Effects of Dietary 1α-hydroxycholecalciferol on Broiler Performance, Femoral Quality, and Intestinal Calcium and Phosphorus Transporter Gene Expression

ABSTRACT

This study investigated the effects of dietary 1α-hydroxycholecalciferol (1α-OH-D₃) supplementation on growth performance, femoral quality, and intestinal gene expression related to calcium (Ca) and phosphorus (P) transporters in 1- to 21-day-old broilers. In a single-factor design, 288 broilers were randomly allocated to four groups. Birds were fed a basal diet supplemented with 0, 2.5, or 5.0 μg/kg 1α-OH-D₃, or 25 μg/kg VD₃ (positive control, PC). Compared with the unsupplemented group, broilers fed 2.5 and 5.0 µg/kg 1α-OH-D₃ exhibited significantly improved growth performance (body weight gain, feed intake) and femoral quality (bone weight, length, and the weights and percentages of ash, Ca, and P), and had a lower feed conversion ratio and mortality (p<0.05). No significant differences were detected between the two 1α-OH-D₃ doses for most indicators, except for femoral Ca and P weights. Meanwhile, adding 1α-OH-D₃ significantly upregulated the mRNA levels of calcium (CaBP-D28k, PMCA1b, NCX1) and phosphorus (NaPi-IIb, PiT-1, PiT-2) transporters in the three intestinal segments (p<0.05), except for duodenal PiT-1 and jejunal NaPi-IIb, revealing segment- and gene-specific effects. Importantly, 5.0 μg/kg 1α-OH-D₃ increased duodenal and jejunal CaBP-D28k mRNA abundance by more than 100-fold, and ileal expression by approximately 61-fold. In conclusion, dietary 1α-OH-D₃ improved growth performance and femoral mineralization in broilers and modulated intestinal Ca and P transporter gene expression in a segment-specific manner.

Keywords:
1α-OH-D₃; broiler; Ca and P transporters; femoral quality; performance

INTRODUCTION

Vitamin D (VD) is a key nutrient in the regulation of calcium (Ca) and phosphorus (P) homeostasis and the maintenance of bone health in broilers (Khan et al., 2023; Jabbar et al., 2024). Cholecalciferol (VD₃) and 25-hydroxycholecalciferol (25-OH-D₃) currently are the most commonly used VD sources in commercial feeds (Adhikari et al., 2020). Generally, VD₃ requires sequential hydroxylation reactions in the liver and kidneys to be converted into its biologically active form, 1,25-dihydroxyvitamin D₃ (1,25-(OH)₂-D₃) (Garcia et al., 2013; Światkiewicz et al., 2017). Although 25-OH-D₃ can bypass the hepatic hydroxylation step, its final activation still depends on renal 1α-hydroxylase (Holick & Chen, 2008; Plum & DeLuca, 2010). Thus, this organ-dependent metabolic pathway is susceptible to limitations under conditions such as high-density rearing or during the early post-hatch period, when hepatic and renal functions are not fully mature (Edwards et al., 2002). However, synthetic 1α-hydroxycholecalciferol (1α-OH-D₃) can directly bypass the rate-limiting step of renal 1α-hydroxylation due to the presence of a hydroxyl group at the C-1α position and only requires a single 25-hydroxylation step in the liver for activation (Applegate et al., 2003; Garcia et al., 2013).

Previous studies have confirmed that 1α-OH-D₃ possesses greater biological efficacy than both VD₃ and 25-OH-D₃ (Han et al., 2016; Wang et al., 2016). Moreover, compared with the direct use of the expensive 1,25-(OH)₂-D₃, 1α-OH-D₃ exhibits better stability during feed processing and storage, and is more cost-effective (Snow et al., 2004). Different types of VD₃ analogs may exert divergent effects on broiler performance and skeletal health. Although 1α-OH-D₃ has garnered considerable research interest as a promising feed additive for poultry (Landy & Toghyani, 2014; Ghasemi et al., 2019), studies on it remain considerably fewer than those on VD₃ (Shao et al., 2019; Tay-Zar et al., 2020; Han et al., 2023) and 1,25-(OH)₂-D₃ (Han et al., 2024). Therefore, there continues to be limited information regarding the effects of dietary 1α-OH-D₃ on intestinal Ca and P transporter gene expression in broilers.

In poultry intestines, active Ca transporters such as plasma membrane calcium ATPase 1b (PMCA1b) and sodium-calcium exchanger 1 (NCX1) are predominantly localized to the basolateral membrane; Calbindin-D28k (CaBP-D28k), by contrast, acts as a cytoplasmic calcium shuttle (Proszkowiec-Weglarz & Angel, 2013; Wongdee et al., 2021). Previous work by Wu et al. (2022) showed that 1,25-(OH)₂-D₃ promotes intestinal Ca absorption in 19-day-old broilers by upregulating the transcription of these three Ca transporters in the duodenum and jejunum. Similarly, dietary VD₃ supplementation has been shown to upregulate intestinal Ca transporter mRNA abundance in broilers, particularly in the duodenum (Han et al., 2023). However, the impact of dietary 1α-OH-D₃ on the expression of these intestinal Ca transporter genes in broilers remains unclear.

To date, three P transporters are known to be responsible for intestinal P absorption in animals: inorganic phosphorus transporters 1 (PiT-1) and 2 (PiT-2), and sodium-phosphorus cotransporter IIb (NaPi-IIb) (Wongdee & Charoenphandhu, 2015). Tay-Zar et al. (2020) demonstrated a linear upregulation of duodenal NaPi-IIb mRNA in broilers with rising dietary VD₃ concentrations. Zhang et al. (2024) reported that 1,25-(OH)₂-D₃ activated the transcription of NaPi-IIb and PiT-2 through the vitamin D receptor pathway. In short, most current research focuses on the impact of VD₃ on NaPi-IIb, while studies on the regulatory effect of 1α-OH-D₃ on the mRNA expression of PiT-1 and PiT-2 remain limited.

Therefore, this study was designed to examine the influence of dietary 1α-OH-D₃ on performance and femoral quality in 1- to 21-day-old broilers, focusing on its regulation of intestinal gene expression related to Ca and P transporters.

MATERIALS AND METHODS

Ethics Statement

All animal handling procedures were authorized by Shangqiu Normal University’s Animal Ethics Committee (2021-0327).

