Effects of Chronic and Acute Heat Stress on the Cardiac Expression of Antioxidative and Anti-Inflammatory Genes in Chicks

ABSTRACT

Heat stress can affect several biological pathways. This study aimed to compare the effects of chronic and acute heat stress on the oxidative status and inflammatory responses of chick’s hearts. Chronic and acute heat stress were induced in chicks, heart tissues were examined for morphological changes, and gene expression was analyzed in heart samples. Our results showed that prolonged heat exposure caused a dramatic reduction in chicks body weight, increased lesions, and ruptured cardiac muscle fibers in the hearts, confirming that chronic heat stress damages heart tissues and causes inflammation. Our gene expression results confirmed that heat stress induces oxidative stress and inflammation in the hearts of chicks, and this is evidenced by changes in the expression of NRF2 and CAT as antioxidant factors, NFκB and LITAF as anti-inflammatory factors, and changes in the expression of Leptin as an activator of Reactive Oxygen Species production and induction of proinflammatory factors. Our study also showed that the induction of anti-inflammatory and antioxidant genes was greater upon exposure to chronic heat stress than acute heat stress. These findings confirm that chickens generally tolerate chronic heat stress better than acute heat stress.

Keywords:
Heat stress; Oxidative stress; Inflammation; Chicks; Hearts; Gene-expression

INTRODUCTION

Chickens are more sensitive to heat stress than mammals because of their feathers and the lack of sweat glands, making the negative impact of heat stress a significant concern for poultry production ( Lara & Rostagno, 2013; Saeed et al., 2019; Cândido et al., 2020; Hirakawa et al., 2020; Nawaz et al., 2021). Heat stress affects chicken physiology, increasing heart rate, blood flow, and internal temperature, and decreasing food intake, growth rates, and egg production (Cervantes et al., 2016; Goel, 2021; Ahmad et al., 2022).

Heat stress can be categorized into two types based on the duration of exposure: acute (short-term exposure) and chronic (long-term exposure) (Ghulam Mohyuddin et al., 2022). Chronic heat stress affects animal physiology and behavior, but is generally tolerated by animals and does not lead to death ( Morera et al., 2012; Goel, 2021). Acute heat stress, however, can result in hyperthermia, significant damage to organs, and chicken death ( Lan et al., 2016; Adu-Asiamah et al., 2021).

Recent studies have demonstrated that heat stress induces oxidative stress through the overproduction of Reactive Oxygen Species (ROS). Overproduction of ROS causes damage to cells and organs by modifying cellular proteins and lipids, and damaging nucleic acids ( Sies et al., 2017; Emami et al., 2020; Qixiang Miao et al., 2020; Liu et al., 2021; Alva et al., 2023). One of the first defense mechanisms against oxidative stress is the expression of detoxifying enzymes such as superoxide dismutase (SOD), catalase (CAT), and guaiacol peroxidase (POD). These enzymes scavenge excess ROS inside the cells (Sies et al., 2017; Liu et al., 2021). One of the crucial regulators of the redox homeostasis under oxidative stress is the activity of the Nuclear factor erythroid 2-related factor 2 (NRF2). NRF2 is a transcription factor that is a master regulator of antioxidant defense mechanisms under oxidative stress. It binds to a conserved antioxidant response element of target genes and promotes the activity of antioxidant enzymes, such as SOD and CAT ( J. F. Zhang et al., 2018; Surai et al., 2021; Tang et al., 2021; Tang et al., 2022).

In addition to oxidative stress, heat stress causes an imbalance in the immune system that triggers inflammation (Abdelnour et al., 2019; Most & Yates, 2021; E. Liu et al., 2022). Several studies have demonstrated that heat stress increases the inflammatory components of the immune system. For example, rats exposed to a few weeks of heat stress showed more leukocytes in the spleen than control rats (Song et al., 2019). Broiler chickens exposed to heat stress for 14 days showed severe damage to the proliferation and differentiation of the immune system in lymphoid tissues (Hirakawa et al., 2020). Upon exposure to heat stress, immune homeostasis must be maintained in order to avoid extreme inflammation and autoimmune diseases (Horwitz et al., 2019; Song et al., 2019). One mechanism by which cells adapt to overcome inflammation is the activation of the Nuclear Factor Kappa B (NF-κB) and Tumor Necrosis Factor Alpha (TNF- α) pathways (Abdelnour et al., 2019; Daghero et al., 2022; Gao et al., 2022). NF-κB is a transcription factor closely related to NRF2 and a master regulator of inflammation and immune homeostasis (Mitchell & Carmody, 2018). NF-κB controls inflammation by activating proinflammatory cytokines such as tumor necrosis factor-α (TNF-α)/lipopolysaccharide-induced tumor necrosis factor (TNF)-alpha factor (LITAF), which consequently activates innate and adaptive immune responses (Mitchell & Carmody, 2018; Del Vesco et al., 2020; Surai et al., 2021).

Leptin is a hormone derived from adipose tissue that plays a major role in energy homeostasis and appetite regulation (Dridi et al., 2008; Laursen et al., 2017; Caruso et al., 2023). Some studies have shown that heat stress increases Leptin production. For example, one study showed that chronic heat stress improves Leptin signaling in adipose, muscle, and liver tissues in mice (Morera et al., 2012). Acute heat stress has been shown to upregulate hepatic leptin in broiler chickens (Dridi et al., 2008). Another study showed that the expression of Leptin was not affected by exposure to chronic heat stress in the adipose tissues of pigs (Cervantes et al., 2016).

In the immune system, Leptin stimulates the production of proinflammatory cytokines, and Leptin production increases during acute infection and inflammation (Bruun et al., 2002; Sánchez-Margalet et al., 2003; La Cava & Matarese, 2004; Abella et al., 2017). Moreover, Leptin is potentially an activator of ROS production, as it increases the generation and accumulation of ROS in cells (Yamagishi et al., 2001; Koh et al., 2008; Mahbouli et al., 2017; Mourmoura et al., 2022). The role of Leptin in the cardiovascular system remains uncertain; however, various studies suggest that Leptin may be needed for the pathogenesis of chronic inflammation in the heart, as it affects the production of proinflammatory cytokines and oxidative stress, Thus, Leptin can be used as a biomarker for heart failure (Schulze & Kratzsch, 2005; Poetsch et al., 2020; Vasamsetti et al., 2023).

In the present study, chronic and acute heat stress were induced in chicks, and gene expression was used to monitor the effect of heat on the progression of oxidation and inflammation in the heart. Five genes were selected for this study: NRF2 and CAT as antioxidant factors, NFκB and LITAF as anti-inflammatory factors, and Leptin as an activator of ROS production and inducer of proinflammatory factors. To the best of our knowledge, this is the first study to monitor Leptin expression in chicken hearts after exposure to heat stress.

MATERIALS AND METHODS

Ethical approval

The experiment procedures of this study were approved by the Ethics Committee on Animal Use at Kuwait University and the Ethics Committee for the Use of Laboratory Animals (DBS/IRB(ECULA)20-005 (Bastaki et al., 2022 and Bastaki et al., 2023).

Animal Source for the Study

In the present study, 75 two-week-old chicks (Gallus gallus domesticus) were purchased from local farms in Kuwait. Forty chicks were exposed to chronic heat stress and thirty five were exposed to acute heat stress. Chicks in all experiments had free access to food and water.

