Malformações do sistema nervoso central e a presença da mutação C677T-MTHFR no sangue fetal

Central nervous system malformations and the presence of the MTHFR-C677T mutation in fetal blood

Resumos

OBJETIVO: Avaliar a associação entre as malformações do sistema nervoso central (SNC) e a mutação C677T-MTHFR no sangue fetal. MÉTODOS: Foi realizado um estudo caso-controle que comparou a presença da mutação C677T-MTHFR entre 78 fetos com malformações de SNC e 100 fetos morfologicamente normais. O DNA genômico foi extraído e purificado do sangue fetal utilizando o Wizard® Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA), de acordo com o protocolo do fabricante. A reação em cadeia da polimerase (PCR, na sigla em inglês) foi realizada para a detecção da mutação C677T-MTHFR termolábil. A análise estatística descritiva foi realizada usando o teste exato de Fisher e o γ² e o teste de Wilcoxon foi utilizado para a análise univariada. Uma análise de regressão logística foi realizada para identificar as variáveis preditoras de malformações do SNC fetal. RESULTADOS: Os casos e controles foram similares quanto às características maternas, incluindo idade e paridade. A mutação C677T-MTHFR foi detectada em 20 casos (25,6%) e em 6 controles na forma heterozigota (OR 10,3; IC95% 3,3-32,2) e em 6 casos (7,7%) e em 1 controle na forma homozigota (OR 12,3; IC95% 1,3-111,1), e essas diferenças foram estatisticamente significativas. CONCLUSÃO: A presença da mutação C677T-MTHFR no sangue fetal foi consistente com maior risco de malformações de SNC, tanto na forma heterozigota quando homozigota.

Sistema nervoso central; Trombofilia; Hidrocefalia; Anencefalia; Sangue fetal; Espinha bífida


PURPOSE: To evaluate the association between central nervous system (CNS) malformations and the C677T-MTHFR mutation in fetal blood. METHODS: A case-control study was conducted to compare the MTHFR-C677T mutation detected in 78 fetuses with CNS malformations and with 100 morphologically normal fetuses. Genomic DNA was extracted and purified from fetal blood using the Wizard® Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA) according to manufacturer's protocol. The polymerase chain reaction (PCR) was used to assay the thermolabile MTHFR-C677T mutation. The γ² and the Fisher's exact tests were used for descriptive analysis and the Wilcoxon test was used for univariate analysis. Logistic regression analysis was performed to identify which variables were predictors of CNS malformation. RESULTS: Cases and controls were similar regarding maternal characteristics such as age and number of deliveries and abortions. The MTHFR-C677T mutation was detected in 20 cases (25.6%) and in 6 controls in its heterozygous form (OR 10.3; 95%CI 3.3-32.2) and in 6 cases (7.7%) and in 1 control in its homozygous form (OR 12.3; 95%CI 1.3-111.1), and the differences were statistically significant. CONCLUSION: The presence of the MTHFR-C677T mutation in fetal blood was consistent with a higher risk of CNS malformations, both in the heterozygous and homozygous forms.

Central nervous system; Thrombophilia; Hydrocephalus; Anencephaly; Fetal blood; Spina bifida


ARTIGO ORIGINAL

Malformações do sistema nervoso central e a presença da mutação C677T-MTHFR no sangue fetal

Central nervous system malformations and the presence of the MTHFR-C677T mutation in fetal blood

Renata Zaccaria SimoniI; Egle CoutoI; Ricardo BariniI; Juliana Heinrich-MoçouçahI; Welbe Oliveira BragançaII; Evelyn Regina CoutoIII; Joyce Maria Annichino BizzachiIV

IDepartamento de Tocoginecologia, Faculdade de Ciências Médicas, Universidade Estadual de Campinas – Unicamp – Campinas (SP), Brasil

IIInstituto de Biologia da Universidade Estadual de Campinas – Unicamp – Campinas (SP), Brasil

IIIServiço de Fisioterapia, Hospital de Clínicas, Universidade Estadual de Campinas – Unicamp – Campinas (SP), Brasil

IVDepartamento de Clínica Médica, Universidade Estadual de Campinas – Unicamp – Campinas (SP), Brasil

Correspondência

RESUMO

OBJETIVO: Avaliar a associação entre as malformações do sistema nervoso central (SNC) e a mutação C677T-MTHFR no sangue fetal.

