, the central regions are variable in length and amino-acid sequence, carrying H serotype-specific epitopes (Reid et al. 1999).
The RFLP-PCR for fliC gene has been developed by other authors who have shown that the restriction analysis of this gene could be used to type both O157:H7 and O157:H-Shiga toxin-producing E. coli strains (Fields et al. 1997). Subsequently, in a study involving strains isolated from human sources, a data base was constructed from all restriction profiles of H patterns, allowing to identify through this technique all the genes involved in expression of flagellins (Machado et al. 2000). These methods have shown to be important for serotyping, determining genetic relationships and for epidemiological studies (Fields et al. 1997, Machado et al. 2000, Moreno et al. 2006). However, some H antigen cannot be characterized by RFLP-PCR for fliC, and for this reason, some authors use sequencing methods to identify new putative flagellins expressed by fliC genes or other genes that can express flagellin (Machado et al. 2000, Prager et al. 2003, Tominaga 2004). In the present study, we characterized the flagellin genes from 17 E. coli strains, using PCR-RFLP methods and sequencing. We produced antisera for serology identification of new flagellin genes and also to confirm the presence of new antigens. The fliC-RFLP technique proved to be faster than classic serotyping for determining the E. coli H antigen, characterizing the antigens in a few days and indicating new putative genes.
MATERIALS AND METHODS
Bacterial strains. A total of 53 Escherichia coli control strains for H antigen were analyzed, as well as 17 E. coli strains belonging to the E. coli collection of the Bacterial Antigen Laboratory, Department of Genetic, Evolution and Bioagents, Institute of Biology, Unicamp, Brazil. The strains were isolated from sporadic diarrhea cases in different time periods from bovine, swine and sheep (Table 1). The strains were serotyped using O and H standard antisera (Blanco et al. 1992) and all of them presented the non typeable H antigen (HNT).
DNA extraction, PCR and RFLP analysis. E. coli strains were grown in 3ml of Luria-Bertani broth medium overnight at 37ºC. The genomic DNA was obtained using the Wizard® Genomic DNA kit (Invitrogen, USA). PCR for fliC gene and RFLP analysis was performed according to the methods described previously (Fields et al. 1997, Machado et al. 2000) using the FliCF1: 5'ATGGCACAAGTCATTAATACCCAAC3'; FliCF2: 5'CTAACCCTGCAGCAGAGACA3' and FliCM1: 5'CAAGTCATTAATAC(A/C)AACAGCC3'; FliCM2: 5'GACAT(A/G)TT (A/G)GA(G/A/C)ACTTC(G/C)GT3' primers (Fields et al. 1997, Machado et al. 2000). PCR was performed in the Thermal Cycler (Gene Amp PCR System 9700/Perkin Elmer Corporation, Norwalk CT/USA), with 50 µL reaction volumes containing 2mM MgCl2, 1 µM of each primer and 1.5 U of Taq DNA polymerase (Fermentas, Waltham, USA). PCR was developed using cycles of denaturation for 1 min at 95ºC, annealing for 1 min at 50-60ºC and final extension step for 7 min at 72ºC. PCR-Fields products were digested with the RsaI restriction enzyme (Invitrogen, USA) and PCR-Machado products were digested with the HhaI restriction enzyme (Fermentas, USA) according to the manufacturer's instructions. The RFLP fragments were separated in 2% agarose gels by horizontal electrophoresis for 3h at 10V/cm. The restriction fragments were stained with ethidium bromide and documented by Image Master VDS (Amersham Pharmacia Biotech/ USA). Gel Compar II (Applied Maths/ Belgium) was used to identify RFLP patterns and to establish a database for fliC fingerprinting. Fragments were considered identical if their sizes did not differ by more than 3.5% (allowable error).
Gene sequence analysis. Sequencing was carried out using the Big Dye kit (Amersham Biosciences, USA) and the 3700 DNA Analyzer (Applied Biosystems, Foster City, CA/USA) sequencer. The sequence data were assembled using the ChromasPro package (http://www.technelysium.com.au/chromas.html). Gene sequence searches were conducted using the BLAST and GenBank databases (NCBI website home page). Sequence alignments and comparisons were performed using ClustalW (http://www.ebi.ac.uk/Tools/clustalw2/index.html).
Nucleotide sequences and accession numbers. The DNA sequences of the new fliC genes of the E. coli HNT were deposited into the GenBank database under accession numbers HQ116826 to HQ116828.