Distribution and numbers of the chicks in this study

Chronic heat-stress experiment

Two-week-old chicks were randomly divided into eight groups with five replicates each, as follows: control group 1 (indoors for 1 week), control group 2 (indoors for 2 weeks), control group 3 (indoors for 3 weeks), control group 4 (indoors for 4 weeks), heat-stress group 1 (outdoors for 1 week), heat-stress group 2 (outdoors for 2 weeks), heat stress group 3 (outdoors for 3 weeks), and heat-stress group 4 (outdoors for 4 weeks). The control groups were kept indoors at a constant temperature of 25 °C, and the heat-treated groups were kept outdoors, where the temperature fluctuated according to the outside temperature during the summer season in Kuwait (35-50 °C) (Figure 1). Temperatures were recorded three times per day (morning, afternoon, and evening) (Figure 1). The control groups were euthanized indoors, while the heat-treated groups were euthanized outside at noon with direct sun exposure. Immediately after death, heart samples were collected and processed for RNA extraction and histological staining.

Figure 1
Temperature record for the induction of chronic heat stress.

Acute heat-stress experiment

Two-week-old chicks were randomly divided into seven groups with five replicates each, as follows: control group (no heat treatment), group 1 (45 min of heat treatment), group 2 (1 h and 30 min of heat treatment), group 3 (2 h and 15 min of heat treatment), group 4 (3 h of heat treatment), group 5 (3 h and 45 min of heat treatment), and group 6 (4 h and 30 min of heat treatment). Chicks in the heat-treated groups were placed in a temperature-controlled growth chamber at a constant temperature of 45 °C. The control group was euthanized indoors at 25 °C. Immediately after death, heart samples were collected and processed for RNA extraction and histological staining.

Histological staining of the heart

Heart samples for the control and heat-treated chicks were processed for histological staining with Meyer’s hematoxylin (MHS16, Sigma -Aldrich) and eosin (102439, Sigma-Aldrich) as recently reported in the literature (Bastaki et al., 2022).

Quantitative Real-Time PCR

RNA was extracted from the heart samples using TRIzol reagent according to the manufacturer’s protocol (15596018, Invitrogen, Waltham, MA, USA). A cDNA reverse transcription kit was used to synthesize cDNA samples according to the manufacturer’s protocol (4368814, Applied Biosystems, Waltham, MA, USA). Quantitative real-time PCR was performed using a Bio-Rad CFX96 Real-Time system (C1000 Touch Thermal Cycle, Bio-Rad, Singapore). PCR reactions were performed using PowerUp SYBR Green Master-Mix 2X (A25779, Applied Biosystems). The primers used in the qRT-PCR are listed in Table 1. Genes were amplified in duplicate, and each PCR was run at least three times. The PCR conditions were 50 °C for 2 min, then 40 cycles of 95 °C for 2 min, 95 °C for 15 s, 57 °C for 15 s, and 72 °C for 1 min. Melting analysis for primer specificity was set at 65 °C for 5 s and 95 °C for 5 s.

Table 1
Description of all primers for the genes used for RT-qPCR analysis.

Gene	Gene Full Name	Primer Sequence (5’-3’)	Accession Number
CAT	Catalase	F: ACACAGCATTGCCCTCGATT R:AGGTCCTCAAATGCACCAC	NM_001031215.2
LITAF	lipopolysaccharide induced TNF factor	F:TTGGCCCCCAGTGTTATCAG R:CCGGTGATGCACAGTAACCT	XM_040647309.1
NF-kB	nuclear factor kappa B subunit 1	F:TCAACGCAGGACCTAAAGCAT R:GCAGATAGCCAAGTTCAGGATG	NM_205134.1
LEP	Leptin	F:GCTGCCTTTGTGCTCTGCTAT R: TGAGGGTTCGGCTCAGAC	KT_970642.1
GAPDH	glyceraldehyde-3-phosphate dehydrogenase	F: CACACAGAAGACGGTGGATG R: CAGCTCAGGGATGACTTTCC	NM_204305.2
B-Actin	Beta-Actin	F: ACCCCAAAGCCAACAGA R: CCAGAGTCCATCACAATACC	NM_205518.2
RPL5	Ribosomal Protein L5	F:AATATAACGCCTGATGGGATGG R:CTTGACTTCTCTCTTGGGTTTCT	NM_204581.5

Statistical analysis of target genes

Statistical analysis was performed as described by Bastaki et al. (2023). In summary, the Ct value was computed using Bio-Rad CFX96 software to quantify the mRNA for each gene, and the average Ct values were calculated for each sample group. Values were normalized using GAPDH as an endogenous control. The mRNA quantity was calculated as the ΔCt value (Ct target gene−Ct reference gene GAPDH) for each gene. The normalized relative expression ∆∆Ct (∆Ct heat-treated sample − ∆Ct control sample) was calculated for each gene. The fold-change 2^−ΔΔCt was obtained for each gene. Finally, statistical analysis was conducted using one-way ANOVA and two-way ANOVA for acute and chronic heat stress, respectively. GraphPad Prism version 9 (GraphPad Software Inc., San Diego, CA, USA) was used to obtain the p value and standard deviation for the expression of each gene. Statistical significance was set at * p≤0.05, ** p≤0.01, *** p≤0.001, **** p≤0.0001. Data are presented as means ± standard deviation (SD).

RESULTS

Effects of heat stress on growth performance of chicks

The chicks were weighted prior to euthanasia. Weights varied among the chicks exposed to chronic heat stress (Figure 2). The average weights were 27.8 g, 46.6 g, 50.4 g, and 105.6 g in the control 1 (14 days old), control 2 (21 days old), control 3 (28-days-old), and control 4 (35 days old) groups, respectively. The weight increase in the control groups was expected, as the chicks grew weekly. However, the weights of chicks placed outdoors and exposed to chronic heat stress did not increase normally; the average weights were 25.5 g, 33.5 g, 41.5 g, and 42.2 g after one week (14 days old), two weeks (21 days old), three weeks (28 days old), and four weeks (35 days old) of heat stress, respectively. The acute heat stress experiment was conducted in one day on 14-day-old chicks, and the average weights were similar among groups, ranging between 27.8 g and 32.0 g. These results indicate that chronic heat stress affected the feed intake of chicks, resulting in reduced weight gain and growth performance.

Figure 2
Average weights of chicks prior to euthanasia in the chronic heat stress groups.

Histological staining of chicken hearts after exposure to chronic heat stress

Histological staining of heart tissue was compared between control chicks and chicks exposed to chronic heat for three and four weeks (Figure 3). Control group 3 (28 days old) and control group 4 (35 days old) had clear and regular cardiac muscle fibers (Figure 3a and 3c). In comparison, heart samples from chicks exposed to chronic heat stress for three (28 days old; Figure 3b) and for four weeks (35-days-old; Figure 3d) showed clear lesions and spaces with fragmented and ruptured cardiac muscle fibers, suggesting inflammation of heart cells and tissue. The results clearly demonstrate that exposure to heat stress for a prolonged period induces heart damage.

Figure 3
H&E stained heart tissue sections (x 200) of control (a, c) and heat-stressed hearts (b,d). Arrows indicate lesions and spaces with fragmented and ruptured cardiac muscle fibers.