MÉTODOS: Foi realizado um estudo caso-controle que comparou a presença da mutação C677T-MTHFR entre 78 fetos com malformações de SNC e 100 fetos morfologicamente normais. O DNA genômico foi extraído e purificado do sangue fetal utilizando o Wizard® Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA), de acordo com o protocolo do fabricante. A reação em cadeia da polimerase (PCR, na sigla em inglês) foi realizada para a detecção da mutação C677T-MTHFR termolábil. A análise estatística descritiva foi realizada usando o teste exato de Fisher e o γ2 e o teste de Wilcoxon foi utilizado para a análise univariada. Uma análise de regressão logística foi realizada para identificar as variáveis preditoras de malformações do SNC fetal.

RESULTADOS: Os casos e controles foram similares quanto às características maternas, incluindo idade e paridade. A mutação C677T-MTHFR foi detectada em 20 casos (25,6%) e em 6 controles na forma heterozigota (OR 10,3; IC95% 3,3–32,2) e em 6 casos (7,7%) e em 1 controle na forma homozigota (OR 12,3; IC95% 1,3–111,1), e essas diferenças foram estatisticamente significativas.

CONCLUSÃO: A presença da mutação C677T-MTHFR no sangue fetal foi consistente com maior risco de malformações de SNC, tanto na forma heterozigota quando homozigota.

Palavras-chave: Sistema nervoso central; Trombofilia; Hidrocefalia; Anencefalia; Sangue fetal; Espinha bífida

ABSTRACT

PURPOSE: To evaluate the association between central nervous system (CNS) malformations and the C677T-MTHFR mutation in fetal blood.

METHODS: A case-control study was conducted to compare the MTHFR-C677T mutation detected in 78 fetuses with CNS malformations and with 100 morphologically normal fetuses. Genomic DNA was extracted and purified from fetal blood using the Wizard® Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA) according to manufacturer's protocol. The polymerase chain reaction (PCR) was used to assay the thermolabile MTHFR-C677T mutation. The γ2 and the Fisher's exact tests were used for descriptive analysis and the Wilcoxon test was used for univariate analysis. Logistic regression analysis was performed to identify which variables were predictors of CNS malformation.

RESULTS: Cases and controls were similar regarding maternal characteristics such as age and number of deliveries and abortions. The MTHFR-C677T mutation was detected in 20 cases (25.6%) and in 6 controls in its heterozygous form (OR 10.3; 95%CI 3.3–32.2) and in 6 cases (7.7%) and in 1 control in its homozygous form (OR 12.3; 95%CI 1.3–111.1), and the differences were statistically significant.

CONCLUSION: The presence of the MTHFR-C677T mutation in fetal blood was consistent with a higher risk of CNS malformations, both in the heterozygous and homozygous forms.

Keywords: Central nervous system; Thrombophilia; Hydrocephalus; Anencephaly; Fetal blood; Spina bifida

Introdução

A prevalência das malformações congênitas é estimada em 3 a 5% dos nascidos vivos1. Dentre elas, as do sistema nervoso central (SNC) são, depois das malformações cardíacas, os defeitos mais comuns, e ocorrem em aproximadamente 21% dos casos. Os defeitos do tubo neural (DTN) são consequência de falhas de fechamento durante a quarta semana de embriogênese2. A ventriculomegalia do SNC fetal ocorre, em 60% dos casos, como resultado de malformações, tumores e lesões destrutivas; em 40% dos casos, a causa não é encontrada. É definida como aumento do átrio do ventrículo maior que 10 mm, sendo classificada em leve (10 a 15 mm), moderada (maior que 15 mm com córtex residual maior que 2 mm) e grave (córtex residual inferior a 2 mm)3.

A anencefalia é a ausência de tecido cerebral e do fechamento superior do crânio, e sua incidência no Brasil é de 18 casos por cada 10.000 nascidos vivos, taxa 50 vezes maior do que a observada em países europeus como França e Áustria4.

A espinha bífida é um defeito de linha média que leva à exposição do canal medular, e ocorre entre a terceira e a quarta semanas de gestação. Pode acometer várias regiões da medula e ter diferentes extensões e as estruturas envolvidas na malformação definem o prognóstico. Em 90% dos casos, a região afetada é a lombossacra5.

