Utilization of Biotechnology, Neurotransmitter and Cytogenetic Indices in Selecting Pigeon Breeds

El-Sayed, MA; Ibrahim, NS; Assi, HAEM; El-Gawad, MA; Mohammed, WS; Ibrahim, MA; Mesalam, NM; Abdel-Moneim, AE

doi:10.1590/1806-9061-2021-1586

MA El-Sayed

read

approved the final

Animal Genetic Resources Department, National Gene Bank, Agricultural Research Center, P.O. Box 12619-Giza Egypt.

http://orcid.org/0000-0003-3980-2812

NS Ibrahim

pigeon breeds sample collection and performed three breeds of Pigeons, maintained at the pigeons experimental farm

biochemical analysis of neurotransmitters

statistical analysis of neurotransmitters data

conception

design

data collection

interpretation of the results

wrote

corresponding author with MAE

Data discussion

data analyses

read

approved the final

Biological Applic. Department, Nuclear Res. Center, Egyptian Atomic Energy Authority, P.O. Box 13759, Cairo, Egypt. nashaat1977@yahoo.com

http://orcid.org/0000-0003-4907-2905

HAEM Assi

genetic analyses of breeds

data discussion

data analyses, and MEA, MAI measured parameters of cytogenetic among the three pigeon breeds

read

approved the final

Animal Production Research Institute, Agricultural Research Center, Giza, Egypt.

http://orcid.org/0000-0003-4541-7662

MA El-Gawad

genetic analyses of breeds

data discussion

data analyses, and MEA, MAI measured parameters of cytogenetic among the three pigeon breeds

read

approved the final

Animal Genetic Resources Department, National Gene Bank, Agricultural Research Center, P.O. Box 12619-Giza Egypt.

http://orcid.org/0000-0001-8267-8859

WS Mohammed

genetic analyses of breeds

data discussion

data analyses, and MEA, MAI measured parameters of cytogenetic among the three pigeon breeds

read

approved the final

Biotechnology Department, Faculty of Agriculture, Al-Azhar University, Nasr city, Egypt.

http://orcid.org/0000-0001-6570-3901

MA Ibrahim

read

approved the final

Animal Genetic Resources Department, National Gene Bank, Agricultural Research Center, P.O. Box 12619-Giza Egypt.

http://orcid.org/0000-0001-7301-6220

NM Mesalam

read

approved the final

Biological Applic. Department, Nuclear Res. Center, Egyptian Atomic Energy Authority, P.O. Box 13759, Cairo, Egypt. nashaat1977@yahoo.com

http://orcid.org/0000-0001-7176-9165

AE Abdel-Moneim

pigeon breeds sample collection and performed three breeds of Pigeons, maintained at the pigeons experimental farm

biochemical analysis of neurotransmitters

statistical analysis of neurotransmitters data

Biological Applic. Department, Nuclear Res. Center, Egyptian Atomic Energy Authority, P.O. Box 13759, Cairo, Egypt. nashaat1977@yahoo.com

http://orcid.org/0000-0002-0199-6298

Corresponding author e-mail address
Nashat Saeid Ibrahim Biological Application. Department, Nuclear Research. Center, Egyptian Atomic Energy Authority, Inshas, Egypt, P.O, Box 13759. Phone: (0202) / +02-01119992240 Email: Nashaat1977@yahoo.com

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest.

Genes	Primers sequences	References
DR-D4 Fragment (1)	F: TTTGGGATCGCTCGCTTACC R: ATGACAGGGGATGCTACAGC	Proskura et al., (2015Proskura WS, Kustosz J, Dybus A, Lanckriet R. Polymorphism in dopamine receptor D4 gene is associated with pigeon racing performance. Animal Genetics 2015;46(5):586-7.)
DR-D4 Fragment (2)	F: TTTGGGATCGCTCGCTTACC R: GCAGGACAACACAGCGTCTC	Proskura et al., (2015Proskura WS, Kustosz J, Dybus A, Lanckriet R. Polymorphism in dopamine receptor D4 gene is associated with pigeon racing performance. Animal Genetics 2015;46(5):586-7.)
DR-D4 Fragment (3)	F: GGGCCAACAGGAAGCTCTAT R: GCAGGACAACACAGCGTCTC	Proskura et al., (2015Proskura WS, Kustosz J, Dybus A, Lanckriet R. Polymorphism in dopamine receptor D4 gene is associated with pigeon racing performance. Animal Genetics 2015;46(5):586-7.)
LDH-A	F: ATCATGGGCTATTGGCCTCT R: AAAACCTGAGGAAGAGGA CAAA	Dybus et al., (2006Dybus A, Pijanka J, Cheng Y-H, Sheen F, Grzesiak W, Muszynska M. Polymorphism within the LDHA gene in the homing and non-homing pigeons. Journal of Applied Genetics 2006;47:63-6.)