Effects of chronic and acute heat stress on antioxidative gene expression

To monitor the effect of heat stress on the oxidative status of the heart, two antioxidative factors were selected for gene expression analysis: NRF2 as a transcription factor of the antioxidant defense mechanism, and CAT as an antioxidant enzyme promoted by NRF2.

Upon exposure to chronic heat stress for one to four weeks, both genes showed similar expression patterns. After the first week of heat exposure, expression was downregulated in the heat-stressed hearts compared to the control hearts; however, expression of both genes was upregulated after the second week of heat exposure compared with the control chicks (Figure 4a and b), with a significant value (p≤0.05) detected only for CAT and not for NRF2. Both genes were slightly downregulated in the third and fourth weeks of chronic heat treatment.

Upon exposure to acute heat stress, there were fluctuations in the expression of NRF2 and CAT, but both showed a similar gene expression pattern. Expression was downregulated after the first period of heat exposure, and then started to increase gradually until it peaked after two hours of exposure. After the two hours, expression fluctuated again, reducing and then increasing (Figures 4c and d).

Our results demonstrated similar gene expression patterns for NRF2 and CAT under chronic and acute heat stress.

Figure 4
The fold change differences (2^ΔΔCt) of the relative normalized expression for CAT (a and c) and NRF2 (b and d) in the control and heat-treated chicks after exposure to chronic heat stress for one to four weeks, or acute heat stress for 45 min to 4 hr and 30 min (n = 3 in each group, * p≤0.05). Data are presented as means ± SD.

Effects of chronic and acute heat stress on anti-inflammatory gene expression

To monitor the effect of heat stress on the inflammation status of the heart, two anti-inflammatory factors were selected for gene expression analysis: NF-kB as a transcription factor of inflammation and immune homeostasis, and LITAF as proinflammatory cytokine controlled by NF-kB.

NF-kB expression was significantly upregulated (p≤0.0001) after the first week of chronic heat exposure in the hearts of heat-stressed chicks compared with that of control hearts. Expression was dramatically reduced after the second week of heat exposure (p≤0.001), but it was still slightly higher than in the controls. After the 3^rd and 4^th week of heat exposure, NF-kB expression was downregulated in the hearts of heat-stressed chicks compared control hearts (Figure 5a), and significantly lower than that of the first week’s heat exposure (p≤0.0001). As for LITAF, its expression was upregulated in the hearts of heat-stressed chicks after the 2^nd and 3^rd weeks of heat stress; however, after the 1^st and 4^th weeks, it was downregulated (Figure 5b). No significant values were detected for LITAF in the chronic heat stress groups.

Upon exposure to acute heat stress, expression of NF-kB and LITAF was downregulated at different time points from the beginning to the endpoint of heat exposure (Figure 5 c and d). A significant decrease (p≤0.05) was detected for LITAF in all acute heat treatments, but only at 3 and 4.5 hours for NF-kB.

Figure 5
The fold change differences (2^ΔΔCt) of the relative normalized expression for NFKB (a and c) and LITAF (b and d) in the control and heat-treated chicks after exposure to chronic heat stress for one to four weeks or acute heat stress for 45 min to 4 hr and 30 min (n = 3 in each group, * p≤0.05, ** p≤0.01, *** p≤0.001, **** p≤0.0001). Data are presented as means ± SD.

Effects of chronic and acute heat stress on Leptin gene expression

Leptin expression was significantly upregulated (p≤0.05) upon the first week of heat exposure in the chronically heat-stressed hearts compared with that in the control hearts . In the heat-stressed hearts, Leptin expression was significantly diminished (p≤0.01) after the 2^nd and 3^rd weeks of heat exposure, and after the 4^th week, but the expression was slightly higher than in the control hearts (Figure 6a).

Leptin expression was lower in the hearts of chicks exposed to acute heat stress than in the control hearts throughout the examined time, with slight variation in expression. Expression was highest after 45 min of heat exposure than in the rest of the examined time periods (Figure 6b), but significant decreases (p≤0.05) were observed only at 1.5 and 4.5 hours.

Figure 6
The fold change differences (2^ΔΔCt) of the relative normalized expression for Leptin in the control and heat-treated chicks after exposure to chronic heat stress for one to four weeks (a) or acute heat-stress for 45 min to 4 hr and 30 min (b) (n = 3 in each group, * p≤0.05, ** p≤0.01). Data are presented as means ± SD.

DISCUSSION

Chickens are homoeothermic and lack sweat glands; therefore, they are more susceptible to heat stress than other animals (Murugesan et al., 2017; Cândido et al., 2020). The body temperature of a newly hatched chick is approximately 39.7 °C, and this temperature increases every day until it becomes stable at three weeks post-hatch. The body temperature of an adult chicken is approximately maintained between 40.0 and 40.5 °C (Donald & William, 2002; Saeed et al., 2019). In practice, the best environmental temperature for chicks to maintain optimal body temperature is between 24 and 26°C. Above this ideal range, the air temperature may induce a state of heat stress known as hyperthermia, which compromises normal functions of many organs and leads to high mortality rates (Hamissou Maman et al., 2019; Brugaletta et al., 2022; Burhans et al., 2022).

Oxidative stress and inflammatory responses are two major causes of heat stress. Under normal conditions, all aerobic organisms maintain a redox balance between the production of ROS through metabolism and the reduction of ROS through antioxidants. Heat stress interrupts this balance by increasing the production of ROS and decreasing antioxidant activity, causing oxidative stress (Birben et al., 2012; Akbarian et al., 2016; Jacobs et al., 2020). Heat stress also increases the inflammatory components of the immune system and causes overproduction of inflammatory cytokines (Min et al., 2016; Barnes et al., 2021; Most & Yates, 2021; Park et al., 2021).

The objective of the present study was to examine oxidative and inflammatory responses in heart samples of chicks exposed to chronic and acute heat stress. Chicks in each group in the chronic and acute experiments were examined for behavioral changes, including respiratory rate, heart rate, and feeding intake. The weights of the chicks in the acute heat experiment were similar between the control and heat-treated groups; however, the weights were different between the control and heat-treated chicks in the chronic heat experiment. After the 1^st week of heat treatment, the difference in averages between the control and treated groups was 2.3 g (Figure 2). The difference became more noticeable in the subsequent weeks, rising to 13 g after the 2nd week, 8.9 g after the 3rd week, and 63.4 after the 4th week of heat treatment. The results demonstrated that prolonged heat exposure decreases feed intake, causing a dramatic reduction in chick weight. Our results matched those of other studies that reported heat stress inhibiting the growth performance of broilers, and prolonged exposure to chronic heat not resulting in a higher mortality compared with acute heat (Quinteiro-Filho et al., 2010; Y.-L. Liu et al., 2022). In both experiments, one to two deaths occurred in each group for the control and heat-treated groups.

Histological staining was used to examine the effect of chronic heat exposure on heart tissue. Our results on the histopathological changes in heart samples exposed to chronic heat stress agreed with those from previous studies (Tang et al., 2014; Nasrolahi et al., 2020). The lesions and ruptured cardiac muscle fibers observed in our study also matched previously published results on chicken hearts exposed to cold stress (Zhao et al., 2013; Wei et al., 2018). Histopathological changes due to chronic heat have also been reported in tissues such as intestines (Yu et al., 2010; Abdel-Rahman et al., 2022; W.-C. Liu et al., 2022), muscles (Ohira et al., 2017), liver (Ma et al., 2022; Tang et al., 2022), lungs (Lin et al., 2019; Wu et al., 2023) and kidneys (Aengwanich & Simaraks, 2004; Goto et al., 2022). These studies and ours clearly demonstrate that heat stress has a dramatic effect on tissue and organ stability and functions, and can lead to organ failure.