A encefalocele se apresenta como protrusão do conteúdo intracraniano por meio de um defeito ósseo. Pode ser associada a síndromes genéticas ou não, mas geralmente concorre com outras malformações. É rara, ocorrendo em 1,2 casos por 10.000 nascimentos. A mortalidade perinatal chega a 40%, e a grande maioria dos sobreviventes apresenta deficiência intelectual6.

Na porencefalia, cistos cerebrais formam cavidades que podem se comunicar com o sistema ventricular. É geralmente bilateral e simétrica, e pode estar associada com microcefalia7. A hidranencefalia representa a forma extrema de pseudoporencefalia. A causa é heterogênea e pode envolver infecção congênita ou oclusão da carótida interna. Felizmente, é rara8.

Apesar das sugestões de possível associação entre trombofilia e malformações fetais de origem vascular9, há poucos estudos em que, avaliando-se essa correlação, a hidrocefalia10 e a microcefalia11 subsequentes à trombose vascular foram descritas em relatos de caso.

A deficiência do ácido fólico é um fator de risco importante para os DTN, mas o mecanismo exato durante a embriogênese é desconhecido. A enzima metileno tetrahidrofolato redutase (MTHFR) é um componente chave no metabolismo do folato. Sua deficiência pode levar à redução da concentração sérica de folato, vitamina B12 e metionina, e aumento da homocisteína. A substituição CT no nucleotídeo 677 do gene da MTHFR permite a geração de uma enzima termolábil com atividade reduzida, a qual foi implicada na patogênese dos DTN em algumas populações12. Por essa razão, alguns pesquisadores sugeriram uma associação entre a mutação C677T-MTHFR e os DTN13,14 que, entretanto, não foi confirmada por outros autores15.

Para avaliar essa possível associação, comparamos a presença da mutação C677T-MTHFR entre fetos com malformações de SNC e fetos morfologicamente normais.

Métodos

Foi realizado um estudo caso-controle que envolveu 81 fetos com as seguintes malformações: hidrocefalia, porencefalia, hidranencefalia, espinha bífida, encefalocele e microcefalia (casos) e 100 fetos sem malformações (controles). Todos os casos foram recrutados do Serviço de Medicina Fetal da Unicamp entre 2005 e 2010 e foram submetidos à cordocentese de rotina para a realização de cariótipo. Nos fetos com cariótipo normal, o sangue obtido foi posteriormente utilizado para a pesquisa da mutação C677T-MTHFR. Em 3 dos 81 casos não foi possível obter material suficiente para a pesquisa da mutação (um caso de hidranencefalia, um de espinha bífida e um de encefalocele), e eles foram excluídos. Restaram 78 casos.

O sangue de 100 fetos sem malformações do Banco de Sangue de Cordão da Unicamp, obtido ao nascimento e antes da dequitação placentária, foi utilizado como controle para a pesquisa da mutação C677T-MTHFR. Para compor esse grupo, as mães foram submetidas aos seguintes critérios de exclusão: história de três ou mais abortos espontâneos, óbito fetal, tromboembolismo, hipertensão gestacional e malformações fetais. Os dados foram obtidos a partir do prontuário das mulheres e complementados por entrevista telefônica, quando necessário. Todas as doadoras de sangue de cordão haviam assinado um consentimento autorizando a utilização do sangue em pesquisas éticas.

No grupo de casos, os dados sobre idade, paridade e antecedente de malformação fetal das gestantes foram obtidos por entrevista direta no dia da cordocentese. O número de filhos vivos foi considerado até 48 horas após o parto. Todas elas foram informadas sobre os objetivos e métodos do estudo, e assinaram o Termo de Consentimento Livre e Esclarecido.

Este estudo foi aprovado pelo Comitê de Ética em Pesquisa do CAISM-UNICAMP em 18 de dezembro de 2007, sob o protocolo número 1.003/2007.

O DNA genômico foi extraído e purificado do sangue fetal por meio do Wizard® Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA), de acordo com o protocolo do fabricante para sangue total.