Animals and Feeding Management

In total, 288 one-day-old male Arbor Acres (AA) broilers were randomly allocated to four treatment groups. Each group consisted of six replicate cages with 12 birds per cage. Birds were housed in stainless steel cages with a floor area of 0.98 m² at a stocking density of 12.24 birds/m². During the 21-day trial, broilers had ad libitum access to mash feed and water. The house temperature was regulated as follows: 33-35 °C for days 1-3, 31-33 °C for days 4-7, and gradually decreased by 2-3 °C weekly until reaching 25 °C in the third week. Lighting consisted of 23 h light and 1 h dark from days 1 to 3, followed by 18 h light and 6 h dark from days 4 to 21. Relative humidity was maintained at 55%-70%. Ventilation was provided continuously by an exhaust fan system.

Diet Formulation and Experimental Design

Crystalline VD₃ and 1α-OH-D₃ (purity ≥ 97%) were purchased from Zhejiang Tianhecheng Biological Technology Co., Ltd. and Taizhou Healtech Chemical Co., Ltd., located in Jiaxing and Taizhou, China, respectively. Each compound was first dissolved in anhydrous ethanol and then diluted with propylene glycol to achieve a final ethanol-to-propylene glycol volume ratio of 1:19. Stock solutions of VD₃ (50 mg/L) and 1α-OH-D₃ (10 mg/L) were prepared and stored separately in amber bottles at 4 °C for subsequent feed formulation. All dietary treatments received the same final volume of ethanol-propylene glycol carrier solution.

A basal maize-soybean meal diet was prepared in compliance with both the Chinese Feeding Standard of Chicken (Ministry of Agriculture, 2004) and the NRC (1994). The basal diet composition is presented in Table 1. Groups 1-3 were fed this diet supplemented with 1α-OH-D₃ at doses of 0, 2.5, or 5.0 μg/kg, respectively. Group 4 served as the positive control (PC) and was fed the same basal diet supplemented with 25 μg/kg VD₃.

Table 1
Ingredients and nutrient composition of the maize-soybean meal basal diet fed to Arbor Acres broilers from 1 to 21 days of age.

Item	Amount
Ingredient (g/kg)
Maize	562.1
Soybean protein concentrate (645 g/kg CP)	36.7
Soybean meal (435 g/kg CP)	332.1
Soybean oil	28.0
Dicalcium phosphate	19.3
DL-Methionine (985 g/kg)	1.5
L-Lysine·Hydrochloride (985 g/kg)	1.5
Limestone	13.3
Vitamin premix1	0.2
Mineral premix2	0.1
Salt	3.1
Choline chloride (500 g/kg)	2.1
Nutrient composition (g/kg)
CP	215.0
Analyzed Ca	10.1
Analyzed total P	7.0
Non-phytate P	4.5
Methionine	5.1
Lysine	11.1
ME (kcal/kg)	2975.2

• ¹
  Provided per kg of diet: vitamin B₁ (thiamine), 2.2 mg; vitamin B₂ (riboflavin), 8.3 mg; niacin, 35.4 mg; pantothenic acid, 10.5 mg; vitamin B₆ (pyridoxine), 3.6 mg; biotin, 0.19 mg; folic acid, 0.56 mg; vitamin B₁₂, 0.015 mg; vitamin A, 4.5 mg; vitamin E, 21 mg; and vitamin K₃, 0.52 mg.
• ²
  Provided per kg of diet: Cu (CuSO₄∙5H₂O), 7 mg; Fe (FeSO₄∙7H₂O), 90 mg; Zn (ZnSO₄∙7H₂O), 50 mg; Mn (MnSO₄∙H₂O), 70 mg; Se (Na₂SeO₃), 0.15 mg; and I (KI), 0.30 mg.
• ³
  The vitamin premix did not contain VD₃.

Growth Performance Measurements

Before the experiment, the initial body weight (BW on day 1) of broilers was measured per replicate cage. To minimize the influence of digestive tract contents, broilers were fasted for 12 h before final body weight measurement on day 21 (BW on day 21). Birds that died naturally were individually weighed, and their body weights were used to correct feed intake (FI) and feed conversion ratio (FCR). Body weight gain (BWG) and mortality of broilers were then calculated.

Slaughtering and Sample Collection

At the end of the experiment (day 21), two broilers with body weights close to the cage average were selected from each replicate cage and euthanized by cervical dislocation. The left femur was sampled from both birds, whereas intestinal mucosa was collected from one bird per cage. Sample collection was performed as described by Hu et al. (2018). Each intestinal segment was longitudinally incised, emptied of digesta, and thoroughly rinsed with sterile ice-cold physiological saline. Intestinal mucosa was scraped on ice at 4 °C following the method of Han et al. (2023), and then immediately transferred into RNase-free centrifuge tubes. The mucosal samples were divided into three equal aliquots, flash-frozen in liquid nitrogen, and stored at −80 °C for subsequent analysis.

Bone Quality Assessment

Left femurs from all treatment groups were immersed in boiling deionized water for 10 min. After the excess muscle and cartilage were removed, the samples were placed in a 105 °C oven for 32 h to dry. The dried femurs were weighed on an analytical balance, and their lengths and diameters were measured with Vernier calipers. The femurs were crushed and ashed in a muffle furnace at 600 °C for 36 h, after which the ash weight was determined. Ca and total P contents were determined by the AOAC method and the vanadium-ammonium molybdate method, respectively. Ash percentage was calculated as (ash weight/dry bone weight) × 100%. The percentages of Ca and P were calculated as (measured Ca or P content/dry bone weight) × 100%, respectively.

Real-Time PCR

Primers were designed according to the published DNA sequences of chicken Ca and P transporter genes deposited in GenBank and were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The accession numbers and primer sequences are presented in Table 2.

Table 2
Gene accession numbers and real-time PCR primer sequences.

