Influence of Dietary Chromium and Vitamin E Supplementation on Performance, Metabolism, and Physiology of Broilers Subjected to Cyclic Heat Stress

ABSTRACT

This experiment evaluated the influence of chromium (Cr) and vitamin E (VitE) supplementation on the performance, glucose levels, thyroid hormone levels, immune and oxidative response, and 70 kilodalton heat shock protein (HSP70) mRNA expression of broilers under heat stress (HS). Male chickens (n = 768, 22 days old) were randomly assigned to a 4x3 factorial with 4 Cr levels (0, 500, 1000, and 1500 ppb) and 3 VitE levels (0, 150, and 300 mg/kg), totaling 12 treatments with 8 replicates and 8 birds per experimental unit. Performance, glucose levels, thyroid hormone levels, heterophil-to-lymphocyte (H:L) ratio, malondialdehyde (MDA) in muscle, relative weight of lymphoid organs, and HSP70 mRNA expression were measured. VitE at 150 mg/kg improved FI and BWG (p ≤ 0.05). The combination of Cr 1500 ppb and VitE 150 mg/kg reduced FCR (p ≤ 0.05). Cr and VitE had single effects on glucose levels (p ≤ 0.05) and their interaction influenced thyroid hormone levels (p ≤ 0.05). Cr 1500 ppb with VitE 300 mg/kg lowered the H:L ratio and HSP70 mRNA expression (p ≤ 0.05). VitE at 300 mg/kg increased spleen relative weight (p ≤ 0.05). Cr supplementation reduced MDA concentrations (p ≤ 0.05). In conclusion, Cr and VitE, individually or combined, benefitted performance, glucose and thyroid hormone levels, immune and oxidative response, and heat stress tolerance.

Keywords: Nutritional strategies; antioxidant; trace mineral; metabolic response

INTRODUCTION

A range of stress factors influences modern poultry production. Broiler chickens are particularly vulnerable to heat stress (HS) due to their limited capacity to dissipate heat, high metabolic activity and internal body temperature, and narrow zone of thermal tolerance (Emami et al., 2021). Birds exposed to HS adopt several adaptive mechanisms crucial for survival, which can have negative impacts on performance, hematological parameters, immune and oxidative response, as well as overall metabolic processes (Khan et al., 2023). Several strategies including physical cooling measures, and managerial, genetic, and nutritional approaches have been tested to alleviate the detrimental effects of HS on poultry (He et al., 2018). Dietary supplementation of vitamins and minerals may be a helpful strategy in reducing the negative effects of HS (Saeed et al., 2019).

Vitamin E (Vit E) is a natural antioxidant that plays a crucial role in preserving the integrity of cell membranes (Traber & Atkinson, 2007). It has been reported that Vit E supplementation was associated with improvement in growth performance in animals due to its ability to mitigate the peroxidation of membrane lipids, thereby safeguarding cellular structures, and enhancing the activation of the immune system (Dalólio et al., 2015). Chromium (Cr), a trace mineral, has been recognized as an effective strategy for mitigating the deleterious effects of HS in animals (Piray & Foroutanifar, 2022). Its beneficial properties are associated with several physiological mechanisms, including the reduction of corticosterone concentrations, enhancement of immune function, and attenuation of oxidative stress in broiler chickens (Dalólio et al., 2018). Nevertheless, the Cr requirement for broilers has not been established.

In this study, we hypothesized that combining dietary Cr and Vit E supplementation could exhibit synergistic effects in mitigating the adverse impacts of HS conditions on broilers. Therefore, this study aimed to assess the influence of Cr and Vit E supplementation on performance parameters, glucose levels, thyroid hormone levels, immune and oxidative response, and HSP70 mRNA expression in broiler chickens under HS conditions (32°C).

MATERIALS AND METHODS

Ethics Committee

All procedures adopted in this study were previously approved by the Ethics Committee in the Use of Farming Animals at the Federal University of Viçosa, under protocol number 038/2018.

Birds Husbandry

The experiment was performed in the environmentally controlled chambers of the Laboratory of Bioclimatology in the Animal Science Department at the Federal University of Viçosa, Viçosa, Minas Gerais, Brazil. From 1 to 21 days of age, chicks were reared in a house according to Cobb500™ guideline recommendations (Cobb Broiler Management Guide, Cobb-Vantress, 2021) and fed a diet formulated to meet their nutritional requirements according to Rostagno et al. (2017), which contained 36,100 IU Vit E/kg of feed.

At 22 days of age, a total of 768 Cobb500™ broilers (924 g ± 36 g) were randomly assigned to battery cages in a completely randomized design within the environmentally controlled chambers. The design followed a 4 x 3 factorial arrangement, comprising four levels of Cr (0, 500, 1000, and 1500 ppb) and three levels of Vit E (0, 150, and 300 mg/kg), totaling 12 treatments with 8 replicates and 8 birds per experimental unit, which was represented by a cage. The treatment containing Vit E at the level of 0 mg/kg was a deficient diet. Each cage, measuring 0.80 x 0.80 m², was equipped with one nipple drinker and two tube feeders, allowing birds to have ad libitum access to feed and water during the entire experimental period, which consisted of 21 days (22-42 days old).

During the experimental period (22-42 days), birds were exposed to a 12-hour HS challenge daily, where the temperature and humidity were maintained at 32.0 ± 0.8 ºC (608.0 ± 46.4 ºF) and 65.2 ± 3.5%, respectively, from 7:00 a.m. to 7:00 p.m. During the remaining period, the temperature was set to 23ºC (73.4 ºF) to ensure it remained in the thermoneutral (TN) zone. The lighting program adopted consisted of 16 hours of artificial light followed by 8 hours of darkness. Environmental conditions, including temperature and humidity, were monitored daily at 7 a.m., 10 a.m., 2 p.m., 4 p.m., and 6 p.m. using wet/dry bulbs and black globe thermometers placed in the middle of the chambers.

Experimental Diets

The experimental diets (Table 1) were based on corn and soybean meal and were formulated to meet or exceed the nutritional requirements of broilers for the finisher phase, according to Rostagno et al. (2017). Four levels of Cr methionine 0.1% (Zinpro^®, Eden Prairie, Minnesota) were added to diets (0, 0.50, 1.00, and 1.50 mg/kg or 0, 500, 1000, and 1500 ppb) replacing the inert components; and three levels of α-tocopherol Vit E (DSM, Heerlen, The Netherlands) were added to each Cr-level (0, 150, and 300 mg/kg), resulting in 12 dietary treatments.

