Caracterização molecular de parvovírus de ganso em gansos da Turquia

O parvovírus do ganso (GPV), também chamado de doença de Derzsy, é um patógeno viral que causa alta morbidade e mortalidade em gansos e patinhos. Neste estudo, objetivou-se a determinação da caracterização molecular do GPV na Turquia, a definição da similaridade com o mundo dos isolados de GPV na Turquia e a construção de uma árvore filogenética. Para tanto, a presença de GPV no fígado, baço e tecidos do intestino de nove gansos com sintomas como disfagia, edema ocular bilateral, secreção ocular, diarreia e fadiga foram investigados pelo método de PCR em tempo real e todas as amostras foram detectadas tão positivo. À luz dos dados obtidos por caracterização molecular, a análise filogenética do GPV foi apresentada na Turquia. Como resultado deste estudo, foi determinado que os GPVs disponíveis na Turquia são cepas virulentas.

TERMOS DE INDEXAÇÃO:
Parvovírus de ganso; PCR em tempo real; análise filogenética; Turquia; gansos

Autoria

Oya Bulut

Department of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.Selçuk UniversityTurkeyKonya, TurkeyDepartment of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.

Irmak Dik

Department of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.Selçuk UniversityTurkeyKonya, TurkeyDepartment of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.

http://orcid.org/0000-0003-2516-9489

Hatice P. Aslim ^**Corresponding author: hpelinucan@gmail.com

Department of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.Selçuk UniversityTurkeyKonya, TurkeyDepartment of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.

http://orcid.org/0000-0001-9160-1255

Cagri Avci

Department of Virology, Veterinary Faculty, Cukurova University, Adana, Turkey.Cukurova UniversityTurkeyAdana, Turkey Department of Virology, Veterinary Faculty, Cukurova University, Adana, Turkey.

http://orcid.org/0000-0002-7762-2874

Hasan S. Palanci

Department of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.Selçuk UniversityTurkeyKonya, TurkeyDepartment of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.

http://orcid.org/0000-0001-5408-9176

Sezer Akbaba

Department of Virology, Veterinary Control and Research Institute, Konya, Turkey.Veterinary Control and Research InstituteTurkeyKonya, Turkey Department of Virology, Veterinary Control and Research Institute, Konya, Turkey.

http://orcid.org/0000-0001-6413-4575

Varol Çivril

Department of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.Selçuk UniversityTurkeyKonya, TurkeyDepartment of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.

http://orcid.org/0000-0003-0538-8959

Hasan H. Hadimli

Department of Microbiyology, Veterinary Faculty, Selçuk University, Konya, Turkey.Selçuk UniversityTurkeyKonya, Turkey Department of Microbiyology, Veterinary Faculty, Selçuk University, Konya, Turkey.

http://orcid.org/0000-0002-7665-687X

*Corresponding author: hpelinucan@gmail.com

Conflict of interest statement.- The authors declared that there is no conflict of interest.

SCIMAGO INSTITUTIONS RANKINGS

Department of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.Selçuk UniversityTurkeyKonya, TurkeyDepartment of Virology, Veterinary Faculty, Selçuk University, Konya, Turkey.

Department of Virology, Veterinary Faculty, Cukurova University, Adana, Turkey.Cukurova UniversityTurkeyAdana, Turkey Department of Virology, Veterinary Faculty, Cukurova University, Adana, Turkey.

Figuras | Tabelas

Figuras (3)
Tabelas (8)

Thumbnail

Fig.1.
GPV Conventional PCR results. 1kp DNA marker (M), positive samples (1-5), GPV positive control (PC), negative control (NC).’

Thumbnail

Fig.2.
Real-time PCR result. Positive control (PC), negative control (NC).

Thumbnail

Fig.3.
Phylogenetic analysis of the GPV part VP3 gene was created using the Neighbor-Joining method using the MEGA X program. The bootstrap value was chosen as 1000.

Thumbnail

Table 1.
Real-time PCR primers used in the study

Thumbnail

Table 2.
Real-time PCR protocol

Thumbnail

Table 3.
Real-time PCR stages and temperature (°C)/time values applied during these stages

Thumbnail

Table 4.
Conventional PCR Protocol

Thumbnail

Table 5.
Conventional PCR stages and temperature (°C)/time values applied during these stages

Thumbnail

Table 6.
Data on GPV isolates in GenBank and obtained from different countries

Thumbnail

Table 7.
VP3 gene amino acid sequence positions of the current isolate with the GPV reference strain

Thumbnail

Table 8.
Amino acid changes of partial VP3 gene

Fig.1. GPV Conventional PCR results. 1kp DNA marker (M), positive samples (1-5), GPV positive control (PC), negative control (NC).’

Fig.2. Real-time PCR result. Positive control (PC), negative control (NC).

Fig.3. Phylogenetic analysis of the GPV part VP3 gene was created using the Neighbor-Joining method using the MEGA X program. The bootstrap value was chosen as 1000.

Table 1. Real-time PCR primers used in the study

Name	Sequence 5’ to 3’	Position	Amplicon size (bp)
GPV-F	GTGCCGATGGAGTGGGTAAT	3084-3103	60
GPV-R	ACTGTGTTTCCCATCCATTGG	3122-3143
GPV-FP	6FAM-FTCGCAATGCCAATTTCCCGAGGP-TAMRA	3098-3120

Yang et al. (2009)Yang J.-L., Cheng A.-C., Wang M.-S., Pan K.-C., Li M., Guo Y.-F., Li C.-F., Zhu D.-K. & Chen X.-Y. 2009. Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of goose parvovirus in vivo. Virol. J. 6:142. <https://dx.doi.org/10.1186/1743-422X-6-142> <PMid:19754946>
https://doi.org/10.1186/1743-422X-6-142... .