Before the quantitative RT-PCR analysis of the antioxidative and anti-inflammatory genes in the hearts, the best reference gene as a normalizer for the experiment was tested and selected accordingly. Three endogenous reference genes were tested in this study: GAPDH (glyceraldehyde 3-phosphate dehydrogenase), B-actin (beta-actin), and RPL5 (ribosomal protein L5) (Table 1). Our results showed that GAPDH was the best gene normalizer for heart samples, as it had the lowest and most consistent Ct values in both control and heat-treated chicks (data not shown). Therefore, GAPDH was chosen as the gene normalizer for the quantitative RT-PCR in this study, which was consistent with our recently reported study using retinal samples (Bastaki et al., 2023).

Our results showed that the antioxidant factors NRF2 and CAT had similar patterns of expression under chronic and acute heat stress. Under chronic stress, expression was upregulated only after the 2^nd week of heat treatment (Figure 4a and b). The temperature recorded in the afternoon was 46 °C after the 1^st week of heat treatment and 52°C after the 2^nd week of heat treatment. Therefore, it is possible that the rise in temperature in the 2^nd week caused an increase in oxidative stress, which led to increased expression of the antioxidative factors NRF2 and CAT in the hearts of heat-stressed chicks. However, after the 3^rd and 4^th week of heat treatment, the outdoor temperature was similar to that of the 2^nd week, but the expressions of NRF2 and CAT were slightly reduced. The expression of NRF2 and CAT under acute heat stress was similar and fluctuated across the different treatment groups. The highest expression of NRF2 and CAT was observed in the 3^rd week treatment group (2 h 15 min of heat exposure).

Our results confirmed that exposure to acute and chronic heat stress induces oxidative stress in the hearts of chicks. Heat-stress-induced oxidative stress in the heart shows that the transcription factor NRF2 promotes the activity of the antioxidant enzyme CAT, which is evidenced by the same pattern of gene expression under chronic and acute heat stress. The upregulation of NRF2 and CAT expression indicates that these genes are required to detoxify ROS in the heart, thus helping to maintain redox homeostasis and reduce oxidative stress under heat stress.

The findings of this study are in agreement with those of previous studies that examined the effect of chronic and acute heat stress on the oxidation status of different tissues. In one study, the expression of NRF2 and CAT was elevated in mouse testes after exposure to elevated ambient temperatures (42°C) for 2 hours for twelve days. They found that the expression of NRF2 and CAT varied, with the highest expression seen after the first day of heat treatment; and that NRF2 protected against heat-induced oxidative stress in mouse testes (Li et al., 2013). It has been shown that NRF2 and CAT were upregulated in the liver of broilers at different acute high ambient temperatures; thereby, broilers have certain tolerance to oxidative stress induced by high ambient temperatures (Q. Miao et al., 2020). In addition, high ambient temperatures induce spleen dysplasia in broilers through the activation of the NRF2 pathway (C. Zhang et al., 2018). Based on the literature, the effects of chronic and acute heat stress-induced oxidative stress in the heart are limited, and our study showed patterns seen in different tissues in the heart.

Our results showed that under chronic heat stress, the transcription factors of inflammation, NF-kB, and its proinflammatory cytokine, LITAF, are sequentially upregulated. After the 1^st week of heat treatment, NF-kB was significantly upregualted (p ≤ 0.0001) in the heat-stressed hearts, but its expression was reduced in the 2^nd week, and after the 3^rd and 4^th weeks, the expression was significantly downregulated ( p ≤ 0.001 and p ≤ 0.0001, respectively) compared with the first week of heat treatment and the control (Figure 5a). In contrast, the expression of LITAF was upregulated during the 2^nd and 3^rd weeks of heat treatment, compared to the control (Figure 5b). Under acute heat stress, the expression of NF-kB was generally higher than that of LITAF across the different treatment groups; however, both were downregulated in comparison to the control (Figures 5c and d).

Previous studies have shown that acute and chronic heat stress induce intestinal inflammation in broiler chickens by stimulating the mRNA expression of proinflammatory cytokines (Varasteh et al., 2015). For example, a recent study showed that heat stress increased intestinal inflammatory injury in chickens by increasing the expression of NF-kB and TNF-α (Tang et al., 2021). Another recent study on the effects of chronic heat stress on liver inflammatory injury showed that NF-kB and TNF-α were upregulated in the livers of heat-stressed broilers, compared with the controls (Y.-L. Liu et al., 2022). In our study, we used LITAF as a regulator of TNF-α gene expression because only few studies have been conducted on the effect of heat stress on LITAF. One study showed that broilers exposed to heat stress had higher expression of LITAF in the jejunum and ileum than broilers kept in a comfortable environment (Del Vesco et al., 2020).

The expression of Leptin during chronic heat stress was very similar to that of NF-kB, as it was also significantly upregulated (p≤0.05) during the 1^st week of chronic heat stress (Figure 5a and 6a). Over the following weeks, the expression of both genes declined. Many studies have reviewed the role of Leptin as an inflammatory mediator in chronic inflammation and immunity. Leptin induces the secretion of proinflammatory and anti-inflammatory cytokines via activation of the NF-kB signaling pathway (Procaccini et al., 2009; Pérez-Pérez et al., 2020). Thus, the significant high expression of Leptin and NF-kB during the 1^st week of chronic heat stress might indicate a possible role of Leptin in inducing the NF-kB inflammatory pathway in hearts with heat stress-induced oxidation. The association between Leptin and NF-kB has also been proven in other studies; for example, Leptin showed anti-apoptotic properties on neutrophils through nuclear NF-kB pathway (Sun et al., 2013). A menstrual cycle model study showed an inverse regression of NF-κB p65 activation on Leptin concentrations in the initial follicular phase, as well as in the mid-luteal phase (Faustmann et al., 2016). In our study, Leptin was mostly expressed in treatment group 1 (45 min) among the acute heat stress groups, but it was still downregulated compared with the control group.

Previous studies have shown that Leptin induces oxidative stress by overproducing ROS (Palomba et al., 2015; Schroyen et al., 2012; Blanca et al., 2016; Mahbouli et al., 2017; Shetty et al., 2022). It is possible that the high expression of Leptin observed in our study during the 1^st week of chronic heat stress led to increased ROS production in the following weeks, corresponding to the peak in the expression levels of NRF2 and CAT during the 2^nd week of heat treatment (Figure 4a and b). Therefore, we believe that during chronic heat stress, Leptin may play an important regulatory role in inducing oxidative stress, and this induction might be the reason for the upregulation of the expression of antioxidative genes to detoxify ROS in the heart.

CONCLUSIONS

In summary, our study showed that heat stress induces oxidation and inflammation in the hearts of chicks. The induction of inflammatory and anti-oxidation genes was observed more upon exposure to chronic heat stress than upon acute heat stress, which may confirm previous studies that show chronic heat stress being generally more tolerated by animals than acute heat stress. As far as we know, this is the first study to report the expression of Leptin in the heart upon exposure to heat stress.