Table 1
Basal diets.

Ingredients	(%)
Ground yellow corn	63.808
Soybean meal (45% CP)	30.260
Soybean oil	2.650
Dicalcium phosphate (24.5% Ca, 18.5% P)	1.156
Limestone	0.816
Salt	0.440
DL-Methionine, 99%	0.209
L- Lysine HCl, 78.8%	0.136
Choline chloride, 60%	0.100
Vitamin Premix1	0.100
Mineral Premix2	0.050
Salinomycin, 12%	0.055
Antioxidant BHT3	0.010
Chromium methionine, 0.1%	0.000
Inert	0.210
Crude Protein (%)	19.00
Metabolizable energy, kcal/kg	3100
Calcium (%)	0.683
Available Phosphorus (%)	0.319
Sodium (%)	0.190
SID Lysine (%)	1.005
SID Methionine + Cystine (%)	0.733

• ¹
  Vitamin premix provided per kg of diet: vitamin A, 10,000,000 IU; vitamin D3, 2,000,000 IU; vitamin B1, 1.5 g; vitamin B2, 6.00 g; vitamin B6, 4.0 g; vitamin B12, 15.9 mg; vitamin K3, 3.0 g; pantothenic acid, 12.00 g; nicotinic acid, 50.00 g; folic acid, 0.30 g; biotin, 50.00 mg, niacin, 30 g. The vitamin premix supplied in diets did not contain vitamin E.
• ²
  Trace mineral premix provided per kg of diet: Mn, 78.00 g; Fe, 50.00 g; Zn, 55.00 g; Cu, 10.00 g; I, 0.70 g; Se, 0.18 g, Co, 2.00 g. The mineral premix supplied in diets did not contain chromium.
• ³
  Antioxidant Butylhydroxytoluene.
• SID: standardized ileal digestibility.

Performance Parameters

On days 22 and 42, birds, feed, and leftovers were weighed individually to calculate the average body weight gain (BWG, kg/bird), cumulative feed intake (FI, kg/bird), and feed conversion ratio (FCR, kg/kg). In case of mortality, individual feed intake was adjusted by weighing the feed. Each cage was considered an experimental unit.

Samples Collection

At 42 days of age, four birds from each cage were selected based on their BW being closest to the average of their respective experimental unit (± 10%), totaling 32 birds per treatment. A 5 mL blood sample was collected from the jugular vein and immediately centrifuged to obtain serum, which was stored at -80ºC for subsequent analysis. After, birds were slaughtered using the electronarcosis technique followed by bloodletting. Then, samples of the Pectoralis major muscle were collected, cryogenically stored, flash-frozen in liquid nitrogen, and then kept at -80°C for subsequent analysis of oxidative stress and HSP70 gene expression. The spleen and Bursa of Fabricius were also collected, and their weights were calculated as a proportion of live body weight.

Blood Parameters and Malondialdehyde Concentrations

The blood samples were sent to the LADVET analysis laboratory (Viçosa, Minas Gerais, Brazil) for quantitative analysis of glucose levels (g/L), and heterophils and lymphocytes count to determine the heterophil-to-lymphocyte (H:L) ratio.

The serum concentrations (µg/mL) of triiodothyronine (T3) and thyroxine (T4) were measured using an immunoassay ELISA kit (Bethyl Laboratory Inc., Montgomery, Texas) following the manufacturer’s instructions. The concentration of malondialdehyde (MDA) was determined in muscle samples (mg/kg) using the TBA test methodology as described by Rosmini et al. (1996).

mRNA Extraction and Heat Shock Protein Expression

Total RNA was extracted from muscle samples using a RNeasy Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. The RNA concentration was determined using a Nano Vue Plus spectrophotometer (GE HealthCare Technologies Inc., Chicago, Illinois). RNA integrity was evaluated on 1% agarose gel. Subsequently, samples were converted into cDNA using the kit SuperScriptTM III First-StrandSynthesisSuper Mix (Thermo Fisher Scientific Corporation, Waltham, Massachusetts), following the manufacturer’s recommendations. The samples were stored at -20°C until analysis. The target genes evaluated in the muscle samples were the 70 kilodalton heat shock protein (HSP70), and β-actin (β-ACT), with the latter being used as the endogenous gene for data normalization (Table 2). The real-time quantitative PCR (RT-qPCR) analysis was performed in duplicate using the QuantStudio 3 Thermocycler (Applied Biosystems™, Foster City, California) with the Relative Quantification method, SYBR^® Green PCR Master Mix kit (QIAGEN). The threshold cycle (Ct) values obtained were later normalized using the ΔCt method based on the Ct values obtained for the endogenous control gene β-ACT. The calculation of relative gene expression levels was developed according to the 2^-ΔΔCt method described by Livak and Schmittgen (2001).

Table 2
Primers for housekeeping gene and target gene.

Genes	Accession number
Β-actine	XM_026082987.1	GACATCAGGGTGTGATGGTTGGT	Forward primer
		CCCAGTTGGTGACAATACCGTGT	Reverse primer
HSP70	MH422508.1	CGTGACAATGCTGGCAATAAGCGA	Forward primer
		CAATCTCAATGCTGGCTTGCGTG	Reverse primer

Statistical Analysis

The RStudio statistical software (R version 4.2.0) was used for data analysis. Data were previously evaluated for outliers using a boxplot, and any observations that exceeded 1.5 times the interquartile range were eliminated from the dataset. The Bartlett and Shapiro-Wilk tests were used to check the homogeneity of variance and normality, respectively. If these assumptions were not met, appropriate transformations were applied to the data. An analysis of variance (ANOVA) was then performed to test for differences among the treatments. The ANOVA model used was:

$Yijk=\mu +Ti+Ej+\left(TxE\right)ij+\epsilon ijk,$

Where Yijk is the response variable, Ti is the effect of the ith level of Cr, Ej is the effect of the jth level of Vit E, (T x E)ij is the interaction effect between the ith level of Cr and the jth level of Vit E, and ɛijk is the random error term. Tukey’s test was used to determine significant differences between treatment means at a significance level of α = 0.05.

When interactions were not observed, Tukey’s test was performed to determine significant differences between treatments for each factor individually at a significance level of α = 0.05.