Accession	Gene	Primer (5′-3′)
NM_205513.1	CaBP-D28k (Calbindin-D28k)	F: AGATCTGGCACCACTACGAC R: TGAGCAAGCTCAACGATTCCT
NM_001168002.3	PMCAlb (plasma membrane calcium ATPase 1b)	F: AGCTCAAGATGGTGCAGCTA R: AACAAACCTGCTTTGCCAATCT
NM_001079473.1	NCX1 (sodium-calcium exchanger 1)	F: TCACCTTCTTCTTCTTCCCAATCT R: GCAACCTTTCCGTCCATCTC
NM_204474.1	NaPi-IIb (sodium-P cotransporter IIb)	F: TCGGTCCGTTCACTCTGTTG R: GCCACGTTGCCTTTGTGATT
XM_015297502.1	PiT-1 (P transporter 1)	F: GGCTCCGTGCTTCTGG R: CATTTGACGCCTTTCTGC
NM_001305398.1	PiT-2 (P transporter 2)	F: GCAGCAGATACATCAACTC R: ATTTCCACTCCACCCTC
NM_204305.1	GAPDH (glyceraldehyde-3-phosphate dehydrogenase)	F: GAACATCATCCCAGCGTCCA R: ACGGCAGGTCAGGTCAACAA

Total RNA was extracted from small intestinal mucosa using RNAiso Plus (Takara, Japan). RNA purity was evaluated using a NanoDrop spectrophotometer, with an OD_260/OD₂₈₀ ratio of 1.8-2.0. Intact 28S and 18S rRNA bands were visualized via 1.0% agarose gel electrophoresis. Total RNA was reverse transcribed into cDNA using the PrimeScript RT Kit (Takara, Japan), following the manufacturer’s instructions. Each 10 μL reaction mixture contained 1.0 μL of cDNA template. Amplification was performed on a Roche LightCycler® 480 system (Roche, Switzerland). In brief, the PCR protocol included an initial denaturation step (95 °C, 1 min), followed by 40 cycles of denaturation (95 °C, 10 s), annealing (60 °C, 30 s), and extension (72 °C, 30 s). Each PCR was run in triplicate. The melting curve analysis revealed a single specific peak for each primer. Amplification efficiencies of all target and reference genes were between 90% and 110%, with correlation coefficients (R²) > 0.98.

GAPDH was used as the reference gene. Preliminary analysis indicated that GAPDH Ct values did not differ significantly among treatments within each intestinal segment, supporting its use as the endogenous reference gene. The 2^-ΔΔCt method was applied to calculate the relative abundance of gene expression. Statistical analyses were carried out using raw ΔCt values, whereas the transformed relative expression fold changes were used only for result description and graph plotting.

Statistical Analysis

Each replicate cage served as an experimental unit. All data were analyzed with SAS 9.0 (SAS Institute, 2002). Normality was examined via the Shapiro-Wilk test and variance homogeneity via Levene’s test before one-way ANOVA. Tukey’s multiple comparison test was used for post hoc pairwise comparisons. Mortality data were analyzed using a generalized linear model with a binomial distribution and a logit link function. All figures were generated using GraphPad Prism 10.4. Differences were considered statistically significant at p<0.05.

RESULTS

Growth Performance

Compared with the unsupplemented control group (0 μg/kg), dietary addition of 1α-OH-D₃ at 2.5 and 5.0 μg/kg significantly elevated broiler BW, BWG, and FI at 21 days of age, while significantly reducing the FCR and mortality (p<0.05, Table 3). However, there were no significant differences in the above indicators between the two 1α-OH-D₃-supplemented groups and the PC group (25 μg/kg VD₃) (p>0.05). The 5.0 µg/kg 1α-OH-D₃ group did not differ significantly from the PC group for growth-performance indicators.

Table 3
Growth performance of broilers from 1 to 21 days of age as affected by dietary 1α-OH-D₃ supplementation.

1α-OH-D3 (µg/kg)	BW on day 1 (g/bird)	BW on day 21 (g/bird)	BWG (g/bird)	FI (g/bird)	FCR (g/g)	Mortality (%)
0	46.70	518.84c	472.14c	876.13b	1.87a	16.67a
2.5	47.42	753.35ab	705.93ab	1039.30a	1.50b	4.76b
5.0	47.53	763.61ab	716.08ab	1046.43a	1.47b	2.38b
PC	46.62	780.81a	734.18a	1071.90a	1.46b	2.38b
SEM	0.187	27.28	27.25	22.61	0.05	1.92
p-value	0.1828	<0.0001	<0.0001	0.0022	0.0011	0.0120

• ¹
  PC: positive control group, fed a basal diet with 25 µg/kg VD₃. BWG: body weight gain. FI: feed intake. FCR: feed conversion ratio.
• ²
  FI and FCR were corrected for the body weights of dead birds.
• ³
  Data are presented as cage means from 6 replicates (n = 6, 12 broilers per cage).
• ⁴
  ^a-c Different letters indicate significant differences (p<0.05).

Femoral Quality

Broilers fed diets supplemented with 2.5 and 5.0 µg/kg 1α-OH-D₃ exhibited significantly higher femoral weight, length, and bone mineralization parameters (including the weights and percentages of ash, Ca, and P) compared with the 0 µg/kg group (p<0.05, Table 4); femoral diameter tended to increase, though the difference did not reach statistical significance (p>0.05). Notably, the weights of ash, Ca, and P, as well as the ash percentage, in the 5.0 μg/kg group were significantly higher than those in the PC group (p<0.05), whereas the other indicators exhibited a numerical increase without statistical significance.

Table 4
Femoral quality of broilers from 1 to 21 days of age as affected by dietary 1α-OH-D₃ supplementation.

1α-OH-D3 (µg/kg)	Weight (g)	Length (cm)	Diameter (cm)	Weight (g)			Percentage (%)
				Ash	Ca	P	Ash	Ca	P
0	0.87b	4.02b	0.65b	0.30c	0.11c	0.06c	35.09c	13.43b	6.56b
2.5	1.31a	4.94a	0.71ab	0.60ab	0.22b	0.10b	47.75a	17.22a	8.25a
5.0	1.47a	5.07a	0.71ab	0.68a	0.26a	0.12a	47.27a	17.93a	8.56a
PC	1.30a	5.01a	0.73a	0.57b	0.22b	0.11b	44.47b	17.58a	8.41a
SEM	0.055	0.096	0.012	0.034	0.012	0.006	1.129	0.394	0.180
p-value	<0.0001	<0.0001	0.0373	<0.0001	<0.0001	<0.0001	<0.0001	<0.0001	<0.0001

• ¹
  PC: positive control group, fed a basal diet with 25 µg/kg VD₃.
• ²
  Data are presented as cage means from 6 replicates (n = 6, 2 broilers per cage).
• ³
  ^a-c Different letters indicate significant differences (p<0.05).