The practical application of this study’s findings is significant for understanding the impact of chronic and acute heat stress on the hearts of chickens. By identifying the specific oxidative and inflammatory responses in chick hearts under different heat stress conditions, this research can inform poultry farmers and veterinarians on the risks associated with heat stress and strategies to mitigate them. For example, implementing measures to reduce exposure to prolonged heat stress in poultry farming practices could help prevent cardiac tissue damage and inflammation in chickens. Additionally, the differential gene expression patterns observed in response to chronic and acute heat stress could guide the development of targeted interventions to enhance antioxidant defenses and modulate inflammatory responses in poultry under varying heat stress conditions. Overall, this study contributes to advancing the welfare and health management of chickens in the context of heat stress, highlighting the importance of proactive measures to protect against heat-induced cardiac complications in poultry farming.

ACKNOWLEDGMENTS

The authors would also like to thank Fatma Almousa for participating in sample collection and RNA extraction, and Thecla Gomes for histological staining of the heart samples. The authors would like to acknowledge the assistance of Ms. Sahar Barhoush for the statistical analysis and validation. The authors acknowledge the Animal Care and Breeding Unit and the Micro-technique Unit at the Department of Biological Sciences, The Biotechnology Center (BTC)- Faculty of Science for the use of their facilities, and the general facility project GS 03-01 belonging to the Research Sector Project Unit (RSPU) for the use of liquid nitrogen generator.