RESULTS

Results of performance, glucose, and thyroid hormone levels are shown in Table 3. No significant interaction was found between dietary Cr and Vit E on the FI and BWG of birds (p > 0.05). However, a main effect of dietary Vit E levels was observed, where birds fed 150 mg/kg of Vit E had the highest FI and showed higher BWG than those fed with 0 mg/kg Vit E (p ≤ 0.01). The interaction of dietary Cr and Vit E significantly influenced the FCR of birds (p ≤ 0.05). At the 0 mg/kg Vit E level, 500 ppb Cr resulted in better FCR than 1500 ppb Cr (p ≤ 0.05). Similarly, at the 1500 ppb Cr level, better FCR was observed with 150 mg/kg of Vit E (p ≤ 0.05).

Table 3
Means of cumulative feed intake (FI), body weight gain (BWG), feed conversion ratio (FCR), serum glucose levels (Glu), and serum thyroid hormone levels triiodothyronine (T3) and thyroxine (T4) of broilers fed different dietary chromium (Cr) and vitamin E (Vit E) levels from 22 to 42 days of age.

Cr (ppb)	Vit E (mg/kg)	FI (kg/bird)	BWG (kg/bird)	FCR (kg/kg)	Glu (g/L)	T3 (µg/mL)	T4 (µg/mL)
Interaction effect of Cr and Vit E
0	0	3.03	1.84	1.67AB	221.0	114.0ab	1.09bB
0	150	3.09	1.86	1.65	208.0	95.0bB	1.48a
0	300	3.10	1.87	1.64	211.0	152.0a	1.20bB
500	0	3.07	1.89	1.61B	230.0	156.0	1.49abA
500	150	3.17	1.92	1.65	227.0	174.0A	1.61a
500	300	3.06	1.87	1.61	214.0	131.0	1.30bAB
1000	0	3.06	1.83	1.65AB	220.0	109.0	1.21bAB
1000	150	3.13	1.88	1.66	219.0	135.0AB	1.48a
1000	300	3.08	1.85	1.68	206.0	132.0	1.54aA
1500	0	3.09	1.81	1.71aA	221.0	126.0b	1.18B
1500	150	3.12	1.94	1.61b	199.0	126.0bAB	1.32
1500	300	3.03	1.85	1.68a	211.0	173.0a	1.36AB
The main effect of Cr
0	-	3.08	1.86	1.66	213.0b	120.0	1.25
500	-	3.10	1.89	1.63	224.0a	154.0	1.47
1000	-	3.09	1.85	1.67	215.0ab	125.0	1.41
1500	-	3.09	1.87	1.67	210.0b	142.0	1.29
The main effect of Vit E
-	0	3.06b	1.84b	1.66	223.0a	126.0	1.24
-	150	3.13a	1.90a	1.65	213.0b	133.0	1.47
-	300	3.07b	1.86ab	1.66	211.0b	147.0	1.35
p-Value
Cr	0.89	0.39	0.06	≤0.01	0.02	≤0.01	Cr
Vit E	≤0.01	≤0.01	0.63	≤0.01	0.09	≤0.01	Vit E
Cr x Vit E	0.39	0.31	0.03	0.07	≤0.01	0.03	Cr x Vit E
SEM	0.010	0.009	0.007	1.669	4.872	0.031	SEM

• ^a-b
  Lowercase letters represent significant differences between Vit E levels within each Cr level in the same column (Tukey’s, p ≤ 0.05).
• ^A-B
  Uppercase letters represent significant differences between Cr levels within each Vit E level in the same column (Tukey’s, p ≤ 0.05).
• SEM = Standard Error of the Mean.
• Each cage was considered the experimental unit for performance data collection (8 birds per cage).
• Glu, T3, and T4 values were based on 4 birds per cage (32 birds per treatment).

No significant interaction was found between dietary Cr and Vit E levels on serum glucose levels (p > 0.05). Diets with both levels of Vit E (150 and 300 mg/kg) resulted in lower glucose levels compared to a diet without Vit E supplementation (p ≤ 0.01).

The interaction of dietary Cr and Vit E influenced thyroid hormone levels (T3 and T4) (p ≤ 0.05). At 150 mg/kg Vit E, 500 ppb Cr increased serum T3 concentrations compared to no Cr supplementation (p≤ 0.05). At 0 ppb Cr, birds fed 300 mg/kg Vit E had higher T3 concentrations than those fed 150 mg/kg Vit E (p ≤ 0.05). Similarly, at 1500 ppb Cr, birds fed 300 mg/kg Vit E had the highest T3 concentrations (p ≤ 0.05). For serum T4, birds with 500 ppb Cr had higher concentrations than those with 0 and 1500 ppb Cr, at 0 mg/kg Vit E (p ≤ 0.05). At 300 mg/kg Vit E, supplementation of 1000 ppb Cr increased T4 concentrations compared to 0 ppb Cr (p ≤ 0.05). Differences in Vit E levels within Cr levels showed that at 0 ppb Cr, 150 mg/kg Vit E resulted in the highest T4 concentrations, while at 500 ppb Cr, 150 mg/kg Vit E had higher T4 concentrations than 300 mg/kg Vit E (p ≤ 0.05). Furthermore, at 1000 ppb Cr, both 150 and 300 mg/kg Vit E increased T4 concentrations compared to no Vit E supplementation (p ≤ 0.05).

The results of oxidative stress, immune response, and HSP70 expression are shown in Table 4. No significant interaction was found between dietary Cr and Vit E on MDA levels and relative spleen weight (p > 0.05). However, dietary Vit E levels had a main effect on MDA levels and spleen weight (p ≤ 0.05). Birds fed 150 mg/kg of Vit E had lower MDA levels than those fed 300 mg/kg Vit E, and those fed 300 mg/kg of Vit E had higher relative spleen weight than those receiving 0 mg/kg Vit E (p ≤ 0.05). Dietary Cr levels also had a main effect on MDA levels (p ≤ 0.01). Cr supplementation reduced MDA levels in muscle regardless of the level assessed. Neither dietary Cr nor Vit E influenced the relative weight of the Bursa of Fabricius (p > 0.05). A significant interaction was observed between dietary Cr and Vit E on serum H:L ratio (p ≤ 0.01). At 150 mg/kg Vit E, 1500 ppb Cr resulted in a lower H:L ratio than no Cr supplementation (p ≤ 0.05). At 300 mg/kg Vit E, a lower H:L ratio was observed with both 1000 and 1500 ppb Cr (p ≤ 0.05). Within 500 ppb Cr, both 0 and 150 mg/kg Vit E led to a lower H:L ratio (p ≤ 0.05).