Ca Transporter Gene Expression

Dietary 1α-OH-D₃ at 2.5 and 5.0 μg/kg significantly upregulated CaBP-D28k, PMCA1b, and NCX1 mRNA levels in all three intestinal segments of broilers compared with the 0 μg/kg group (p<0.05, Figures 1a-c, 2a-c, 3a-c). In the duodenum and jejunum, the mRNA expression of CaBP-D28k and PMCA1b did not differ significantly with increasing doses of 1α-OH-D₃ (p>0.05). In the ileum, the mRNA expression of PMCA1b and NCX1 in the 2.5 μg/kg group was significantly higher than that in the 5.0 μg/kg group (p<0.05), whereas CaBP-D28k mRNA expression did not differ between the two doses (p>0.05). Importantly, 5.0 μg/kg 1α-OH-D₃ increased CaBP-D28k expression by 160.68-fold in the duodenum, 449.74-fold in the jejunum, and 60.80-fold in the ileum (Table 5).

Table 5
Fold changes in mRNA expression of intestinal Ca and P transporter genes in broilers relative to the 0 μg/kg 1α-OH-D₃ group.

Gene	Intestinal Segment	2.5 μg/kg 1α-OH-D3 (Fold change vs. 0 μg/kg)	5.0 μg/kg 1α-OH-D3 (Fold change vs. 0 μg/kg)	PC (25 μg/kg) (Fold change vs. 0 μg/kg)
CaBP-D28k	Duodenum	97.12 (p=0.209)	160.68 (p=0.015)	395.90 (p<0.0001)
	Jejunum	219.55 (p=0.242)	449.74 (p=0.004)	691.61 (p<0.0001)
	Ileum	64.20 (p=0.001)	60.80 (p=0.001)	55.31 (p=0.002)
PMCA1b	Duodenum	1.36 (p=0.717)	1.56 (p=0.027)	1.69 (p=0.006)
	Jejunum	2.45 (p=0.012)	2.32 (p=0.024)	3.71 (p<0.0001)
	Ileum	2.12 (p<0.0001)	1.68 (p=0.001)	1.72 (p=0.001)
NCX1	Duodenum	3.12 (p=0.003)	2.22 (p=0.044)	1.63 (p=0.633)
	Jejunum	2.17 (p=0.009)	2.04 (p=0.022)	1.51 (p=0.430)
	Ileum	4.76 (p=0.001)	2.92 (p=0.042)	2.78 (p=0.041)
NaPi-IIb	Duodenum	1.69 (p=0.043)	2.00 (p=0.025)	2.29 (p=0.002)
	Jejunum	1.40 (p=0.455)	1.36 (p=0.547)	1.64 (p=0.040)
	Ileum	1.73 (p=0.016)	1.87 (p=0.004)	1.62 (p=0.045)
PiT-1	Duodenum	1.64 (p=0.200)	1.54 (p=0.331)	2.22 (p=0.004)
	Jejunum	2.53 (p<0.0001)	2.75 (p<0.0001)	1.15 (p=0.784)
	Ileum	1.81 (p=0.004)	1.67 (p=0.018)	1.36 (p=0.319)
PiT-2	Duodenum	2.18 (p<0.0001)	1.83 (p=0.001)	1.67 (p=0.010)
	Jejunum	1.92 (p=0.0003)	1.52 (p=0.044)	1.66 (p=0.008)
	Ileum	2.24 (p<0.0001)	1.72 (p=0.002)	1.46 (p=0.043)

• ¹
  PC: positive control group, fed a basal diet with 25 µg/kg VD₃.
• ²
  Fold changes are expressed relative to the 0 μg/kg control group.
• ³
  ^a-c Differences with p<0.05 were considered statistically significant.

Figure 1
Duodenal mRNA expression of Ca and P transporter genes as affected by dietary 1α-OH-D₃.

Figure 2
Jejunal mRNA expression of Ca and P transporter genes as affected by dietary 1α-OH-D₃.

P Transporter Gene Expression

Broilers receiving dietary 1α-OH-D₃ at 2.5 and 5.0 μg/kg had significantly higher NaPi-IIb, PiT-1, and PiT-2 mRNA levels in the three intestinal segments than those in the 0 μg/kg group (p<0.05), except for duodenal PiT-1 and jejunal NaPi-IIb (Figures 1d-f, 2d-f, 3d-f). In each intestinal segment, there was no significant difference in the mRNA expression of NaPi-IIb and PiT-1 between the two 1α-OH-D₃-supplemented groups (p>0.05). In the jejunum and ileum, the mRNA expression of PiT-2 in the 2.5 μg/kg group was significantly higher than that in the 5.0 μg/kg group (p<0.05). Moreover, the induction effect of the 5.0 μg/kg group on P transporter mRNA abundance in the three intestinal segments was comparable to that of the PC group, except for jejunal PiT-1.

Figure 3
Ileal mRNA expression of Ca and P transporter genes as affected by dietary 1α-OH-D₃.

DISCUSSION

The Chinese Feeding Standard for Broilers (2004) recommends a dietary VD₃ level of 1000 IU/kg (equivalent to 25 μg/kg), and this dosage was used as the positive control in this study. Consistent with previous research (Fritts & Waldroup, 2003), dietary VD₃ deficiency impaired the growth performance and bone quality of broilers, while 1α-OH-D₃ supplementation improved these indicators. In accordance with the concentration ranges of 1α-OH-D₃ commonly applied in poultry studies (Landy & Toghyani, 2018; Ghasemi et al., 2019; Yang et al., 2020) and the 4.84-fold higher bioavailability of 1α-OH-D₃ relative to VD₃ (Wang et al., 2016), 1α-OH-D₃ doses of 2.5 and 5.0 μg/kg were selected for this study. Accordingly, 5.0 μg/kg 1α-OH-D₃ was calculated to be approximately equivalent to 24.2 μg/kg VD₃. It was thus expected to produce effects comparable with those of the PC group supplemented with 25 μg/kg VD₃, whereas the 2.5 μg/kg dose was expected to exhibit weaker effects than the PC group. This explains why the growth performance of the 5.0 μg/kg 1α-OH-D₃ group was comparable to that of the PC group.