REFERENCES

• Abdel-Rahman HG, Alian HA, Mahmoud, MM. Impacts of dietary supplementation with nano-iron and methionine on growth, blood chemistry, liver biomarkers, and tissue histology of heat-stressed broiler chickens. Tropical Animal Health and Production 2022;54(2):126. https://doi.org/10.1007%2Fs11250-022-03130-w
  » https://doi.org/10.1007%2Fs11250-022-03130-w
• Abdelnour SA, Abd El-Hack ME, Khafaga AF, et al. Stress biomarkers and proteomics alteration to thermal stress in ruminants: A review. Journal of thermal Bioloy 2019;79:120-34. https://doi.org/10.1016/j.jtherbio.2018.12.013
  » https://doi.org/10.1016/j.jtherbio.2018.12.013
• Adu-Asiamah P, Zhang Y, Amoah K, et al. Evaluation of physiological and molecular responses to acute heat stress in two chicken breeds. Animal 2021;15(2):100106. https://doi.org/https://doi.org/10.1016/j.animal.2020.100106
  » https://doi.org/https://doi.org/10.1016/j.animal.2020.100106
• Aengwanich W, Simaraks S. Pathology of heart, lung, liver and kidney in broilers under chronic heat stress. Pathology 2004;26(3):18. https://www.thaiscience.info/journals/Article/SONG/10462441.pdf
  » https://www.thaiscience.info/journals/Article/SONG/10462441.pdf
• Ahmad R, Yu YH, Hsiao FS, et al. Influence of heat stress on poultry growth performance, intestinal inflammation, and immune function and potential mitigation by probiotics. Animals (Basel) 2022;12(17). https://doi.org/10.3390/ani12172297
  » https://doi.org/10.3390/ani12172297
• Akbarian A, Michiels J, Degroote J, et al. Association between heat stress and oxidative stress in poultry; mitochondrial dysfunction and dietary interventions with phytochemicals. Journal of animal science and biotechnology 2016;7(1):1-14. https://jasbsci.biomedcentral.com/articles/10.1186/s40104-016-0097-5
  » https://jasbsci.biomedcentral.com/articles/10.1186/s40104-016-0097-5
• Alva R, Mirza M, Baiton A, et al. Oxygen toxicity: Cellular mechanisms in normobaric hyperoxia. Cell Biology and Toxicology 2023;39(1):111-43. https://doi.org/10.1007/s10565-022-09773-7
  » https://doi.org/10.1007/s10565-022-09773-7
• Barnes TL, Burrack RM, Schmidt TB, et al. Sustained heat stress elevated corneal and body surface temperatures and altered circulating leukocytes and metabolic indicators in wether lambs supplemented with ractopamine or zilpaterol. Journal of Animal Science 2021;99(9). https://doi.org/10.1093/jas/skab236
  » https://doi.org/10.1093/jas/skab236
• Bastaki NK, Albarjas TA, Almoosa FA, et al. Chronic heat stress induces the expression of HSP genes in the retina of chickens (Gallus gallus). Fronteirs in Genetics 2023;14: 1085590. https://doi.org/10.3389/fgene.2023.1085590
  » https://doi.org/10.3389/fgene.2023.1085590
• Bastaki NK, Lobo VR, Gomes T, et al. Retinal gene expression of selective genes and histological stages of embryonic and post-hatch chickens (Gallus gallus). Genes 2022;13(11):2048. https://doi.org/10.3390/genes13112048
  » https://doi.org/10.3390/genes13112048
• Birben E, Sahiner UM, Sackesen C, et al. Oxidative stress and antioxidant defense. World Allergy Organization Journal 2012;5(1):9-19. https://doi.org/10.1097/wox.0b013e3182439613
  » https://doi.org/10.1097/wox.0b013e3182439613
• Blanca A J, Ruiz-Armenta MV, Zambrano S, et al. Leptin induces oxidative stress through activation of nadph oxidase in renal tubular cells: antioxidant effect of L-Carnitine. Journal of Cellular Biochemistry 2016;117(10):2281-8. https://doi.org/10.1002/jcb.25526
  » https://doi.org/10.1002/jcb.25526
• Brugaletta G, Teyssier JR, Rochell SJ, et al. A review of heat stress in chickens. Part I: Insights into physiology and gut health. Frontiers in Physiology 2022;13:934381. https://doi.org/10.3389%2Ffphys.2022.934381
  » https://doi.org/10.3389%2Ffphys.2022.934381
• Bruun JM, Pedersen SB, Kristensen K, et al. Effects of pro-inflammatory cytokines and chemokines on leptin production in human adipose tissue in vitro . Molecular and Cellular Endocrinology 2002;190(1-2):91-9. https://doi.org/10.1016/s0303-7207(02)00007-2
  » https://doi.org/10.1016/s0303-7207(02)00007-2
• Burhans W, Burhans CR, Baumgard L. Invited review: lethal heat stress: the putative pathophysiology of a deadly disorder in dairy cattle . Journal of Dairy Science 2022;105(5):3716-35. https://doi.org/10.3168/jds.2021-21080
  » https://doi.org/10.3168/jds.2021-21080
• Cândido MGL, Tinôco IFF, Albino LFT, et al. Effects of heat stress on pullet cloacal and body temperature. Poultry Science 2020;99(5):2469-77. https://doi.org/10.1016/j.psj.2019.11.062
  » https://doi.org/10.1016/j.psj.2019.11.062
• Caruso A, Gelsomino L, Panza S, et al. Leptin: a heavyweight player in obesity-related cancers. Biomolecules 2023;13(7):1084. https://doi.org/10.3390/biom13071084
  » https://doi.org/10.3390/biom13071084
• Cervantes M, Cota M, Arce N, et al. Effect of heat stress on performance and expression of selected amino acid and glucose transporters, HSP90, leptin and ghrelin in growing pigs. Journal of Thermal Biology 2016;59:69-76. https://doi.org/https://doi.org/10.1016/j.jtherbio.2016.04.014
  » https://doi.org/https://doi.org/10.1016/j.jtherbio.2016.04.014
• Daghero H, Doffe F, Varela B, et al. Jejunum-derived NF-?B reporter organoids as 3D models for the study of TNF-alpha-induced inflammation. Scientific Reports 2022;12(1):14425. https://doi.org/10.1038/s41598-022-18556-3
  » https://doi.org/10.1038/s41598-022-18556-3
• Del Vesco AP, Khatlab AdS, Santana TP, et al. Heat stress effect on the intestinal epithelial function of broilers fed methionine supplementation. Livestock Science 2020;240:104152. https://doi.org/https://doi.org/10.1016/j.livsci.2020.104152
  » https://doi.org/https://doi.org/10.1016/j.livsci.2020.104152
• Donald D, William D. Commercial chicken meat and egg production. Journal of Applied Poultry Research 2002;11(2);224-5. http://dx.doi.org/10.1093/japr/11.2.224
  » http://dx.doi.org/10.1093/japr/11.2.224
• Dridi S, Temim S, Derouet M, et al. Acute cold- and chronic heat-exposure upregulate hepatic leptin and muscle uncoupling protein (UCP) gene expression in broiler chickens. Journal of Experimental Zoology Part A: Ecological Genetics and Physiology 2008;309(7):381-8. https://doi.org/10.1002/jez.461
  » https://doi.org/10.1002/jez.461
• Emami NK, Jung U, Voy B, et al. Radical response: effects of heat stress-induced oxidative stress on lipid metabolism in the avian liver. Antioxidants (Basel) 2020;10(1). https://doi.org/10.3390/antiox10010035
  » https://doi.org/10.3390/antiox10010035
• Faustmann G, Tiran B, Maimari T, et al. Circulating leptin and NF-?B activation in peripheral blood mononuclear cells across the menstrual cycle. Biofactors 2016;42(4):376-87. https://doi.org/10.1002/biof.1281
  » https://doi.org/10.1002/biof.1281
• Gao J, Liu M, Guo H, et al. ROS induced by streptococcus agalactiae activate inflammatory responses via the TNF-?/NF-?B signaling pathway in golden pompano Trachinotus ovatus (Linnaeus,1758). Antioxidants 2022;11(9):1809. https://doi.org/10.3390%2Fantiox11091809
  » https://doi.org/10.3390%2Fantiox11091809
• Ghulam Mohyuddin S, Khan I, Zada A, et al. Influence of heat stress on intestinal epithelial barrier function, tight junction protein, and immune and reproductive physiology. BioMed Research International 2022; 8547379:1-11. https://doi.org/10.1155%2F2022%2F8547379
  » https://doi.org/10.1155%2F2022%2F8547379
• Goel A. Heat stress management in poultry. Journal of Animal Physiology and Animal Nutrition 2021;105(6):1136-45. https://doi.org/10.1111/jpn.13496
  » https://doi.org/10.1111/jpn.13496
• Goto H, Nakashima M, Nakashima H, et al. Heat acclimation ameliorated heat stress-induced acute kidney injury and prevented changes in kidney macrophages and fibrosis. American Journal of Physiology-Renal Physiology 2022;323(3):F243-F254. https://doi.org/10.1152/ajprenal.00065.2022
  » https://doi.org/10.1152/ajprenal.00065.2022