Production of antisera of HNT antigen. The HNT antigen (non typeable antigens) suspensions used for the production of antisera were prepared according to the methodology described previously (MacNab 1992). Bacterial strains were cultured in U tubes in consecutive passages at 37ºC for 18hs for E. coli motility. After this, the strains were grown in Brain Hearth Infusion Broth (Difco, Sparks, USA) at 37ºC for 18hs and then were inactivated with an equal volume of formalin solution. These HNT antigens were inoculated in rabbits at serial doses of 0.5mL to 4.0mL and their blood was collected to obtain the antiserum and stored at -20ºC.
Determination of HNT antisera titers and absorption of antisera. The titers of HNT antisera were determined by using serial dilutions of antisera from 1:100 to 1:25,600. For the agglutination tests, Kahn tubes were used containing 200µL of HNT of each H antigen (homologous HNT antigen and all 53 H control antigen) and equal volume of HNT antiserum. The tubes were incubated at 45ºC in a water bath for 3 hours. For unspecific reactions the antisera were absorbed against heterologous antigen using protocol described previously (Ewing's 1986).
RESULTS
We began by testing the primers for PCR amplification for control strains and non-typeable strains. Then, the PCR products were submitted to RFLP analysis using specific restriction enzymes. To confirm the RFLP patterns, we sequenced fliC genes and this allowed us to compare with antisera agglutination.
Detection of fliC genes in Escherichia coli strains by RFLP-PCR
With the exception of H17, H25, H53 and H54 (flagellin expressed by other genes), the fliC genes of 49 control E. coli H strains were amplified, digested, and submitted to RFLP analysis. A common pattern was observed in RFLP-PCR for the fliC gene using primers FliCF1/2 and RsaI from H1, H28 and H31 (P1); H2, H30 and H35 (P2), H3 and H8 strains (P3); H7, H19 and H27 (P7); H9 and H14 (P9); H11 and H47 (P11); H55 and H56 (P40). To further characterize these alleles, we performed RFLP with the primers FliCM1/2 and HhaI endonuclease. The fliC genes encoding the H3 and H8; H11 and H47; H19 and H27; H55 and H56 antigens were not differentiated by HhaI restriction analysis. However, the H1, H28 and H31; H2, H30 and H35; H9 and H14; H7 strains were distinguishable when the PCR fragments were restricted with HhaI (Table 2).
Detection of fliC gene and RFLP analysis of non typeable (HNT) E. coli strains
The fliC gene was amplified in all the analyzed strains (Table 3) and a common pattern was observed for the fliC gene with nine E. coli strains. In five bovine strains, two were serotyped as O20:H16 (P13), one as O123:H34 (P23), another as O141:H34 (P23) and one as O159:H34 (P23). Two strains isolated from pigs were classified as O128:H2 (P2). Two strains isolated from sheep had the gene fliC characterized as O157:H33 (P22) and O8:H44 (P36). Eight E. coli strains did not present restriction patterns by both primers used (Table 3).
Sequencing analysis of fliC gene in E. coli HNT
In five E. coli strains, it was possible to characterize the antigen with partial sequences. Strains isolated from swines were characterized, determining O11:H7 (two strains) and ONT:H32 (one strain). Antigens of two strains isolated from sheep were determined as O42:H25 (Figure 1). Three E. coli strains, two isolated from bovine (serogroup O8) and one isolated from avian (serogroup O121) were completely sequenced. The avian E. coli isolate showed close genetic relations with the H45, up to 97% similarity, and with the fliC gene of Shigella boydii, so, this strain was considered to be associated with a new flagellin gene. Regarding the bovine strains, one of them showed total homology with the H2 antigen gene, but the antigen produced did not react with H2 antiserum. The second strain showed total homology with a sequence of the new fliC gene, recently described with the accession number CQ423574.
Antisera production and serology from the novel fliC antigens
Antisera against the flagellar antigens were produced from the strains HNT 3C, 4C and 40C. All antisera showed positive results for the homologous H antigen when diluted up to 1:12,800. However, none of them produced strong agglutination with the other 53 reference H antigens. The unspecific reactions disappeared when the antisera were absorbed with heterologous antigens.
DISCUSSION
The definition of Escherichia coli pathotypes according to their virulence profile mainly implies a correlation between pathogenic factors and specific serotypes. Therefore, serotype grouping (O- and H-antigens) of pathogenic E. coli strains remains the first line of characterization and is considered the gold-standard approach in subtyping pathogenic bacteria. According to some authors, only when the serotype of clinical isolates is established can the other molecular methods for subtyping and fingerprinting be reasonably applied (Fields et al. 1997, Prager et al. 2003, Moreno et al. 2006).