A pesquisa da mutação termolábil C677T-MTHFR foi realizada por reação em cadeia da polimerase (PCR). As amplificações foram feitas em reações separadas de 50 mL contendo 10 mM Tris HCl (pH 8,3), 50 mM KCl, 1,5 mM MgCl2, 0,2 mM de cada nucleosídeo trifosfato, 0,4 mM do primer frontal e reverso e 2,5 U de Taq Polimerase. Os parâmetros da PCR foram 38 ciclos a 94oC (30 seg), 54oC (30 seg) e 72oC (30 seg). O ciclo inicial foi precedido por 90 min a 94oC para ativar a AmpliTaq Gold Polimerase e desnaturar o modelo, e o último ciclo foi seguido por 5 min a 72oC. Os produtos da PCR foram digeridos com a enzima de restrição apropriada. Depois da digestão, os produtos foram submetidos à eletroforese em agar minigels a 2% contendo brometo de etídio a 120 V por 1 h. Para a MTHFR, a enzima HynfI não quebra o procuto 198-bp do alelo normal, enquanto o alelo mutante fornece fragmentos de 175 e 23 bp após a digestão do HynfI. Para cada lócus, os indivíduos heterozigotos exibiram produtos de digestão normais e digeridos. O controle do ensaio incluiu DNA de indivíduo mutante, normal e branco para cada análise.

Após a extração do DNA genômico, a região onde a mutação podia ocorrer foi amplificada. O fragmento foi amplificado em uma mistura de 54 mm Tris-HCl, pH 8,8, 5,4 mM MgCl2, 5,4 mM EDTA, 13,3 mM (NH4) 2SO4, 8% DMSO, 8 mM β-mercaptoetanol, 0,4 mg BSA/mL, 0,8 mM de cada nucleosídeo trifosfato, 400 ng de cada primer: sentido (5'-TGAAGGAGAAGGTGTCTGCGGGA-3') e contrasentido (AGGACGGTGCGGTGAGAGTG 5'-3'), 500 ng de DNA genômico e 2 U da enzima Taq Polimerase. A reação envolveu 30 ciclos de incubação a 94° C (1 min), 55°C (1 min) e 72°C (2 min). Um fragmento de 198 pares de base foi obtido e 10–15 µL do material amplificado foram digeridos com 0,5 U da enzima HynfI. Após a digestão, o alelo mutante (677T) forneceu dois fragmentos de 175 e 23 pares de base, observados em gel de agarose. Quando o alelo normal (677T) estava presente, não apareceu local de restrição para a enzima e apenas um fragmento de 198 bp foi observado.

Foi realizada uma análise descritiva por grupo, considerando a associação entre cada uma das variáveis e o grupo, utilizando o γ2 e o teste exato de Fisher. A análise univariada foi utilizada para comparar cada variável por grupo e identificar aquelas que poderiam ser discriminatórias (nível de significância de 20%) para a variável resposta de interesse (malformação), usando o teste de Wilcoxon para amostras independentes. Elas foram avaliadas quanto à correlação entre si, e a análise de regressão logística foi realizada para identificar quais eram preditoras de malformação do SNC. O nível de significância foi de 5% e o software utilizado foi o SAS versão 9.1.3. O poder do teste foi de pelo menos 80% para a comparação entre os grupos.

Resultados

Os casos e controles foram similares quanto à etnia das gestantes, história de abortos e número de partos. O número de filhos vivos foi significativamente mais baixo nas mulheres do grupo casos, mas ter pelo menos um filho vivo foi critério de inclusão para o grupo controle (Tabela 1). A história de óbito fetal foi encontrada em 23% das mulheres do grupo casos, e a ausência desse antecedente foi critério de inclusão para o grupo controle.

A mutação C677T-MTHFR foi distribuída de acordo com os diferentes tipos de malformação conforme se segue: hidrocefalia: 32 CC (homozigoto normal), 12 CT (heterozigoto) e 3 TT (homozigoto mutante); anencefalia: 11 CC, 5 CT e 1 TT. Quatro fetos com encefalocele eram CC e dois eram CT. O genótipo normal (CC) foi também visto em um feto com porencefalia, um com hidranencefalia, dois com espinha bífida e um com microcefalia. O genótipo CT (heterozigoto) foi encontrado em um feto com espinha bífida, assim como um TT (homozigoto mutante). Esse último genótipo também foi encontrado em um feto com microcefalia. No total, foram 52 fetos CC, 20 fetos CT e 6 fetos TT.

Os resultados da comparação da mutação ­C677T-MTHFR entre os dois grupos podem ser vistos na Tabela 2. A mutação foi encontrada em 26 casos e em 7 controles. Uma diferença significativa entre os grupos foi vista para as duas formas da mutação, homozigota e heterozigota.