• Hamissou Maman A, Özlü S, Uçar A, et al. Effect of chick body temperature during post-hatch handling on broiler live performance1. Poultry Science 2019;98(1):244-50. https://doi.org/https://doi.org/10.3382/ps/pey395
  » https://doi.org/https://doi.org/10.3382/ps/pey395
• Hirakawa R, Nurjanah S, Furukawa K, et al. Heat stress causes immune abnormalities via massive damage to effect proliferation and differentiation of lymphocytes in broiler chickens. Frontiers in Veterinary Science 2020;7:46. https://doi.org/10.3389/fvets.2020.00046
  » https://doi.org/10.3389/fvets.2020.00046
• Horwitz DA, Fahmy TM, Piccirillo CA, et al. Rebalancing immune homeostasis to treat autoimmune diseases. Trends in Immunology 2019;40(10):888-908. https://doi.org/10.1016/j.it.2019.08.003
  » https://doi.org/10.1016/j.it.2019.08.003
• Jacobs P J, Oosthuizen M K, Mitchell C, et al. Heat and dehydration induced oxidative damage and antioxidant defenses following incubator heat stress and a simulated heat wave in wild caught four-striped field mice Rhabdomys dilectus. PLoS One 2020;15(11):e0242279. https://doi.org/10.1371/journal.pone.0242279
  » https://doi.org/10.1371/journal.pone.0242279
• Koh KK, Park SM, Quon MJ. Leptin and cardiovascular disease: response to therapeutic interventions. Circulation 2008;117(25):3238-49. https://doi.org/10.1161/circulationaha.107.741645
  » https://doi.org/10.1161/circulationaha.107.741645
• La Cava A, Matarese G. The weight of leptin in immunity. Nature Reviews Immunology 2004; 4(5):371-9. https://doi.org/10.1038/nri1350
  » https://doi.org/10.1038/nri1350
• Lan, X, Hsieh JCF, Schmidt CJ, et al. Liver transcriptome response to hyperthermic stress in three distinct chicken lines. BMC Genomics 2016;17(1):955. https://doi.org/10.1186/s12864-016-3291-0
  » https://doi.org/10.1186/s12864-016-3291-0
• Lara, LJ, Rostagno MH. Impact of heat stress on poultry production. Animals (Basel) 2013;3(2):356-69. https://doi.org/10.3390/ani3020356
  » https://doi.org/10.3390/ani3020356
• Laursen, TL, Zak RB, Shute RJ, et al. Leptin, adiponectin, and ghrelin responses to endurance exercise in different ambient conditions. Temperature 2017;4(2):166-75. https://doi.org/10.1080/23328940.2017.1294235
  » https://doi.org/10.1080/23328940.2017.1294235
• Li Y, Huang Y, Piao Y, et al. Protective effects of nuclear factor erythroid 2-related factor 2 on whole body heat stress-induced oxidative damage in the mouse testis. Reproductive Biology and Endocrinology 2013;11:23. https://doi.org/10.1186/1477-7827-11-23
  » https://doi.org/10.1186/1477-7827-11-23
• Lin CH, Tsai CC, Chen TH, et al. Oxytocin maintains lung histologicl and functional integrity to confer protection in heat stroke. Scientific Reports 2019; 9(1):18390. https://doi.org/10.1038/s41598-019-54739-1
  » https://doi.org/10.1038/s41598-019-54739-1
• Liu E, Zhao X, Li C, et al. Effects of acute heat stress on liver damage, apoptosis and inflammation of pikeperch (Sander lucioperca). Journal of Thermal Biology 2022;106:103251. https://doi.org/10.1016/j.jtherbio.2022.103251
  » https://doi.org/10.1016/j.jtherbio.2022.103251
• Liu H-L, Lee Z-X, Chuang T-W, et al. Effect of heat stress on oxidative damage and antioxidant defense system in white clover (Trifolium repens L.). Planta 2021;254(5): 103. https://doi.org/10.1007/s00425-021-03751-9
  » https://doi.org/10.1007/s00425-021-03751-9
• Liu W-C, Pan Z-Y, Zhao Y, et al. Effects of heat stress on production performance, redox status, intestinal morphology and barrier-related gene expression, cecal microbiome, and metabolome in indigenous broiler chickens. Frontiers in Physiology 2022;13:761. https://doi.org/10.3389/fphys.2022.890520
  » https://doi.org/10.3389/fphys.2022.890520
• Liu Y-L, Ding K-N, Shen X-L, et al. Chronic heat stress promotes liver inflammation in broilers via enhancing NF-?B and NLRP3 signaling pathway. BMC Veterinary Research 2022;18(1):289. https://doi.org/10.1186/s12917-022-03388-0
  » https://doi.org/10.1186/s12917-022-03388-0
• Ma B, Xing T, Li J, et al. Chronic heat stress causes liver damage via endoplasmic reticulum stress-induced apoptosis in broilers. Poultry Science 2022;101(10):102063. https://doi.org/https://doi.org/10.1016/j.psj.2022.102063
  » https://doi.org/https://doi.org/10.1016/j.psj.2022.102063
• Mahbouli S, Der Vartanian A, Ortega S, et al. Leptin induces ROS via NOX5 in healthy and neoplastic mammary epithelial cells. Oncology Reports 2017;38(5):3254-64. https://doi.org/10.3892/or.2017.6009
  » https://doi.org/10.3892/or.2017.6009
• Miao Q, Si X, Xie Y, et al. Effects of acute heat stress at different ambient temperature on hepatic redox status in broilers. Poultry Science 2020;99(9):4113-22. https://doi.org/10.1016/j.psj.2020.05.019
  » https://doi.org/10.1016/j.psj.2020.05.019
• Min L, Zheng N, Zhao S, et al. Long-term heat stress induces the inflammatory response in dairy cows revealed by plasma proteome analysis. Biochemical and Biophysical Research Communications 2016;471(2):296-302. https://doi.org/10.1016/j.bbrc.2016.01.185
  » https://doi.org/10.1016/j.bbrc.2016.01.185
• Mitchell JP, Carmody RJ. NF-?B and the transcriptional control of inflammation. International Review of Cell and Molecular Biology 2018;335:41-84. https://doi.org/10.1016/bs.ircmb.2017.07.007
  » https://doi.org/10.1016/bs.ircmb.2017.07.007
• Morera P, Basiricò L, Hosoda K, et al. Chronic heat stress up-regulates leptin and adiponectin secretion and expression and improves leptin, adiponectin and insulin sensitivity in mice. Journal of Molecular Endocrinology 2012;48(2):129. https://doi.org/10.1530/jme-11-0054
  » https://doi.org/10.1530/jme-11-0054
• Most MS, Yates DT. Inflammatory mediation of heat stress-induced growth deficits in livestock and its potential role as a target for nutritional interventions: a review. Animals 2021;11(12):3539. https://doi.org/10.3390/ani11123539
  » https://doi.org/10.3390/ani11123539
• Mourmoura E, Papathanasiou I, Trachana, VK, et al. Leptin-depended NLRP3 inflammasome activation in osteoarthritic chondrocytes is mediated by ROS. Mechanisms of Ageing and Development 2022;208:111730. https://doi.org/10.1016/j.mad.2022.111730
  » https://doi.org/10.1016/j.mad.2022.111730
• Murugesan S, Ullengala R, Amirthalingam V. Heat shock protein and thermal stress in chicken. In: Asea AAA, Kaur P, editors. Heat shock proteins in veterinary medicine and sciences. Cham: Springer; 2017. p.79-193. http://dx.doi.org/10.1007/978-3-319-73377-7_6
  » http://dx.doi.org/10.1007/978-3-319-73377-7_6
• Nasrolahi A, Hosseini L, Farokhi-Sisakht F, et al. Cardioprotective effect of Rosa canina L. methanolic extract on heat shock induced cardiomyocyte injury: An experimental study. Journal of Cardiovascular and Thoracic Research 2020;12(4):286. https://doi.org/10.34172%2Fjcvtr.2020.47
  » https://doi.org/10.34172%2Fjcvtr.2020.47
• Nawaz A H, Amoah K, Leng, QY, et al. Poultry response to heat stress: its physiological, metabolic, and genetic implications on meat production and quality including strategies to improve broiler production in a warming world. Frontiers in Veterinary Science 2021;8:699081. https://doi.org/10.3389/fvets.2021.699081
  » https://doi.org/10.3389/fvets.2021.699081
• Ohira T, Higashibata A, Seki M, et al. The effects of heat stress on morphological properties and intracellular signaling of denervated and intact soleus muscles in rats. Physiological Reports 2017;5(15). https://doi.org/10.14814/phy2.13350
  » https://doi.org/10.14814/phy2.13350
• Palomba L, Silvestri C, Imperatore R, et al. Negative regulation of leptin-induced Reactive Oxygen Species (ROS) formation by cannabinoid CB1 receptor activation in hypothalamic neurons. Journal of Biological Chemistry 2015;290(22):13669-77. https://doi.org/https://doi.org/10.1074/jbc.M115.646885
  » https://doi.org/https://doi.org/10.1074/jbc.M115.646885
• Park DS, Gu B-H, Park YJ, et al. Dynamic changes in blood immune cell composition and function in Holstein and Jersey steers in response to heat stress. Cell Stress and Chaperones 2021;26(4):705-20. https://doi.org/10.1007/s12192-021-01216-2