Furthermore, Landy & Toghyani (2014) revealed that no significant differences were observed in growth rate and tibia quality between broilers fed 5.0 μg/kg 1α-OH-D₃ and those fed 5000 IU/kg VD₃ from 1 to 42 days of age, although all parameters in the 1α-OH-D₃ group showed a tendency toward improvement or increase. Our previous study (Han et al., 2023) showed that elevating the dietary VD₃ concentration from 1000 IU/kg to 2000 IU/kg did not improve broiler growth rate. Similar findings were reported by Sakkas et al. (2019). Thus, 1000 IU/kg VD₃ adequately meets the requirements for broiler performance and bone mineralization.

Nevertheless, Ghasemi et al. (2019) observed that adding 5.0 μg/kg 1α-OH-D₃ to diets low in Ca and P still resulted in reduced tibial mineral contents in broilers relative to those fed nutritionally adequate diets. Similarly, Pesti & Shivaprasad (2010) noted that 1α-OH-D₃ enhanced phytate utilization but did not affect broiler growth rate. Notably, the basal diet used in the present study contained sufficient Ca and P and no exogenous phytase. These results indicate that the optimal dosage of 1α-OH-D₃ depends on basal Ca and P supply, phytase inclusion, bird age, and basal diet VD status. Moreover, the unsupplemented group had a mortality rate of 16.67% within 21 days post-hatch, markedly higher than the <5% normally reported for broilers fed nutritionally adequate diets. Birds in this group presented leg weakness, reduced activity, and skeletal deformities indicative of severe VD deficiency. The elevated mortality was probably caused by disrupted Ca and P homeostasis. Such metabolic disorders may trigger rickets, motor impairment, and even death (Edwards et al., 2002; Whitehead, 2002). However, supplementation with 2.5 or 5.0 μg/kg 1α-OH-D₃ effectively reduced mortality. Because systematic postmortem examination and histopathology were not conducted, other potential risks, including bacterial infection and management-related stress, cannot be completely ruled out.

Notably, some femoral mineralization parameters were significantly elevated in the 5.0 μg/kg 1α-OH-D₃ group relative to the PC group. This advantage may be attributable to its simplified metabolic pathway. VD₃ requires dual hepatic and renal hydroxylation for activation, whereas 1α-OH-D₃ requires only one-step, hepatic 25-hydroxylation. This simplified activation pathway may favor intestinal Ca and P utilization and bone mineralization more effectively than conventional VD₃ under the present experimental conditions. Moreover, Wang et al. (2016) reported that dietary 1α-OH-D₃ had no significant effect on tibial diameter in broilers, which may be attributed to the more direct regulation of tibial diameter by growth hormone, genetic factors, and mechanical stress. Recent studies have demonstrated that combining two VD₃ analogs in animal diets typically yields greater improvements in overall growth rate and health status than using a single analog alone (Kwon et al., 2025; Phutthaphol et al., 2025).

To our knowledge, there is still limited research on how 1α-OH-D₃ regulates the expression of Ca and P transporter genes in the broiler small intestine. CaBP-D28k is involved in cytoplasmic Ca²⁺ transport and directly affects Ca deposition in bird bones (Bar, 2008; Fleet & Schoch, 2010). Our further analysis revealed that CaBP-D28k mRNA expression in the duodenum and jejunum of 21-day-old broilers was upregulated with increasing doses of 1α-OH-D₃. This finding aligns with studies by Liu et al. (2023) and Wu et al. (2022), which respectively showed that dietary administration of 25-OH-D₃ and 1,25-(OH)₂-D₃ significantly enhanced the mRNA abundance of CaBP-D28k in the small intestine of broilers. Recently, analogous findings have also been documented in laying ducks (Zhang et al., 2025). In contrast, the CaBP-D28k mRNA level in the ileum was not significantly affected by different doses of 1α-OH-D₃. Moreover, studies have shown that CaBP-D28k mRNA abundance is segment-specific, being most abundant in the duodenum, followed by the jejunum and ileum (Fleet & Schoch, 2010; Ebeid et al., 2012). The current study found that the addition of 5.0 μg/kg 1α-OH-D₃ upregulated CaBP-D28k mRNA abundance by more than one-hundred-fold in the duodenum and jejunum, while the upregulation reached approximately 61-fold in the ileum. This finding further supports that CaBP-D28k mRNA expression exhibits intestinal segment specificity.

Intestinal transcellular Ca²⁺ absorption is co-mediated by PMCA1b, NCX1 and intracellular CaBP-D28k. The former two mediate basolateral Ca²⁺ efflux, while CaBP-D28k buffers cytosolic Ca²⁺ and shuttles it to the basolateral side (Li et al., 2018; Wongdee et al., 2021). In this study, PMCA1b and NCX1 mRNA levels were significantly upregulated in all small intestinal segments of broilers following dietary addition of 1α-OH-D₃ at 2.5 and 5.0 μg/kg, compared with the 0 μg/kg group. This result is similar to the regulatory effects of VD₃ reported by Han et al. (2023). Another study found that the PMCA1b mRNA level in the small intestine was upregulated only after treatment with a high dose (50 μg/kg) of 25-OH-D₃ (Liu et al., 2023). Collectively, these findings indicate that 1α-OH-D₃, like other VD₃ analogs, upregulates key genes responsible for coordinated transcellular Ca transport.

NaPi-IIb, as a major P transporter, is responsible for maintaining systemic phosphate homeostasis (Sabbagh et al., 2009; Tatsumi et al., 2019). Consistent with the work of Tay-Zar et al. (2020) in poultry, dietary administration of 1α-OH-D₃ at 2.5 and 5.0 μg/kg significantly upregulated NaPi-IIb mRNA levels in the duodenum and ileum of broilers. However, the NaPi-IIb mRNA level in the jejunum did not change significantly, possibly because jejunal NaPi-IIb is only partially involved in phosphate absorption and utilization. For reference from other monogastric animal models, Saddoris et al. (2021) reported that dietary inclusion of 1500 IU/kg VD₃ failed to increase NaPi-IIb mRNA abundance in the jejunum of piglets. Although several poultry-related studies have demonstrated that duodenal NaPi-IIb mRNA abundance is regulated primarily by VD₃ and its analogs (Tay-Zar et al., 2020; Zhang et al., 2024), it is also influenced by dietary crude protein and non-phytate phosphorus concentrations (Huber et al., 2015; Li et al., 2018; Tay-Zar et al., 2019).