Genes /Breed	Female racing long distances pigeon			Male racing long distances pigeon
Genes /Breed	Position (bp)	Deletion	Variation	Position (bp)	Deletion	Variation
LDH-A	20	A		195		TA
LDH-A	362	A		385	C
LDH-A	366	C		386	A
LDH-A				387	G
LDH-A				389		AG
DR-D4	17		TC	418		AC
DR-D4				524		CT
	Female racing short distances pigeon			Male racing short distances pigeon
	Position (bp)	Deletion	Variation	Position (bp)	Deletion	Variation
LDH-A	20	A		20	A
LDH-A	362	A		362	A
LDH-A	366	C		366	C
DR-D4	457		CT	17		TC
DR-D4				496		TC
	Female non-racing wild rock pigeon			Male non-racing wild rock pigeon pigeon
	Position (bp)	Deletion	Variation	Position (bp)	Deletion	Variation
LDH-A	20	A		20	A
LDH-A	362	A		261		CT
LDH-A	366	C		362	A
LDH-A	383		CT	366	C
LDH-A	386		AC
LDH-A	387		GA
LDH-A	388		AG

Breed	Gender	Counts of nucleotides
		DR-D4 gene						LDH-A gene
		A	T	C	G	C+G	A+T	A	T	C	G	C+G	A+T
Racing long distances pigeon	Female	135	131	196	157	353	266	118	113	69	86	155	231
Racing long distances pigeon	Male	135	132	195	157	352	267	119	112	69	86	155	231
Racing short distances pigeon	Female	135	133	194	157	351	268	118	113	69	86	155	231
Racing short distances pigeon	Male	135	130	197	157	354	265	118	113	69	86	155	231
Non-racing wild rock pigeon	Female	134	133	195	157	352	267	117	114	69	86	155	231
Non-racing wild rock pigeon	Male	134	133	196	157	352	267	118	114	68	86	154	232
Total		808	792	1173	942	1762	1333	708	679	413	516	929	1387

Pigeon Breeds	Gender	Genes	Frequencies of nucleotides
Pigeon Breeds	Gender	Genes	G/C	A/T	PIC
Racing long distances pigeon	Female	LDH-A	0.402	0.598	0.48
	Female	DR-D4	0.570	0.430	0.49
	Male	LDH-A	0.402	0.598	0.48
	Male	DR-D4	0.569	0.431	0.49
Racing short distances pigeon	Female	LDH-A	0.402	0.598	0.48
	Female	DR-D4	0.567	0.433	0.49
	Male	LDH-A	0.402	0.598	0.48
	Male	DR-D4	0.572	0.428	0.49
Non-racing wild rock pigeon	Female	LDH-A	0.402	0.598	0.48
	Female	DR-D4	0.569	0.431	0.49
	Male	LDH-A	0.399	0.601	0.48
	Male	DR-D4	0.402	0.598	0.48

	RL%			CI			CP
	1	2	3	1	2	3
1	6.65	6.88	6.64	44.18	44.50	44.11	submetcentric
2	6.65	6.70	6.64	44.18	44.03	44.11	submetcentric
3	4.98	5.33	5.24	3.03	3.23	3.33	acrocentric
4	6.50	6.70	6.47	44.86	44.59	44.24	submetcentric
5	6.34	6.36	6.47	44.86	44.24	44.24	submetcentric
6	6.34	6.19	6.29	4.86	4.44	4.44	acrocentric
7	6.34	6.19	6.29	3.86	4.44	4.44	acrocentric
8	6.04	6.02	6.12	3.90	3.86	3.86	acrocentric
Z	3.29	3.27	3.15	44.86	44.37	44.44	submetcentric
W	2.50	2.56	2.60	43.90	43.72	43.80	submetcentric

		G-positive bands	G-negative bands	Total
1	p	4	5	9	22
1	q	6	7	13	22
2	p	4	5	9	20
2	q	5	6	11	20
3	p	5	6	11	11
4	p	2	3	5	12
4	q	3	4	7	12
5	p	2	3	5	12
5	q	3	4	7	12
6	p	3	4	7	7
7	P	3	4	7	7
8	p	2	3	5	5
Z	p	2	3	5	12
Z	q	3	4	7	12
W	p	1	2	3	6
W	q	1	2	3	6
Total		49	65	114

Indices	DA ng/ml	ST ng/ml	GABA pg/ml	ACHE pg/ml	MTN pg/ml
Pigeon breeds	DA ng/ml	ST ng/ml	GABA pg/ml	ACHE pg/ml	MTN pg/ml
Racing long distances pigeon	0.666^a	159^a	258^a	68^a	197^a
Racing short distances pigeon	0.335^b	67^b	146^b	34^b	80^b
Non-racing wild rock pigeon	0.253^b	25^c	78^c	18^b	48^c
SEM	0.066	20.01	26.64	7.800	22.94
p -value	0.001	<0.001	<0.001	0.001	<0.001

[1] Corresponding author e-mail address
Nashat Saeid Ibrahim Biological Application. Department, Nuclear Research. Center, Egyptian Atomic Energy Authority, Inshas, Egypt, P.O, Box 13759. Phone: (0202) / +02-01119992240 Email: Nashaat1977@yahoo.com

Brasil

Brasil

Utilization of Biotechnology, Neurotransmitter and Cytogenetic Indices in Selecting Pigeon Breeds

ABSTRACT