Table 4
Means of malondialdehyde (MDA) concentration in muscle, the relative weight of lymphoid organs spleen and Bursa of Fabricius, heterophil-to-lymphocyte ratio (H:L) levels, and the 70 kilodalton heat shock protein (HSP 70) gene expression of broilers fed different dietary chromium (Cr) and vitamin E (Vit E) levels.

Cr (ppb)	Vit E (mg/kg)	MDA (mg/kg)	Spleen (%)	Bursa of Fabricius (%)	H:L1 ratio	HSP702
Interaction effect of Cr and Vit E
0	0	0.053	0.081	0.17	3.60	1.55B
0	150	0.052	0.080	0.13	3.54A	1.45B
0	300	0.055	0.088	0.15	4.17B	1.35AB
500	0	0.024	0.088	0.11	2.72b	1.40B
500	150	0.022	0.092	0.13	2.21bAB	1.55B
500	300	0.051	0.090	0.16	6.41aA	1.49AB
1000	0	0.019	0.070	0.15	3.45	1.54B
1000	150	0.016	0.079	0.15	2.74AB	1.81AB
1000	300	0.040	0.098	0.17	1.69C	1.72A
1500	0	0.036	0.076	0.14	1.80	2.02aA
1500	150	0.031	0.080	0.16	1.16B	2.24aA
1500	300	0.034	0.096	0.13	1.25C	1.27bB
The main effect of Cr
0	-	0.053a	0.083	0.15	3.77	1.45
500	-	0.032b	0.090	0.13	3.78	1.48
1000	-	0.025b	0.082	0.16	2.63	1.69
1500	-	0.034b	0.084	0.14	1.40	1.84
The main effect of Vit E
-	0	0.033ab	0.079b	0.14	2.89	1.63
-	150	0.030b	0.082ab	0.14	2.41	1.76
-	300	0.045a	0.093a	0.15	3.38	1.46
p-Value
Cr	≤0.01	0.57	0.24	≤0.01	≤0.01	Cr
Vit E	0.02	0.03	0.56	0.07	≤0.01	Vit E
Cr x Vit E	0.32	0.60	0.06	≤0.01	≤0.01	Cr x Vit E
SEM	0.003	0.002	0.004	0.252	0.049	SEM

• ^a-b
  Lowercase letters represent significant differences between Vit E levels within each Cr level in the same column (Tukey’s, p ≤ 0.05).
• ^A-C
  Uppercase letters represent significant differences between Cr levels within each Vit E level in the same column (Tukey’s, p ≤ 0.05).
• SEM = Standard Error of the Mean.
• ¹
  Heterophil-to-lymphocyte ratio.
• ²
  70 kilodalton heat shock protein.
• Values were based on 4 birds per cage (32 birds per treatment).

The interaction between dietary Cr and Vit E influenced HSP70 mRNA expression in muscle (p≤0.01). At 0 mg/kg Vit E, 1500 ppb Cr resulted in the highest HSP70 expression (p ≤ 0.05). Similarly, within 150 mg/kg Vit E, 1500 ppb Cr led to higher HSP70 expression compared to diets with 0 and 500 ppb Cr (p ≤ 0.05). Furthermore, within 300 mg/kg Vit E, 1500 ppb Cr led to lower HSP70 mRNA expression than 1000 ppb Cr (p≤0.05). Regarding Vit E levels within 1500 ppb Cr, 300 mg/kg Vit E supplementation resulted in the lowest HSP70 mRNA expression (p ≤ 0.05).

DISCUSSION

High-temperature conditions have negative effects on broilers, as they are sensitive to temperature-associated environmental challenges (Lara & Rostagno, 2013). Heat-stressed birds adjust their behavior and physiological processes to regulate body temperature, resulting in reduced feed intake, growth rate, and nutrient utilization (Khan et al., 2023). Our findings demonstrate that 150 mg/kg of Vit E resulted in a significant improvement in FI and BWG of broilers under HS. These results corroborate the findings of Attia et al. (2017), who reported supplementation with 100 mg/kg of α-tocopherol Vit E improved the BWG of heat-stressed birds compared to the non-supplemented group, while a combination of Vit E, Vit C, and probiotics had a synergistic effect, improving both BWG and FI. The beneficial effects of Vit E on the performance of heat-stressed broilers can be attributed to its antioxidant properties, protecting cellular membranes against oxidative damage (Shakeri et al., 2020). Moreover, in the present study, the combination of 150 mg/kg of Vit E with 1500 ppb of Cr demonstrated an improvement in the FCR of heat-stressed birds. Cr supplementation also exhibits positive effects on FI, BWG, and FCR in heat-stressed birds, which can be attributed to its ability to alleviate the detrimental effects of high temperatures (Piray & Foroutanifar, 2022).

In the present study, supplementation with Cr affected glucose concentration. Blood glucose concentration is dependent on insulin levels. HS leads to an increase in circulating concentrations of corticosterone, which reduces insulin sensitivity and glucose uptake (Zhao et al., 2009). Numerous studies have focused on the molecular mechanisms through which Cr can alleviate insulin resistance and regulate glucose homeostasis. These mechanisms primarily involve the modulation of insulin receptor phosphorylation, activation of kinases, and regulation of glucose transporters, leading to improved insulin sensitivity and glucose control. It is reported that Cr enhances the insulin sensibility of tissues by binding to apochromodulin to form chromodulin, a low molecular weight oligopeptide that activates tyrosine kinase in insulin receptors (Vincent, 2001). Furthermore, Cr supplementation (Cr-picolinate and Cr-histidinate) may enhance the expression of glucose transporters such as GLUT1 and GLUT4 in tissues (Ozdemir et al., 2017), and reduce corticosterone levels in birds under HS (Sahin et al., 2003). Therefore, dietary Cr levels may alleviate the adverse impact caused by HS on glucose homeostasis (Wang et al., 2022). In the present study, Vit E deficiency led to increased blood glucose levels, while supplementation with 150 and 300 mg/kg of Vit E resulted in reduced circulating glucose levels. We attribute these effects to the capacity of Vit E to increase antioxidant capacity and reduce circulating corticosterone levels, although the corticosterone was not measured in the present study. Rehman et al. (2017) also observed the beneficial effects of Vit E supplementation in reducing circulating glucose levels of heat-stressed birds, which were attributed to the antioxidant capacity of Vit E. The authors additionally reported that ginger supplementation reduced glucose levels in the serum of heat-stressed birds, further supporting the idea that antioxidants may enhance glucose uptake in challenged birds.