PiT-1 and PiT-2 have similar functions and participate in the active transport of phosphate in intestinal epithelial cells (Rubio-Aliaga & Krapf, 2022). Shao et al. (2019) documented that VD₃ promoted PiT-1 protein expression in the broiler small intestine. Zhang et al. (2024) found that intraduodenal loop perfusion with high-dose 1,25-(OH)₂-D₃ significantly activated PiT-2 gene transcription and protein expression in broilers. In another study, Katai et al. (1999) showed that VD₃ increased PiT-2 mRNA expression in the rat small intestine, where PiT-2 mRNA expression is generally lower than that of PiT-1 (Ichida et al., 2021). In this study, we observed that dietary 1α-OH-D₃ addition differentially upregulated PiT-1 and PiT-2 mRNA levels in different intestinal segments of broilers, except for duodenal PiT-1. Similar observations were reported by Shao et al. (2019). Furthermore, jejunal and ileal PiT-2 mRNA expression was more sensitive to the lower 1α-OH-D₃ dose (2.5 µg/kg). Taken together, these findings indicate that 1α-OH-D₃ exhibits segment- and gene-specific effects on the mRNA expression of intestinal P transporters in broilers.

However, these changes in Ca and P transporter mRNA expression do not directly lead to alterations in intestinal Ca or P transport function, and future studies measuring transporter protein abundance or conducting direct absorption assays are needed to confirm functional relevance.

CONCLUSION

This study demonstrated that dietary supplementation with 1α-OH-D₃ improved early broiler growth performance and femoral quality to varying degrees, while upregulating the intestinal mRNA expression of Ca and P transporters. Importantly, 5.0 μg/kg 1α-OH-D₃ induced a more than one-hundred-fold increase in CaBP-D28k mRNA levels in the duodenum and jejunum, and an approximately 61-fold increase in the ileum. However, further studies should confirm whether these transcriptional responses translate into protein-level changes and actual mineral absorption.

ACKNOWLEDGEMENTS

No additional acknowledgments are applicable for this study.