A análise multivariada mostrou o risco de malformações do SNC de acordo com o resultado da mutação ­C677T-MTHFR no sangue fetal. O nível de significância para ser incluído nesta análise foi de 20%, e os resultados podem ser vistos na Tabela 3. O risco de um feto CT ­(heterozigoto) ter uma malformação do SNC foi dez vezes maior do que o risco de um feto CC (homozigoto normal). Da mesma forma, o risco de um feto TT (homozigoto mutante) foi 12 vezes maior. Quando comparamos a mutação heterozigota e homozigota, não houve diferença significativa.

Discussão

A etiologia das malformações do SNC, especialmente dos DTN, é multifatorial e envolve fatores genéticos e ambientais, com suas complexas interações9. Vários estudos mostraram que a variante termolábil da MTHFR tem atividade enzimática, e foi associada a níveis plasmáticos elevados de menor homocisteína, mas esse aumento foi corrigido pela suplementação de ácido fólico16,17. O folato age por meio da estabilização da enzima termolábil18,19. O folato sérico maior que 15,4 nM parece conter os efeitos da mutação20. A mutação na enzima termolábil ocorre no Exon 4 do nucleotídeo 677, no qual a citosina é substituída pela timina (T→C), resultando na substituição de alanina por valina no sítio de ligação do folato18. Na mutação homozigota, a atividade da MTHFR é reduzida a 35% do normal9.

Outro polimorfismo genético na MTHFR é a transição A→C no nucleotídeo 1298, resultando na substituição de alanina por glutamato. Essa mutação, tanto heterozigota quando homozigota, não parece induzir elevação da homocisteína plasmática. Entretanto, a combinação das mutações heterozigotas C677T e A1298C pode resultar em elevação da homocisteína plasmática21.

Várias metanálises mostraram associação entre polimorfismos no gene da MTHFR e aspectos clínicos como defeito cardíaco congênito22, destacando a mutação no feto e no pai; infarto agudo do miocárdio em caucasianos23; acidente vascular cerebral isquêmico em caucasianos24, trombose venosa cerebral25 e acidente vascular cerebral em recém-nascidos e crianças26; doença de Alzheimer em asiáticos27, tromboembolismo venoso28 e doença arterial periférica29, nefropatia diabética30 e enxaqueca com aura31.

Um forte componente vascular pode ser detectado na maioria das doenças associadas com a mutação C677T-MTHFR. Um aumento na homocisteína plasmática foi demonstrado em várias dessas séries. Entretanto, o mecanismo pela qual a mutação e/ou a hiperhomocisteinemia age na vasculatura, levando a tal impacto, não é claro. Questionamos se esses mecanismos ainda não esclarecidos poderiam agir durante o desenvolvimento embrionário e levar a malformações do SNC, como DTN ou outras malformações de origem vascular, como hidranencefalia e hidrocefalia.

Os DTN, aborto recorrente e óbito fetal foram associados com hiperhomocisteinemia17,32. Van der Put et al.5 sugeriram pela primeira vez a mutação ­C677T-MTHFR como fator de risco para DTN. Estudos mostraram prevalência mais alta da mutação em pacientes com DTN e em suas mães33,34, mas outros não encontraram associação significativa35.

Ainda não está claro se o uso de folato periconcepcional supera o desequilíbrio no metabolismo do folato e da homocisteína induzidos pela mutação na mãe e no embrião em desenvolvimento. Van der Put et al.5 notaram que o genótipo mutante na mãe e no feto contribuiu para o desenvolvimento dos DTN. Em seu estudo na população alemã, a mutação na mãe conferiu maior risco do que a mutação no feto36. Entretanto, em uma metanálise que comparou a prevalência da mutação entre grupos internacionais de pacientes, suas mães e controles, um risco discretamente maior foi conferido pela presença da mutação na criança do que na mãe37.

Em um estudo na população irlandesa33, os autores concluíram que o genótipo TT (homozigoto) no embrião produziu maior risco de DTN do que o genótipo materno, o qual isoladamente teve pequena importância. No estudo de Harisha et al.9, os resultados foram similares: a frequência da C677T homozigota foi significativamente maior em crianças afetadas por DTN do que nos controles, enquanto a diferença entre suas mães e controles não foi estatisticamente significante.