  » https://doi.org/10.1007/s12192-021-01216-2
• Pérez-Pérez A, Sánchez-Jiménez F, Vilariño-García T, et al. Role of leptin in inflammation and vice versa. International Journal of Molecular Sciences 2020;21(16): 5887. https://doi.org/10.3390%2Fijms21165887
  » https://doi.org/10.3390%2Fijms21165887
• Poetsch MS, Strano A, Guan K. Role of leptin in cardiovascular diseases . Frontiers in Endocrinology 2020;11:354. https://doi.org/10.3389/fendo.2020.00354
  » https://doi.org/10.3389/fendo.2020.00354
• Procaccini C, Lourenco EV, Matarese G, et al. Leptin signaling: A key pathway in immune responses. Current Signal Transduction Therapy 2009;4(1):22-30. https://doi.org/10.2174/157436209787048711
  » https://doi.org/10.2174/157436209787048711
• Quinteiro-Filho WM, Ribeiro A, Ferraz-de-Paula V, et al. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poultry Science 2010;89(9):1905-14. https://doi.org/10.3382/ps.2010-00812
  » https://doi.org/10.3382/ps.2010-00812
• Saeed M, Abbas G, Alagawany M, et al. Heat stress management in poultry farms: A comprehensive overview. Journal of Thermal Biology 2019;84:414-25. https://doi.org/10.1016/j.jtherbio.2019.07.025
  » https://doi.org/10.1016/j.jtherbio.2019.07.025
• Sánchez-Margalet V, Martín-Romero C, Santos-Alvarez J, et al. Role of leptin as an immunomodulator of blood mononuclear cells: mechanisms of action. Clinical and Experimental Immunology 2003;133(1):11-19. https://doi.org/10.1046/j.1365-2249.2003.02190.x
  » https://doi.org/10.1046/j.1365-2249.2003.02190.x
• Schroyen B, Guimarães EL, Dollé L, et al. Leptin-mediated reactive oxygen species production does not significantly affect primary mouse hepatocyte functions in vitro. European Journal of Gastroenterology & Hepatology 2012;24(12):1370-80. https://doi.org/10.1097/MEG.0b013e328357ce1c
  » https://doi.org/10.1097/MEG.0b013e328357ce1c
• Schulze PC, Kratzsch, J. Leptin as a new diagnostic tool in chronic heart failure. Clinica Chimica Acta 2005;362(1-2):1-11. https://doi.org/10.1016/j.cccn.2005.05.019
  » https://doi.org/10.1016/j.cccn.2005.05.019
• Shetty SS, Kumari NS, Hegde P, et al. Leptin gene polymorphism Rs7799039; G2548A, metabolic and oxidative stress markers in polycystic ovarian syndrome. Journal of King Saud University-Science 2022;34(6):102222. https://doi.org/10.1016/j.jksus.2022.102222
  » https://doi.org/10.1016/j.jksus.2022.102222
• Sies H, Berndt C, Jones DP. Oxidative stress. The Annual Review of Biochemistry 2017;86:715-48. https://doi.org/10.1146/annurev-biochem-061516-045037
  » https://doi.org/10.1146/annurev-biochem-061516-045037
• Song JH, Kim KJ, Choi SY, et al. Korean ginseng extract ameliorates abnormal immune response through the regulation of inflammatory constituents in Sprague Dawley rat subjected to environmental heat stress 2019. The Journal of Ginseng Research 2019;43(2): 252-60. https://doi.org/10.1016/j.jgr.2018.02.003
  » https://doi.org/10.1016/j.jgr.2018.02.003
• Sun Z, Dragon S, Becker A, et al. Leptin inhibits neutrophil apoptosis in children via ERK/NF-?B-dependent pathways. PLoS One 2013;8(1):e55249. https://doi.org/10.1371%2Fjournal.pone.0055249
  » https://doi.org/10.1371%2Fjournal.pone.0055249
• Surai PF, Kochish II, Kidd MT. Redox homeostasis in poultry: regulatory roles of NF-?B. Antioxidants 2021;10(2). https://doi.org/10.3390/antiox10020186
  » https://doi.org/10.3390/antiox10020186
• Tang L-P, Li W-H, Liu Y-L, et al. Heat stress aggravates intestinal inflammation through TLR4-NF-?B signaling pathway in Ma chickens infected with Escherichia coli O157:H7. Poultry Science 2021;100(5):101030. https://doi.org/https://doi.org/10.1016/j.psj.2021.101030
  » https://doi.org/https://doi.org/10.1016/j.psj.2021.101030
• Tang L-P, Liu Y-L, Zhang J-X, et al. Heat stress in broilers of liver injury effects of heat stress on oxidative stress and autophagy in liver of broilers. Poultry Science 2022;101(10):102085. https://doi.org/https://doi.org/10.1016/j.psj.2022.102085
  » https://doi.org/https://doi.org/10.1016/j.psj.2022.102085
• Tang S, Lv Y, Chen H, et al. Comparative analysis of ?B-crystallin expression in heat-stressed myocardial cells in vivo and in vitro. PLoS One 2014;9(1):e86937. https://doi.org/10.1371%2Fjournal.pone.0086937
  » https://doi.org/10.1371%2Fjournal.pone.0086937
• Varasteh S, Braber S, Akbari P, et al. Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides. PLoS One 2015;10(9):e0138975. https://doi.org/10.1371/journal.pone.0138975
  » https://doi.org/10.1371/journal.pone.0138975
• Vasamsetti SB, Natarajan N, Sadaf S, et al. Regulation of cardiovascular health and disease by visceral adipose tissue-derived metabolic hormones. The Journal of Physiology 2013;601(11):2099-120. https://doi.org/10.1113/jp282728
  » https://doi.org/10.1113/jp282728
• Wei H, Zhang R, Su Y, et al. Effects of acute cold stress after long-term cold stimulation on antioxidant status, heat shock proteins, inflammation and immune cytokines in broiler heart. Frontiers in Physiology 2018;9:1589. https://doi.org/10.3389%2Ffphys.2018.01589
  » https://doi.org/10.3389%2Ffphys.2018.01589
• Wu X-Y, Wang F-Y, Chen H-X, et al. Chronic heat stress induces lung injury in broiler chickens by disrupting the pulmonary blood-air barrier and activating TLRs/NF-?B signaling pathway. Poultry Science 2023;2103066. https://doi.org/10.1016%2Fj.psj.2023.103066
  » https://doi.org/10.1016%2Fj.psj.2023.103066
• Yamagishi S I, Edelstein D, Du X L, et al. Leptin induces mitochondrial superoxide production and monocyte chemoattractant protein-1 expression in aortic endothelial cells by increasing fatty acid oxidation via protein kinase A. The Journal of Biological Chemistry 2001;276(27):25096-100. https://doi.org/10.1074/jbc.M007383200
  » https://doi.org/10.1074/jbc.M007383200
• Yu J, Yin P, Liu F, et al. Effect of heat stress on the porcine small intestine: amorphological and gene expression study. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 2010;156(1):119-28. https://doi.org/https://doi.org/10.1016/j.cbpa.2010.01.008
  » https://doi.org/https://doi.org/10.1016/j.cbpa.2010.01.008
• Zhang C, Chen, K, Zhao X, et al. Protective effects of resveratrol against high ambient temperature-induced spleen dysplasia in broilers through modulating splenic redox status and apoptosis. Journal of the Science of Food and Agriculture 2018;98(14):5409-17. https://doi.org/10.1002/jsfa.9084
  » https://doi.org/10.1002/jsfa.9084
• Zhang JF, Bai K W, Su WP, et al. Curcumin attenuates heat-stress-induced oxidant damage by simultaneous activation of GSH-related antioxidant enzymes and Nrf2-mediated phase II detoxifying enzyme systems in broiler chickens. Poultry Science 2018;97(4):1209-19. https://doi.org/10.3382/ps/pex408
  » https://doi.org/10.3382/ps/pex408
• Zhao F-Q, Zhang Z-W, Wang C, et al. The role of heat shock proteins in inflammatory injury induced by cold stress in chicken heart. Cell Stress and Chaperones 2013;18(6):773-83. https://doi.org/10.1007%2Fs12192-013-0429-8
  » https://doi.org/10.1007%2Fs12192-013-0429-8

• Funding
  Fund for this work was provided by the college of graduate studies of Kuwait University.
• Data availability statement
  The datasets used and/or analyzed and materials used during the current study are available from the corresponding author upon reasonable request.
• Disclaimer/Publisher’s Note
  The published papers’ statements, opinions, and data are those of the individual author(s) and contributor(s). The editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions, or products referred to in the content.

Edited by

• Section editor:
  Ramon Malheiros

Data availability

The datasets used and/or analyzed and materials used during the current study are available from the corresponding author upon reasonable request.

Publication Dates

• Publication in this collection
  04 Nov 2024
• Date of issue
  2024

History

• Received
  26 Feb 2024
• Accepted
  02 Aug 2024