With the purpose of streamlining the process of serotyping of E. coli strains, alternative methods for subtyping them have been widely applied, which focus on establishing relationships between the provoked human diseases and the specific serotypes of E. coli present in infections. Some studies using RFLP-PCR have been successfully applied with strains isolated from humans, and all of them showed good results for characterizing H antigens (Botelho et al. 2003, Prager et al. 2003, Moreno et al. 2006).
Different E. colifliC PCR products could be detected in association with all H-antigens (H1 to H56 antigens) identified serologically in an E. coli reference collection. In our analysis, some E. coli reference strains for H antigens (H17, H25, H53 and H54) did not amplify the fliC gene. This result was expected because these flagellar antigens were not expressed by fliC, but by other genes like flnA (H17) (Ratiner et al. 2010), flkA (H53) and flmA (H54) (Tominaga 2004). Other studies have already demonstrated that it is possible to classify the non typeable strains through conventional serology techniques using RFLP-PCR, demonstrating that this method can be more efficient (Botelho et al. 2003, Badri et al. 2010). In our work, it was possible to characterize nine H antigens through the RFLP method, confirming previous reports on the limitation of serological methods (Prager et al. 2003, Moreno et al. 2006, Badri et al. 2010). Moreover, beyond the RFLP-PCR, applying sequencing techniques, we could successfully serotype other strains, permitting the identification of three putative new genes of flagellin in HNT E. coli strains. These findings were confirmed by the production of rabbit antiserum and by endpoint agglutination tests with all known H-antigen reference strains. Defining and establishing new H antigen types remains a main task for the International Escherichia and Klebsiella Centre (WHO).
Other authors characterized 43 of 53 H antigen expressed by fliC gene of E. coli by sequencing analysis (Wang et al. 2003). Through the construction of these databases, the characterization of other H antigens became much more efficient with the use of partial or total sequences since N- and C- regions of the gene are conserved between all the different antigens (Wang et al. 2003). Using the fliC sequence from the GenBank database website, it was possible to obtain information from the partial sequences, being the starting point for characterizing the remaining strains used in the present study. The total sequencing of the gene was not necessary since the partial sequence had demonstrated 100% similarity to the described H antigens already used in previous described reports (Wang et al. 2003, Feng et al. 2008).
The antisera produced against H antigens and not characterized by the RFLP-PCR techniques of sequencing had shown to be highly specific to its homologous antigens; however, it demonstrated a low specificity to other control antigens (H1 to the H56), demonstrating that it is probably related to a new antigen that has not yet been described in the literature.
A number of concerns could be raised about the RFLP-PCR method. For instance, the fliC gene may not be amplified by PCR due to inadequate primer homology. However, we observed that the amplification could be obtained in most cases, warranting the use of this technique. Another potential limitation is that, since there are unknown fliC alleles, these alleles could not be matched with known RFLP-PCR profiles. However, if these genes were obtained by epidemiological studies, they may soon be determined as new patterns might be described for the diarrheagenic strains of E.coli, thus permitting a widespread use of this technique for characterizing fliC genes, which can be used to determine the H antigen of the E. coli strains by sequencing techniques, as we did in this study. As previously mentioned, classic serotyping methods presents stronger limitations than the RFLP-CR sequencing methods. Moreover, the potential limitations of the classical serotyping techniques can be successfully complemented with the RFLP-PCR methods (Botelho et al. 2003, Prager et al. 2003, Amhaz et al. 2004, Moreno et al. 2006, Beutin et al. 2007, Badri et al. 2010).
The results observed in this study permitted us to conclude that molecular methods (RFLP-PCR) showed to be more efficient in detecting H antigen of E. coli strains. The fliC-RFLP techniques proved to be faster than the classic serotyping methods for the detection of the E. coli H antigens. The RFLP-PCR/sequencing techniques were capable of rapidly determining H antigens, leading to the discovery of new flagellin genes produced by these bacteria.
Acknowledgements.- C. Moura, has a PhD fellowship granted by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). This study was supported by grants from FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo (Grant 2005/00713-0).
Received on January 15, 2013
Accepted for publication on February 14, 2013
- Amhaz J.M., Andrade A., Bando S.Y., Tanaka T.L., Moreira-Filho C.A. & Martinez M. 2004. Molecular typing and phylogenetic analysis of enteroinvasive Escherichia coli using the fliC gene sequence. FEMS Microbiol. Lett. 15:259-264.