A sugestão de que a mutação homozigota no embrião e na mãe pode agir sinergicamente não é clara: alguns estudos mostraram maior risco quando há a combinação de ambas36, e outros não33. Nossos resultados mostraram prevalência significativamente mais alta da mutação C677T-MTHFR em fetos com malformações do SNC, quando comparados com fetos sem malformações. Estudos futuros poderão avaliar outras mutações no gene da MTHFR, assim como em outros genes do metabolismo do folato e da homocisteína e os DTN não preveníveis com folato, que representam aproximadamente 30% dos casos e foram associados com distúrbios do metabolismo da vitamina B12, metionina e inositol.

A avaliação da presença da mutação C677T-MTHFR em casais que têm filhos com malformações do SNC pode ajudar a estimar o risco de trombofilia fetal, de acordo com a transmissão genética, e facilitar o aconselhamento. Da mesma forma, portadores da mutação que desejam ter filhos podem ser orientados de forma mais consistente a partir dos resultados deste estudo e de estudos futuros.

Recebido: 19/09/2013

Aceito com modificações: 09/10/2013

Conflito de interesses: não há.

Trabalho realizado na Universidade Estadual de Campinas – Unicamp – Campinas (SP), Brasil.

  • 1. Sekhobo JP, Druschel CM. An evaluation of congenital malformations surveillance in New York State: an application of Centers for Disease Control and Prevention (CDC) guidelines for evaluating surveillance systems. Public Health Rep. 2001;116(4):296-305.
  • 2. Guardiola A, Koltermann V, Aguiar PM, Grossi SP, Fleck V, Pereira EC, et al. Neurological congenital malformations in a tertiary hospital in south Brazil. Arq Neuropsiquiatr. 2009;67(3B):807-11.
  • 3. Girard N, Raybaud C, Gambarelli D, Figarella-Branger D. Fetal brain MR imaging. Magn Reson Imaging Clin N Am. 2001;9(1):19-56, vii.
  • 4. Anis: Instituto de Bioética, Direitos Humanos e Gênero. Anencefalia: o pensamento brasileiro em sua pluralidade [Internet]. Brasília (DF): Anis: Instituto de Bioética, Direitos Humanos e Gênero; 2004 [citado 2011 Mar 9]. Disponível em: <http://www.anis.org.br//Arquivos/Textos/pluralidade_final.pdf>
  • 5. van der Put NM, Steegers-Theunissen RP, Frosst P, Trijbels FJ, Eskes TK, van den Heuvel LP, et al. Mutated methylenetetrahydrofolate reductase as a risk factor for spina bifida. Lancet. 1995;346(8982):1070-1.
  • 6. Agthong S, Wiwanitkit V. Encephalomeningocele cases over 10 years in Thailand: a case series. BMC Neurol. 2002;2:3.
  • 7. Cameron M, Moran P. Prenatal screening and diagnosis of neural tube defects. Prenat Diagn. 2009;29(4):402-11.
  • 8. Ramesh VG. Hydranencephaly vs hydrocephalus. Neurosurgery. 2010;67(5):E1472.
  • 9. Harisha PM, Devi BI, Christopher R, Kruthika-Vinod TP. Impact of 5,10-methylenetetrahydrofolate reductase gene polymorphism on neural tube defects. J Neurosurg Pediatr. 2010;6(4):364-7.
  • 10. Ansari SA, Hunter JV, Nassif LM, Clark GD, Ramocki MB. Bilateral in utero cerebellar infarction. J Child Neurol. 2011; 26(7):895-9.
  • 11. Ergenekon E, Gücüyener K, Atalay Y, Serdarolu A, Tali T, Koç E, et al. Neonatal cerebral venous thrombosis coexisting with bilateral adrenal hemorrhage. Indian J Pediatr. 2000;67(8):591-4.
  • 12. Eskes TK. Neural tube defects, vitamins and homocysteine. Eur J Pediatr. 1998;157 Suppl 2:S139-41.
  • 13. Dávalos IP, Olivares N, Castillo MT, Cantú JM, Ibarra B, Sandoval L, et al. The C677T polymorphism of the methylenetetrahydrofolate reductase gene in Mexican mestizo neural-tube defect parents, control mestizo and native populations. Ann Genet. 2000;43(2):89-92.