REFERENCES

• Adhikari R, White D, House JD, et al. Effects of additional dosage of vitamin D3, vitamin D2, and 25-Hydroxyvitamin D3 on calcium and phosphorus utilization, egg quality and bone mineralization in laying hens. Poultry Science 2020;99:364-73. https://doi.org/10.3382/ps/pez502
  » https://doi.org/10.3382/ps/pez502
• Applegate TJ, Angel R, Classen HL. Effect of dietary calcium, 25-hydroxycholecalciferol, or bird strain on small intestinal phytase activity in broiler chickens. Poultry Science 2003;82:1140-8. https://doi.org/10.1093/ps/82.7.1140
  » https://doi.org/10.1093/ps/82.7.1140
• Bar A. Calcium homeostasis and vitamin D metabolism and expression in strongly calcifying laying birds. Comparative Biochemistry and Physiology A: Molecular & Integrative Physiology 2008;151:477-90. https://doi.org/10.1016/j.cbpa.2008.07.006
  » https://doi.org/10.1016/j.cbpa.2008.07.006
• Ebeid TA, Suzuki T, Sugiyama T. High ambient temperature influences eggshell quality and calbindin-D28k localization of eggshell gland and all intestinal segments of laying hens. Poultry Science 2012;91:2282-7. https://doi.org/10.3382/ps.2011-01898
  » https://doi.org/10.3382/ps.2011-01898
• Edwards HM, Shirley RB, Escoe WB, et al. Quantitative evaluation of 1a-hydroxycholecalciferol as a cholecalciferol substitute for broilers. Poultry Science 2002;81:664-9. https://doi.org/10.1093/ps/81.5.664
  » https://doi.org/10.1093/ps/81.5.664
• Fleet JC, Schoch RD. Molecular mechanisms for regulation of intestinal calcium absorption by vitamin D and other factors. Critical Reviews in Clinical Laboratory Sciences 2010;47:181-95. https://doi.org/10.3109/10408363.2010.536429
  » https://doi.org/10.3109/10408363.2010.536429
• Fritts CA, Waldroup PW. Effect of source and level of vitamin D on live performance and bone development in growing broilers. Journal of Applied Poultry Research 2003;12:45-52. https://doi.org/10.1093/japr/12.1.45
  » https://doi.org/10.1093/japr/12.1.45
• Garcia AFQM, Murakami AE, Duarte CRDA, et al. Use of vitamin D3 and its metabolites in broiler chicken feed on performance, bone parameters and meat quality. Animal Bioscience 2013;26:408-15. https://doi.org/10.5713/ajas.2012.12455
  » https://doi.org/10.5713/ajas.2012.12455
• Ghasemi P, Toghyani M, Landy N. Effects of dietary 1-alpha-hydroxycholecalciferol in calcium and phosphorus-deficient diets on growth performance, tibia related indices and immune responses in broiler chickens. Animal Nutrition 2019;5:134-9. https://doi.org/10.1016/j.aninu.2018.04.011
  » https://doi.org/10.1016/j.aninu.2018.04.011
• Han JC, Chen GH, Wang JG, et al. Evaluation of Relative Bioavailability of 25-Hydroxycholecalciferol to Cholecalciferol for Broiler Chickens. Asian-Australasian Journal of Animal Sciences 2016;29:1145-51. https://doi.org/10.5713/ajas.15.0553
  » https://doi.org/10.5713/ajas.15.0553
• Han JC, Wu LH, Lv XL, et al. Intestinal segment and vitamin D3 concentration affect gene expression levels of calcium and phosphorus transporters in broiler chickens. Journal of Animal Science and Technology 2023;65:336-50. https://doi.org/10.5187/jast.2022.e78
  » https://doi.org/10.5187/jast.2022.e78
• Han JC, Lv XL, Wang Z, et al. MAPK signaling pathway participates in the regulation of intestinal phosphorus and calcium absorption in broiler chickens via 1,25-dihydroxyvitamin D3. Poultry Science 2024;103:104052. https://doi.org/10.1016/j.psj.2024.104052
  » https://doi.org/10.1016/j.psj.2024.104052
• Holick MF, Chen T. Vitamin D deficiency: a worldwide problem with health consequences. American Journal of Clinical Nutrition 2008;87:1080-6. https://doi.org/10.1093/ajcn/87.4.1080s
  » https://doi.org/10.1093/ajcn/87.4.1080s
• Huber K, Zeller E, Rodehutscord M. Modulation of small intestinal phosphate transporter by dietary supplements of mineral phosphorus and phytase in broilers. Poultry Science 2015;94:1009-17. https://doi.org/10.3382/ps/pev065
  » https://doi.org/10.3382/ps/pev065
• Hu YX, Liao XD, Wen Q, et al. Phosphorus absorption and gene expressions of related transporters in the small intestine of broilers. British Journal of Nutrition 2018;119:1346-54. https://doi.org/10.1017/s0007114518000934
  » https://doi.org/10.1017/s0007114518000934
• Ichida Y, Ohtomo S, Yamamoto T, et al. Evidence of an intestinal phosphate transporter alternative to type IIb sodium-dependent phosphate transporter in rats with chronic kidney disease. Nephrology Dialysis Transplantation 2021;36:68-75. https://doi.org/10.1093/ndt/gfaa156
  » https://doi.org/10.1093/ndt/gfaa156
• Jabbar A, Tahir M, Naz S, et al. Enhancing calcium and phosphorus utilization in broiler chickens through cholecalciferol in sequential calcium-phosphorus-deficient diets. Journal of Applied Animal Research 2024;52:2337177. https://doi.org/10.1080/09712119.2024.2337177
  » https://doi.org/10.1080/09712119.2024.2337177
• Katai K, Miyamoto K, Kishida S, et al. Regulation of intestinal na+-dependent phosphate co-transporters by a low-phosphate diet and 1,25-dihydroxy vitamin D3. Biochemical Journal 1999;3433:705-12.
• Khan RU, Naz S, Ullah H, et al. Dietary vitamin D: growth, physiological and health consequences in broiler production. Animal Biotechnology 2023;34:1635-41. https://doi.org/10.1080/10495398.2021.2013861
  » https://doi.org/10.1080/10495398.2021.2013861
• Kwon C, Torres J, Safaie E, et al. Effects of vitamin D3 and 25-hydroxyvitamin D3 supplementation on growth performance, bone mineral content, immunological parameters and antioxidant capacity of nursery pigs. Journal of Animal Science 2025;103:158-9. https://doi.org/10.1093/jas/skaf102.169
  » https://doi.org/10.1093/jas/skaf102.169
• Landy N, Toghyani M. Evaluation the effects of dietary cholecalciferol substitution with 1 alpha-hydroxycholecalciferol on performance and tibia parameters in broiler chickens. International Journal of Poultry Science 2014;13:515-7. https://doi.org/10.3923/ijps.2014.515.517
  » https://doi.org/10.3923/ijps.2014.515.517
• Landy N, Toghyani M. Evaluation of one-alpha-hydroxy-cholecalciferol alone or in combination with cholecalciferol in Ca-P deficiency diets on development of tibial dyschondroplasia in broiler chickens. Animal Nutrition 2018;4:109-12. https://doi.org/10.1016/j.aninu.2017.11.002
  » https://doi.org/10.1016/j.aninu.2017.11.002
• Li P, Wang RM, Jiao HC, et al. Effects of dietary phosphorus level on the expression of calcium and phosphorus transporters in laying hens. Frontiers in Physiology 2018;9:627. https://doi.org/10.3389/fphys.2018.00627
  » https://doi.org/10.3389/fphys.2018.00627
• Liu MY, Wu LH, Lv XL, et al. 25-hydroxycholecalciferol affects growth performance, bone calcium content and intestinal calcium transporter gene expression in broiler chickens. Journal of Animal and Feed Sciences 2023;32:138-45. https://doi.org/10.22358/jafs/157475/2023
  » https://doi.org/10.22358/jafs/157475/2023
• Ministry of Agriculture of China. Feeding standard of chicken. Beijing: Standards Press of China; 2004.
• NRC. Nutrient requirements of poultry. 9th ed. Washington (DC): National Academy Press; 1994.