Table 2. Real-time PCR protocol

Reagent	Volume
LightCycler 480 Probes Master 2 x Conc	10μl
Primer forward (10pmol/μl)	0.8μl
Primer reverse (10pmol/μl)	0.8μl
Probe (5pmol/μl)	0.8μl
Distilled water	2.6μl
Template DNA	5μl
Volume collected	20μl

Table 3. Real-time PCR stages and temperature (°C)/time values applied during these stages

Stage	Temperature/time	Cycle
PCR baseline activation	95°C/10 min.	1 x
Denaturation	95°C/10 sec.	40x
Bonding/extending	60°C/30 sec.

Table 4. Conventional PCR Protocol

Reagent	Volume
dNTP (10mM)	1μl
MgCL (25mM)	2.5μl
Reverse Primer	2μl
Forward Primer	2μl
Taq Polymerase	1.5μl
Distilled water	36 μl
DNA	5μl
Volume collected	50μl

Table 5. Conventional PCR stages and temperature (°C)/time values applied during these stages

Stage	Temperature/time	Cycle
PCR baseline activation	95°C/5 min.	1 x
Denaturation	94°C/1 min.	30x
Bonding	52°C/1 min.
Extending	72°C/2 min.

Table 6. Data on GPV isolates in GenBank and obtained from different countries

GenBank access number	Name of strain	Location/country	Host	Date	Source or reference
MT919292	GPV/TR42/01	Turkey	Goose	2020	This study
EU088102	DB3 strain (Comp genome)	China	Goose	2007	GenBank
U25749	Virulent B	Hungary	Anser anser	1995	GenBank
EU583389	82-0321V	Taiwan	Goose	2006	GenBank
EU583392	VG32/1	Germany	Goose	2008	GenBank
EU583391	06-0329	Taiwan	Goose	2006	GenBank
KM272560	LH	China	Goose	2012	GenBank
KC996730	YZ99-6	Jiangsu/China	Goose	1999	GenBank
KC178571	Y	Anhui/China	Muscovy duck	2011	GenBank
KC184133	E	China	Goose	2012	GenBank
EU583390	82-0321	China	Goose	1982	GenBank
JF333590	SH	Shanghai/China	Anser anser	2009	GenBank
KC478066	SHFX1201	China	Swan	2013	GenBank
KC996729	SYG61v	China	Goose	2015	GenBank
MF438102	MDE	China	Muscovy duck	2018	GenBank
U34761	SHM 319	USA	Anser anser	1995	GenBank
U22967 (NC_006147)	FM (MDPV)	Hungary	Muscovy duck	1993	GenBank

Table 7. VP3 gene amino acid sequence positions of the current isolate with the GPV reference strain

	Amino acid positions of the VP3 gene
	266	287	381	382	390	395
EU088102 attenuated strain (GPV-DB3)	Ser-S	Ala-A	Asp-D	Lys-	Lys-	Glu-
GPV/TR42/01	Gly-G	Thr-T	Asn-N	Glu-E	Thr-T	Asp-D
GPV-ZL	Ser-S	Ala-A	Asp-D	Lys-	Lys-	Glu-
GPV-CH	Ser-S	Ala-A	Asp-D	Lys-	Lys-	Glu-
GPV-PSH	Gly	Thr	Asn	Glu	Thr	Asp
GPV-BCH	Gly	Thr	Asn	Glu	Thr	Asp
GPV-LY	Gly	Thr	Asn	Glu	Thr	Asp
GPV-JLJT	Gly	Thr	Asn	Glu	Thr	Asp
GPV-DH	Gly	Thr	Asn	Glu	Thr	Asp
GPV-B	Gly	Thr	Asn	Glu	Thr	Asp

Table 8. Amino acid changes of partial VP3 gene

	Position
	301	326	339	377	505
GPV/TR42/01	S	G	I	R	N
Genbank data conserved amino acid	N	A	L	K	D

Como citar

copiar

Colégio Brasileiro de Patologia Animal - CBPA Pesquisa Veterinária Brasileira, Caixa Postal 74.591, 23890-000 Rio de Janeiro, RJ, Brasil, Tel./Fax: (55 21) 2682-1081 - Rio de Janeiro - RJ - Brazil
E-mail: pvb@pvb.com.br

Acompanhe os números deste periódico no seu leitor de RSS

Versão para download de PDF

PDF

Inglês

Versões e tradução automática

Versão original do texto

English

Tradução automática

Google Translator
Microsoft Translator

Como citar

RIS

BIBTEX

Outros formatos de citação e exportação:

SciELO - Scientific Electronic Library Online
Rua Dr. Diogo de Faria, 1087 – 9º andar – Vila Clementino 04037-003 São Paulo/SP - Brasil
E-mail: scielo@scielo.org

Leia a Declaração de Acesso Aberto

Métricas

Caracterização molecular de parvovírus de ganso em gansos da Turquia

PlumX

Mensagem

[1] *Corresponding author: hpelinucan@gmail.com