In the present study, the serum concentrations of T3 and T4 were influenced by the combination of Cr and Vit levels. Individual results can be attributed to the role of Cr and Vit E in mitigating the negative effects of HS. Broiler chickens employ diverse adaptive mechanisms to survive in HS conditions, and metabolic adaptation is a vital strategy for reducing heat production (Seijan et al., 2018). Thyroid hormones T3 and T4 are key regulators of thermogenesis and metabolism and play an important role in metabolic adaptation. During HS, the activity of the thyrotrophic axis is reduced, leading to smaller thyroid size and secretion, which in turn results in decreased serum and plasma concentrations of T3 and T4 (Khan et al., 2023). However, the dietary supplementation of Cr (Cr-picolinate) or Vit E (α-tocopherol-acetate) in birds under HS has demonstrated positive effects on increasing serum T3 and T4 concentrations by alleviating the negative effects of HS on thyroid activity (Sahin et al., 2001; Sahin et al., 2002).

Under normal physiological conditions, there is an expected equilibrium between pro-oxidant production and antioxidant defenses (Hafez et al., 2022). However, birds exposed to HS have been shown to disrupt this balance by inducing oxidative stress, leading to an increase in reactive oxygen species (ROS) and lipid peroxidation (Emami et al., 2021; Khan et al., 2023). MDA, a key end-product of lipid peroxidation, is a commonly used biomarker to measure oxidative stress levels, with increased levels indicating higher oxidative damage to mitochondrial phospholipids (Rahmani et al., 2017). Our findings demonstrate that dietary supplementation of Cr was effective in alleviating oxidative stress by reducing MDA concentrations in the muscles of heat-stressed birds. The beneficial effect of Cr in reducing MDA concentration may be attributed to its role as a cofactor of insulin, promoting lipid storage in the liver and inhibiting the mobilization of lipids, thereby reducing MDA levels (Sahin et al., 2004). Moreover, Cr is postulated to have antioxidant functions by stabilizing the red cell membrane against cellular changes caused by peroxidation (Sahin et al., 2003). Another way in which Cr acts as an antioxidant is through the activation of the nuclear factor erythroid 2-related factor 2 (Nrf2). Nrf2 is a transcription regulatory protein of genes involved in the antioxidant capacity of cells, stimulating the production of antioxidant enzymes (Kim et al., 2010). Additionally, Cr may alleviate the negative effects of HS by reducing the synthesis and secretion of corticosteroids. Previous studies have shown that dietary Cr supplementation (Cr-picolinate) decreases serum MDA concentrations in broiler chickens under HS conditions (Sahin et al., 2003). Moreover, dietary Cr supplementation (Cr-histidinate or Cr-propionate) has been found to decrease serum and egg yolk MDA concentrations in other avian species such as laying quails and ducks under HS conditions (Akdemir et al., 2015; Chen et al., 2021).

The H:L ratio is considered a reliable indicator of stress levels in avian species, as it reflects changes in the heterophil and lymphocyte populations that are particularly sensitive to stressors such as the adrenocorticotropic hormone (ACTH) (Gross and Siegel, 1983; Selvam et al., 2017). HS stimulates the hypothalamic production of corticotrophin-releasing factor, which leads to an increase in circulating ACTH and a subsequent rise in corticosterone production from the adrenal gland (Bahrami et al., 2012). This contributes to the increase of the H:L ratio in broiler chickens. Our findings demonstrate that dietary supplementation with a combination of Cr and Vit E at 1500 ppb and 300 mg/kg, respectively, resulted in a lower H:L ratio in broiler chickens under HS conditions. This indicates that both Cr and Vit E alleviate the immunosuppression associated with HS. Although the accurate mechanism by which Cr improves the immune system is not yet fully elucidated, it is thought to be through the reduction of corticosterone levels (Hamidi et al., 2022). Vit E also modulates inflammatory signaling by stimulating glutathione peroxidase activity in circulating heterophils and macrophages, and promoting increased activity of T lymphocytes, resulting in increased phagocytic activity and antibody production (Silva et al., 2011). Previous studies have shown that dietary supplementation with either Cr (Uyanik et al., 2002; Toghyani et al., 2007; Ghazi et al., 2012) or Vit E (Rehman et al., 2017; Selvam et al., 2017) decreases the serum H:L ratio in broiler chickens, supporting the positive effects of both Cr and Vit E on enhancing immune function. The enhancement of immune functions can also be observed through the relative weight of lymphoid organs. Although the treatment did not affect the relative weight of the Bursa of Fabricius in the present study, the dietary supplementation of Vit E resulted in a greater relative weight of the spleen. HS may cause oxidative damage and release corticosterone in birds, leading to an involution of lymphoid tissue (Laganá et al., 2007; Chand et al., 2014). Moreover, HS conditions may decrease lymphoid organ weights, possibly due to a reduction in feed intake that leads to fewer nutrients available for the proper development of these organs (Bartlett and Smith, 2003). As previously mentioned, Vit E has antioxidant properties that protect cell membranes from oxidative damage, and contributes to reducing circulating corticosterone levels in the blood. Singh et al. (2006) reported that the spleen and thymus weight was greater when broilers were fed diets with 200 mg/kg of Vit E (tocopheryl acetate), whereas the bursal weight was greater when birds were fed diets with 100 mg/kg of Vit E.