• Pesti GM, Shivaprasad HL. The influence of excessive levels of 1a-hydroxycholecalciferol on the growth and tissue appearance of market weight chickens. Journal of Applied Poultry Research 2010;19:349-53. https://doi.org/10.3382/japr.2010-00193
  » https://doi.org/10.3382/japr.2010-00193
• Phutthaphol R, Bunchasak C, Loongyai W, et al. Effects of vitamin D3 and 25(OH)D3 supplementation on growth performance, bone parameters and gut microbiota of broiler chickens. Animals 2025;15:2900. https://doi.org/10.3390/ani15192900
  » https://doi.org/10.3390/ani15192900
• Plum LA, De Luca HF. Vitamin D, disease and therapeutic opportunities. Nature Reviews Drug Discovery 2010;9:941-55. https://doi.org/10.1038/nrd3318
  » https://doi.org/10.1038/nrd3318
• Proszkowiec-Weglarz M, Angel R. Calcium and phosphorus metabolism in broilers: Effect of homeostatic mechanism on calcium and phosphorus digestibility. Journal of Applied Poultry Research 2013;22:609-27. https://doi.org/10.3382/japr.2012-00743
  » https://doi.org/10.3382/japr.2012-00743
• Rubio-Aliaga I, Krapf R. Phosphate intake, hyperphosphatemia, and kidney function. Pflügers Archiv-European Journal of Physiology 2022;474:935-47. https://doi.org/10.1007/s00424-022-02691-x
  » https://doi.org/10.1007/s00424-022-02691-x
• Sabbagh Y, O'Brien P, Song W. Intestinal Npt2b plays a major role in phosphate absorption and homeostasis. Journal of the American Society of Nephrology 2009;20:2348-58. https://doi.org/10.1681/asn.2009050559
  » https://doi.org/10.1681/asn.2009050559
• Saddoris KL, Fleet JC, Radcliffe JS. The effect of dietary vitamin D supplementation on sodium-dependent phosphate uptake and expression of NaPi-IIb in the small intestine of weanling pigs. Journal of Animal Science 2021;99:skz106. https://doi.org/10.1093/jas/skz106
  » https://doi.org/10.1093/jas/skz106
• Sakkas P, Smith SS, Hill TR, et al. A reassessment of the vitamin D requirements of modern broiler genotypes. Poultry Science 2019;98:330-40. https://doi.org/10.3382/ps/pey350
  » https://doi.org/10.3382/ps/pey350
• Shao YX, Wen Q, Zhang SM, et al. Dietary supplemental vitamin D3 enhances phosphorus absorption and utilisation by regulating gene expression of related phosphate transporters in the small intestine of broilers. British Journal of Nutrition 2019;21:9-21. https://doi.org/10.1017/s0007114518002763
  » https://doi.org/10.1017/s0007114518002763
• Snow JL, Baker DH, Parsons CM. Phytase, citric acid, and 1a-hydroxycholecalciferol improve phytate phosphorus utilization in chicks fed a corn-soybean meal diet. Poultry Science 2004;83:1187-92. https://doi.org/10.1093/ps/83.7.1187
  » https://doi.org/10.1093/ps/83.7.1187
• SAS Institute. SAS user's guide: statistics. version 9.0. Cary (NC): SAS Institute; 2002.
• Swiatkiewicz S, Arczewska-Wlosek A, Bederska-Lojewska D, et al. Efficacy of dietary vitamin D and its metabolites in poultry-review and implications of the recent studies. World's Poultry Science Journal 2017;73:57-68. https://doi.org/10.1017/s0043933916001057
  » https://doi.org/10.1017/s0043933916001057
• Tatsumi S, Katai K, Kaneko I, et al. NAD metabolism and the SLC34 family: evidence for a liver-kidney axis regulating inorganic phosphate. Pflügers Archiv- European Journal of Physiology 2019;471:109-22. https://doi.org/10.1007/s00424-018-2204-2
  » https://doi.org/10.1007/s00424-018-2204-2
• Tay-Zar AC, Muhammad BS, Pirat S, et al. Vitamin D3 enhanced intestine phosphate cotrans porter genes in young and growing broilers. Poultry Science 2020;99:2041-7. https://doi.org/10.1016/j.psj.2019.11.038
  » https://doi.org/10.1016/j.psj.2019.11.038
• Tay-Zar AC, Srichana P, Sadiq MB, et al. Restriction of dietary non-phytate phosphorus on growth performance and expression of intestinal phosphate transporter genes in Broilers. Poultry Science 2019;98:4685-93. https://doi.org/10.3382/ps/pez171
  » https://doi.org/10.3382/ps/pez171
• Wang JG, Han JC, Chen GH, et al. Comparison of bioavailability of 1a-hydroxycholecalciferol and cholecalciferol in broiler chicken diets. The Journal of Poultry Science 2016;53:22-8. https://doi.org/10.2141/jpsa.0150009
  » https://doi.org/10.2141/jpsa.0150009
• Whitehead CC. Nutrition and poultry welfare. World's Poultry Science Journal 2002;58:349-56. https://doi.org/10.1079/wps20020027
  » https://doi.org/10.1079/wps20020027
• Wongdee K, Chanpaisaeng K, Teerapornpuntakit J, et al. Intestinal calcium absorption. Comprehensive Physiology 2021;11:2047-73. https://doi.org/10.1002/cphy.c200014
  » https://doi.org/10.1002/cphy.c200014
• Wongdee K, Charoenphandhu N. Vitamin D-enhanced duodenal calcium transport. Vitamins & Hormones 2015;98:407-40. https://doi.org/10.1016/bs.vh.2014.12.010
  » https://doi.org/10.1016/bs.vh.2014.12.010
• Wu LH, Wang X, Lv XL, et al. 1,25-dihydroxycholecalciferol improved the growth performance and upregulated the calcium transporter gene expression levels in the small intestine of broiler chickens. Journal of Poultry Science 2022;59:129-36. https://doi.org/10.2141/jpsa.0210019
  » https://doi.org/10.2141/jpsa.0210019
• Yang X, Zhang N, Wang XN, et al. Optimal dietary levels of 1a-Hydroxycholecalciferol in broiler chickens from 1 to 42 days of age. The Journal of Poultry Science 2020;57:124-30. https://doi.org/10.2141/jpsa.0190013
  » https://doi.org/10.2141/jpsa.0190013
• Zhang WY, Geng YQ, Yang K, et al. 1,25-dihydroxy vitamin D3 enhances the expression of phosphorus transporters via vitamin D receptor in ligated duodenal loops of Arbor Acres male broilers. Poultry Science 2024;103:104503. https://doi.org/10.1016/j.psj.2024.104503
  » https://doi.org/10.1016/j.psj.2024.104503
• Zhang Y, Xia H, Wang S, et al. Dietary cholecalciferol and 25-hydroxyvitamin D3 supplementation improved eggshell and bone quality of laying ducks during 60 to 76 weeks of Age. Animal Nutrition 2025;22:414-25. https://doi.org/10.1016/j.aninu.2025.02.01
  » https://doi.org/10.1016/j.aninu.2025.02.01

FUNDING

Supported by the National Natural Science Foundation of China (32072753), Natural Science Foundation of Henan Province (252300423078), the Henan Provincial Science and Technology Development Plans (242102110047; 232102110099), the Young Scientists Fund of the Natural Science Foundation of Henan Province (252300420716), and the Key Research Project of Henan Higher Education Institutions (25B230004).

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

DISCLAIMER/PUBLISHER’S NOTE

The published papers’ statements, opinions, and data are those of the individual author(s) and contributor(s). The editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions, or products referred to in the content.

Corresponding author e-mail address

Jincheng Han Shangqiu Normal University, College of Biology and Food, College of Smart Animal Husbandry, Shangqiu, Henan, 476000, China. Phone: [phone] Email: [e-mail]

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Section Editor:

Maria Fernanda Burbarelli

Publication Dates

• Publication in this collection
  02 Oct 2026
• Date of issue
  2026

History

• Received
  03 Apr 2026
• Accepted
  31 July 2026