- Badri S., Fassouane A., Filliol I., Hassar M. & Cohen N. 2010. Sequence analysis of the gene encoding H antigen in Escherichia coli isolated from food in Morocco. J. Microbiol. 48:184-187.
- Beutin L. & Strauch E. 2007. Identification of sequence diversity in the Escherichia coli fliC genes encoding flagellar types H8 and H40 and its use in typing of Shiga toxin-producing E. coli O8, O22, O111, O174, and O179 strains. J. Clin. Microbiol. 45:333-339.
- Blanco J., Blanco M., Alonso M.P., Blanco J.E., Garabal J.I. & González E.A. 1992. Serogroups of Escherichia coli strains producing cytotoxic necrotizing factors CNF1 and CNF2. FEMS Microbiol. Lett. 15:155-159.
- Blanco M., Blanco J.E., Mora A., Rey J., Alonso J.M., Hermoso M., Hermoso J., Alonso M.P., Dahbi G., González E.A., Bernárdez M.I. & Blanco J. 2003. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J. Clin. Microbiol. 41:1351-1356.
- Botelho B.A., Bando S.Y., Trabulsi L.R. & Moreira-Filho C.A. 2003. Identification of EPEC and non-EPEC serotypes in the EPEC O serogroups by PCR-RFLP analysis of the fliC gene. J. Microbiol. Methods. 54:87-93.
- Ewing's W.H. 1986. The genus Escherichia, p.93-134. In: Edwards P.R. & Ewing's W.H. (Eds), Identification of Enterobacteriaceae. 4th ed. Burgess, Minneapolis.
- Feng L., Liu B., Liu Y., Ratiner Y.A., Hu B., Li D., Zong X., Xiong W. & Wang L. 2008. A genomic islet mediates flagellar phase variation in Escherichia coli strains carrying the flagellin-specifying locus flk J. Bacteriol. 190:4470-4477.
- Fields P.I., Blom K., Hughes H.J., Helsel L.O., Feng P. & Swaminathan B. 1997. Molecular characterization of the gene encoding H antigen in Escherichia coli and development of a PCR-restriction fragment length polymorphism test for identification of E. coli O157:H7 and O157:NM. J. Clin. Microbiol. 35:1066-1070.
- Hussein H.S. 2007. Prevalence and pathogenicity of Shiga toxin-producing Escherichia coli in beef cattle and their products. J. Anim. Sci. 85:63-72.
- Machado J., Grimont F. & Grimont P.A. 2000. Identification of Escherichia coli flagellar types by restriction of the amplified fliC gene. Res. Microbiol. 151:535-546.
- MacNab R.M. 1992. Genetics and biosynthesis of bacterial flagella. Ann. Rev. Genet. 26:129-156.
- Mattsson S. & Wallgren P. 2008. Phenotyping of Escherichia coli serotypes associated to oedema disease. Acta Vet. Scand. 2:50-53.
- Moreno A.C.R., Guth B.E.C. & Martinez M.B. 2006. Can the fliC PCR-restriction fragment length polymorphism technique replace classic serotyping methods for characterizing the H antigen of enterotoxigenic Escherichia coli strains? J. Clin. Microbiol. 44:1453-1458.
- Prager R., Strutz U., Fruth A. & Tschäpe H. 2003. Subtyping of pathogenic Escherichia coli strains using flagellar (H)-antigens: serotyping versus fliC polymorphisms. Int. J. Med. Microbiol. 292:477-486.
- Ratiner Y.A., Sihvonen L.M., Liu Y., Wang L. & Siitonen A. 2010. Alteration of flagellar phenotype of Escherichia coli strain P12b, the standard type strain for flagellar antigen H17, possessing a new non-fliC flagellin gene flnA, and possible loss of original flagellar phenotype and genotype in the course of subculturing through semisolid media. Arch. Microbiol. 192:267-278.
- Reid S.D., Selander R.K. & Maniatis T. 1999. Sequence diversity of flagellin (fliC) alleles in pathogenic Escherichia coli. J. Bacteriol. 181:153-160.
- Tominaga A. 2004. Characterization of six flagellin genes in the H3, H53 and H54 standard strains of Escherichia coli Genes Genet. Syst. 79:1-8.
- Wang L., Rothemund D., Curd H. & Reeves P.R. 2003. Species-wide variations in the Escherichia coli flagellin (H-antigen) gene. J. Bacteriol. 185:2936-2943.
Publication Dates
-
Publication in this collection
22 May 2013 -
Date of issue
Apr 2013
History
-
Received
15 Jan 2013 -
Accepted
14 Feb 2013