HSP70 is widely recognized as an optimal molecular biomarker for quantifying heat stress response, as its expression patterns are fundamental for thermo-tolerance at the cellular level in animals (Hao et al., 2016; Seijan et al., 2018; Aengwanich et al., 2022). It is expected that animals under heat stress challenges would exhibit higher expression of HSP70 mRNA, as this protein significantly improves the heat tolerance of cells. This is accomplished by inhibiting oxygen free radicals from binding to death receptors and activating mitochondrial signaling pathways, ultimately suppressing apoptosis (Shilja et al., 2016; Yu et al., 2021). In the present study, although we observed an overall increase in HSP70 mRNA expression as the combination of Cr and Vit E levels increased when 1500 ppb Cr was combined with 300 mg/kg Vit E, a lower HSP70 mRNA expression was observed in heat-stressed birds, indicating the highest level of both Cr and Vit E can alleviate HS responses in broilers. Previous studies reported the effects of dietary Cr or Vit E levels on the downregulation of HSP70 mRNA expression in birds under HS. Calik et al. (2022) observed lower HSP70 mRNA expression in heat-stressed broilers fed with Vit E (α-tocopherol) and selenium compared to those without supplementation. Similarly, Rajkumar et al. (2017) documented a reduced relative mRNA expression of HSP70 in the muscle and spleen of broilers exposed to HS when treated with organic trace minerals (Cr, selenium, and zinc), with Cr specifically demonstrating a pronounced effect in downregulating HSP70 expression. Moreover, the downregulation of HSP70 mRNA expression was also observed in Japanese quails exposed to HS, where the supplementation of increasing levels of Cr up to 800 ppb resulted in a decreased HSP70 mRNA expression (Akdemir et al., 2015). The decrease in HSP70 expression observed when birds were fed with either dietary Cr or Vit E could be attributed to the attenuation of the deleterious effects caused by HS. As discussed, Cr and Vit E, whether administered individually or in combination, can alleviate the impacts of HS through various mechanisms, including enhancing the antioxidant capacity of birds and reducing the production of reactive oxygen species (ROS) (Dalólio et al., 2018). The findings of this study highlight the potential of the use of dietary Vit E and Cr as a strategy to mitigate the adverse effects of HS in broiler production, especially for producers in regions with consistently high temperatures such as tropical countries.

CONCLUSION

This study highlights the beneficial effects of dietary Cr and Vit E, both individually and in combination, on broiler chickens under HS. Notably, the combination of 1500 ppb of Cr with 150 mg/kg of Vit E improved performance, glucose levels, and oxidative stress markers, while the combination with 300 mg/kg of Vit E enhanced immune response and HSP70 mRNA expression. These findings indicate that nutritional strategies can successfully alleviate the effects of HS in poultry. However, due to the complexity of evaluating mineral and vitamin interactions, further studies are needed to better understand the mechanisms by which Cr and Vit E affect broilers under HS.

ACKNOWLEDGEMENTS

In memory of Professor Luiz Fernando Teixeira Albino, whose name and legacy are synonymous with excellence and passion for animal nutrition, we express our gratitude and respect. His tireless dedication to research and his commitment to excellence have inspired and continue to inspire generations of students and professionals, constantly pursuing innovation and excellence in the field. In addition to his remarkable academic career, Professor Albino will be remembered for his generosity, empathy, and kindness. His exemplary character and willingness to share knowledge were true sources of inspiration for all who had the privilege of knowing him. His legacy will continue to guide and inspire those who follow in his footsteps. His memory will live forever in our hearts and the history of animal nutrition. We thank Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for the financial support provided - Finance Code 001.

REFERENCES

• Aengwanich W, Wandee J. The effect of increased ambient temperature on Hsp70, superoxide dismutase, nitric oxide, malondialdehyde, and caspase activity in relation to the intrinsic and extrinsic apoptosis pathway of broiler blood cells. Journal of Thermal Biology 2022;105:103211. https://doi.org/10.1016/j.jtherbio.2022.103211
  » https://doi.org/10.1016/j.jtherbio.2022.103211
• Akdemir F, Sahin N, Orhan C, et al. Chromium-histidinate ameliorates productivity in heat-stressed Japanese quails through reducing oxidative stress and inhibiting heat-shock protein expression. British Poultry Science 2015;56(2):247-54. https://doi.org/10.1080/00071668.2015.1008992
  » https://doi.org/10.1080/00071668.2015.1008992
• Attia YA, Al-Harthi MA, El-Shafey AS, et al. Enhancing Tolerance of Broiler Chickens to Heat Stress by Supplementation with Vitamin E, Vitamin C and/or Probiotics. Annals of Animal Science 2017;17(4):1155-69. https://doi.org/10.1515/aoas-2017-0012
  » https://doi.org/10.1515/aoas-2017-0012
• Bahrami A, Moeini MM, Ghazi SH, et al. The effect of different levels of organic and inorganic chromium supplementation on immune function of broiler chicken under heat-stress conditions. Journal of Applied Poultry Research 2012;21(2):209-15. https://doi.org/10.3382/japr.2010-00275
  » https://doi.org/10.3382/japr.2010-00275
• Bartlett JR, Smith MO. Effects of different levels of zinc on the performance and immunocompetence of broilers under heat stress. Poultry Science 2003;82(10):1580-8. https://doi.org/10.1093/ps/82.10.1580
  » https://doi.org/10.1093/ps/82.10.1580
• Calik A, Emami NK, Schyns G, et al. Influence of dietary vitamin E and selenium supplementation on broilers subjected to heat stress. Part II: oxidative stress, immune response, gut integrity, and intestinal microbiota. Poultry Science 2022;101(6):101858. https://doi.org/10.1016/j.psj.2022.101858
  » https://doi.org/10.1016/j.psj.2022.101858
• Chand N, Naz S, Khan A, et al. Performance traits and immune response of broiler chicks treated with zinc and ascorbic acid supplementation during cyclic heat stress. International Journal of Biometeorology 2014;58(10):2153-7. https://doi.org/10.1007/s00484-014-0815-7
  » https://doi.org/10.1007/s00484-014-0815-7
• Chen XL, Zeng YB, Liu LX, et al. Effects of dietary chromium propionate on laying performance, egg quality, serum biochemical parameters and antioxidant status of laying ducks under heat stress. Animal 2021;15(2):100081. https://doi.org/10.1016/j.animal.2020.100081
  » https://doi.org/10.1016/j.animal.2020.100081
• Dalólio FS, Albino LFT, Lima HJD, et al. Heat stress and vitamin E in diets for broilers as a mitigating measure. Acta Scientiarum 2015;37:419-27. https://doi.org/10.4025/actascianimsci.v37i4.27456
  » https://doi.org/10.4025/actascianimsci.v37i4.27456
• Dalólio FS, Albino LFT, Silva JN, et al. Dietary chromium supplementation for heat-stressed broilers. World's Poultry Science Journal 2018;74(1):101-16. https://doi.org/10.1017/S0043933917001064
  » https://doi.org/10.1017/S0043933917001064
• Emami NK, Jung U, Voy B, et al. Radical Response: Effects of Heat Stress-Induced Oxidative Stress on Lipid Metabolism in the Avian Liver. Antioxidants 2021;10(1):35. https://doi.org/10.3390/antiox10010035
  » https://doi.org/10.3390/antiox10010035
• Ghazi SH, Habibian M, Moeini MM, et al. Effects of different levels of organic and inorganic chromium on growth performance and immunocompetence of broilers under heat stress. Biological Trace Element Research 2012;146(3):309-17. https://doi.org/10.1007/s12011-011-9260-1
  » https://doi.org/10.1007/s12011-011-9260-1
• Gross WB, Siegel HS. Evaluation of the heterophil/lymphocyte ratio as a measure of stress in chickens. Avian Diseases 1983;27(4):972-9. http://dx.doi.org/10.2307/1590198
  » http://dx.doi.org/10.2307/1590198
• Hafez MH, El-Kazaz SE, Alharthi B, et al. The impact of curcumin on growth performance, growth-related gene expression, oxidative stress, and immunological biomarkers in broiler chickens at different stocking densities. Animals 2022;12(8):958. https://doi.org/10.3390/ani12080958
  » https://doi.org/10.3390/ani12080958
• Hamidi O, Chamani M, Ghahri H, et al. Effects of supplemental chromium nanoparticles on ifn-? expression of heat stress broilers. Biological Trace Element Research 2022;200(1):339-47. https://doi.org/10.1007/s12011-021-02634-0
  » https://doi.org/10.1007/s12011-021-02634-0
• Hao Y, Feng Y, Yang P, et al. Transcriptome analysis reveals that constant heat stress modifies the metabolism and structure of the porcine longissimus dorsi skeletal muscle. Molecular Genetics and Genomics 2016;291(6):2101-15. https://doi.org/10.1007/s00438-016-1242-8
  » https://doi.org/10.1007/s00438-016-1242-8
• He S, Arowolo M, Medrano R, et al. Impact of heat stress and nutritional interventions on poultry production. World's Poultry Science Journal 2018;74(4):647-64. https://doi.org/10.1017/S0043933918000727
  » https://doi.org/10.1017/S0043933918000727
• Khan RU, Naz S, Ullah H, et al. Physiological dynamics in broiler chickens under heat stress and possible mitigation strategies. Animal Biotechnology 2023;34(2):438-47. https://doi.org/10.1080/10495398.2021.1972005
  » https://doi.org/10.1080/10495398.2021.1972005
• Kim J, Cha YN, Surh YJ. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders. Mutation Research 2010;690(1-2):12-23. https://doi.org/10.1016/j.mrfmmm.2009.09.007
  » https://doi.org/10.1016/j.mrfmmm.2009.09.007
• Laganá C, Ribeiro AML, González FHD, et al. Níveis dietéticos de proteína e gordura e parâmetros bioquímicos, hematológicos e empenamento em frangos de corte estressados pelo calor. Revista Brasileira de Zootecnia 2007;36(6):1783-90. https://doi.org/10.1590/S1516-35982007000800011
  » https://doi.org/10.1590/S1516-35982007000800011
• Lara LJ, Rostagno MH. Impact of heat stress on poultry production. Animals 2013;3(2):356-69. https://doi.org/10.3390/ani3020356
  » https://doi.org/10.3390/ani3020356
• Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25(4):402-8. https://doi.org/10.1006/meth.2001.1262
  » https://doi.org/10.1006/meth.2001.1262
• Ozdemir O, Tuzcu M, Sahin N, Orhan C, et al. Organic chromium modifies the expression of orexin and glucose transporters of ovarian in heat-stressed laying hens. Cellular and Molecular Biology 2017;63(10):93-8. https://doi.org/10.14715/cmb/2017.63.10.15
  » https://doi.org/10.14715/cmb/2017.63.10.15
• Piray A, Foroutanifar S. Chromium supplementation on the growth performance, carcass traits, blood constituents, and immune competence of broiler chickens under heat stress: a systematic review and dose-response meta-analysis. Biological Trace Element Research 2022;200(6):2876-88. https://doi.org/10.1007/s12011-021-02885-x
  » https://doi.org/10.1007/s12011-021-02885-x
• R Core Team. R: A language and environment for statistical computing. Vienna: R Foundation for Statistical Computing; 2022. Available from: https://www.R-project.org/
• Rahmani M, Golian A, Kermanshahi H, et al. Effects of curcumin or nanocurcumin on blood biochemical parameters, intestinal morphology and microbial population of broiler chickens reared under normal and cold stress conditions. Journal of Applied Animal Research 2018;46(1):200-9. https://doi.org/10.1080/09712119.2017.1284077
  » https://doi.org/10.1080/09712119.2017.1284077
• Rajkumar U, Vinoth A, Pradeep, et al. Effect of supplemental trace minerals on Hsp-70 mRNA expression in commercial broiler chicken. Animal Biotechnology 2018;29(1):20-5. https://doi.org/10.1080/10495398.2017.1287712
  » https://doi.org/10.1080/10495398.2017.1287712
• Rehman ZU, Chand N, Khan RU. The effect of vitamin E, L-carnitine, and ginger on production traits, immune response, and antioxidant status in two broiler strains exposed to chronic heat stress. Environmental Science and Pollution Research 2017;24(34):26851-7. https://doi.org/10.1007/s11356-017-0304-8
  » https://doi.org/10.1007/s11356-017-0304-8
• Rosmini MR, Perlo F, Pérez-Alvarez JA, et al. TBA test by an extractive method applied to 'paté'. Meat Science 1996;42(1):103-10. https://doi.org/10.1016/0309-1740(95)00010-0
  » https://doi.org/10.1016/0309-1740(95)00010-0
• Rostagno HS. Brazilian tables for poultry and swine. 4th ed. Viçosa (MG): UFV/Department of Animal Science; 2017.
• Saeed M, Abbas G, Alagawany M, et al. Heat stress management in poultry farms: a comprehensive overview. Journal of Thermal Biology 2019;84:414-25. https://doi.org/10.1016/j.jtherbio.2019.07.025
  » https://doi.org/10.1016/j.jtherbio.2019.07.025
• Sahin K, Onderci M, Sahin N, et al. Effects of dietary combination of chromium and biotin on egg production, serum metabolites, and egg yolk mineral and cholesterol concentrations in heat-distressed laying quails. Biological Trace Element Research 2004;101(2):181-92. https://doi.org/10.1385/BTER:101:2:181
  » https://doi.org/10.1385/BTER:101:2:181
• Sahin K, Sahin N, Kucuk O. Effects of chromium and ascorbic acid supplementation on growth, carcass traits, serum metabolites, and antioxidant status of broiler chickens reared at a high ambient temperature (32°C). Nutrition Research 2003;23(2):225-38. https://doi.org/10.1016/S0271-5317(02)00513-4
  » https://doi.org/10.1016/S0271-5317(02)00513-4
• Sahin K, Sahin N, Sari M, et al. Effects of vitamins E and A supplementation on lipid peroxidation and concentration of some mineral in broilers reared under heat stress (32°C). Nutrition Research 2002;22(6):723-31. https://doi.org/10.1016/S0271-5317(02)00376-7
  » https://doi.org/10.1016/S0271-5317(02)00376-7
• Sahin N, Sahin K, Küçük O. Effects of vitamin E and vitamin A supplementation on performance, thyroid status and serum concentrations of some metabolites and minerals in broilers reared under heat stress (32°C). Veterinární Medicína 2001;46(11):286-92. https://doi.org/10.17221/7894-vetmed
  » https://doi.org/10.17221/7894-vetmed
• Seijan V, Bhatta R, Gaughan JB, et al. Review: adaptation of animals to heat stress. Animal 2018;12(S2):s431-s444. https://doi.org/10.1017/S1751731118001945
  » https://doi.org/10.1017/S1751731118001945
• Selvam R, Saravanakumar M, Suresh S, et al. Effect of Vitamin E Supplementation and High Stocking Density on the Performance and Stress Parameters of Broilers. Brazilian Journal of Poultry Science 2017;19(4):587-94. https://doi.org/10.1590/1806-9061-2016-0417
  » https://doi.org/10.1590/1806-9061-2016-0417
• Shakeri M, Oskoueian E, Le HH, et al. strategies to combat heat stress in broiler chickens: unveiling the roles of selenium, vitamin E and vitamin C. Veterinary Sciences 2020;7(2):71. https://doi.org/10.3390/vetsci7020071
  » https://doi.org/10.3390/vetsci7020071
• Shilja S, Sejian V, Bagath M, et al. Adaptive capability as indicated by behavioral and physiological responses, plasma HSP70 level, and PBMC HSP70 mRNA expression in Osmanabadi goats subjected to combined (heat and nutritional) stressors. International Journal of Biometeorology 2016;60(9):1311-23. https://doi.org/10.1007/s00484-015-1124-5
  » https://doi.org/10.1007/s00484-015-1124-5
• Silva I, Ribeiro AML, Canal CW, et al. Effect of vitamin E levels on the cell-mediated immunity of broilers vaccinated against coccidiosis. Brazilian Journal of Poultry Science 2011;13(1):53-6. https://doi.org/10.1590/S1516-635X2011000100008
  » https://doi.org/10.1590/S1516-635X2011000100008
• Singh H, Sodhi S, Kaur R. Effects of dietary supplements of selenium, vitamin E or combinations of the two on antibody responses of broilers. British Poultry Science 2006;47(6):714-9. https://doi.org/10.1080/00071660601040079
  » https://doi.org/10.1080/00071660601040079
• Toghyani M, Zarkesh S, Shivazad M, et al. Immune responses of broiler chicks fed chromium picolinate in heat stress condition. The Journal of Poultry Science 2007;44(3):330-4. https://doi.org/10.2141/jpsa.44.330
  » https://doi.org/10.2141/jpsa.44.330
• Traber MG, Atkinson J. Vitamin E, antioxidant and nothing more. Free Radical Biology & Medicine 2007;43(1):4-15. https://doi.org/10.1016/j.freeradbiomed.2007.03.024
  » https://doi.org/10.1016/j.freeradbiomed.2007.03.024
• Uyanik F, Atasever A, Ozdamar S, et al. Effects of dietary chromium chloride supplementation on performance, some serum parameters, and immune response in broilers. Biological Trace Element Research 2002;90(1/3):99-115. https://doi.org/10.1385/BTER:90:1-3:99
  » https://doi.org/10.1385/BTER:90:1-3:99
• Vincent JB. The bioinorganic chemistry of chromium (III). Polyhedron 2001;20(1-2):1-26. https://doi.org/10.1016/S0277-5387(00)00624-0
  » https://doi.org/10.1016/S0277-5387(00)00624-0
• Wang G, Li X, Zhou Y, et al. Effects of dietary chromium picolinate on gut microbiota, gastrointestinal peptides, glucose homeostasis, and performance of heat-stressed broilers. Animals 2022;12(7):844. https://doi.org/10.3390/ani12070844
  » https://doi.org/10.3390/ani12070844
• Yu ZQ, Tian JY, Wen J, et al. Effects of Heat Stress on Expression of Heat Shock Proteins in the Small Intestine of Wenchang Chicks. Brazilian Journal of Poultry Science 2021;23(3):1-8. https://doi.org/10.1590/1806-9061-2020-1430
  » https://doi.org/10.1590/1806-9061-2020-1430
• Zhao JP, Lin H, Jiao HC, et al. Corticosterone suppresses insulin- and NO-stimulated muscle glucose uptake in broiler chickens (Gallus gallus domesticus). Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 2009;149(3):448-54. https://doi.org/10.1016/j.cbpc.2008.10.106
  » https://doi.org/10.1016/j.cbpc.2008.10.106

• FUNDING
  No support has been received for this study.
• DATA AVAILABILITY STATEMENT
  The data that support the findings of this study are available from the corresponding author upon reasonable request.
• DISCLAIMER/PUBLISHER’S NOTE
  The published papers’ statements, opinions, and data are those of the individual author(s) and contributor(s). The editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions, or products referred to in the content.

Edited by

• Section Editor:
  Rodrigo Garófallo Garcia

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Publication Dates

• Publication in this collection
  13 Jan 2025
• Date of issue
  2024

History

• Received
  18 June 2024
• Accepted
  08 Nov 2024