  • 14. Martínez de Villarreal LE, Delgado-Enciso I, Valdéz-Leal R, Ortíz-López R, Rojas-Martínez A, Limón-Benavides C, et al. Folate levels and N(5),N(10)-methylenetetrahydrofolate reductase genotype (MTHFR) in mothers of offspring with neural tube defects: a case-control study. Arch Med Res. 2001;32(4):277-82.
  • 15. Volcik KA, Blanton SH, Tyerman GH, Jong ST, Rott EJ, Page TZ, et al. Methylenetetrahydrofolate reductase and spina bifida: evaluation of level of defect and maternal genotypic risk in Hispanics. Am J Med Genet. 2000;95(1):21-7.
  • 16. Kang SS, Zhou J, Wong PW, Kowalisyn J, Strokosch G. Intermediate homocysteinemia: a thermolabile variant of methylenetetrahydrofolate reductase. Am J Hum Genet. 1988;43(4):414-21.
  • 17. Nelen WL, Blom HJ, Thomas CM, Steegers EA, Boers GH, Eskes TK. Methylenetetrahydrofolate reductase polymorphism affects the change in homocysteine and folate concentrations resulting from low dose folic acid supplementation in women with unexplained recurrent miscarriages. J Nutr. 1998;128(8):1336-41.
  • 18. Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG, et al. A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet. 1995;10(1):111-3.
  • 19. Rozen R. Genetic predisposition to hyperhomocysteinemia: deficiency of methylenetetrahydrofolate reductase (MTHFR). Thromb Haemost. 1997;78(1):523-6.
  • 20. Jacques PF, Bostom AG, Williams RR, Ellison RC, Eckfeldt JH, Rosenberg IH, et al. Relation between folate status, a common mutation in methylenetetrahydrofolate reductase, and plasma homocysteine concentrations. Circulation. 1996;93(1):7-9.
  • 21. van der Put NM, Gabreëls F, Stevens EM, Smeitink JA, Trijbels FJ, Eskes TK, et al. A second common mutation in the methylenetetrahydrofolate reductase gene: an additional risk factor for neural-tube defects? Am J Hum Genet. 1998;62(5):1044-51.
  • 22. Yin M, Dong L, Zheng J, Zhang H, Liu J, Xu Z. Meta analysis of the association between MTHFR C677T polymorphism and the risk of congenital heart defects. Ann Hum Genet. 2012;76(1):9-16.
  • 23. Xuan C, Bai XY, Gao G, Yang Q, He GW. Association between polymorphism of methylenetetrahydrofolate reductase (MTHFR) C677T and risk of myocardial infarction: a meta-analysis for 8,140 cases and 10,522 controls. Arch Med Res. 2011;42(8):677-85.
  • 24. Yu HH, Zhang WL, Shi JP. [Relationship between methylenetetrahydrofolate reductase gene C677T polymorphism and susceptibility of ischemic stroke: a meta-analysis]. Zhonghua Yi Xue Za Zhi. 2011;91(29):2060-4. Chinese.
  • 25. Marjot T, Yadav S, Hasan N, Bentley P, Sharma P. Genes associated with adult cerebral venous thrombosis. Stroke. 2011;42(4):913-8.
  • 26. Kenet G, Lütkhoff LK, Albisetti M, Bernard T, Bonduel M, Brandao L, et al. Impact of thrombophilia on risk of arterial ischemic stroke or cerebral sinovenous thrombosis in neonates and children: a systematic review and meta-analysis of observational studies. Circulation. 2010;121(16):1838-47.
  • 27. Hua Y, Zhao H, Kong Y, Ye M. Association between the MTHFR gene and Alzheimer's disease: a meta-analysis. Int J Neurosci. 2011;121(8):462-71.
  • 28. Gohil R, Peck G, Sharma P. The genetics of venous thromboembolism. A meta-analysis involving approximately 120,000 cases and 180,000 controls. Thromb Haemost. 2009;102(2):360-70.
  • 29. Khandanpour N, Willis G, Meyer FJ, Armon MP, Loke YK, Wright AJ, et al. Peripheral arterial disease and methylenetetrahydrofolate reductase (MTHFR) C677T mutations: a case-control study and meta-analysis. J Vasc Surg. 2009;49(3):711-8.
  • 30. Zintzaras E, Uhlig K, Koukoulis GN, Papathanasiou AA, Stefanidis I. Methylenetetrahydrofolate reductase gene polymorphism as a risk factor for diabetic nephropathy: a meta-analysis. J Hum Genet. 2007;52(11):881-90.
  • 31. Rubino E, Ferrero M, Rainero I, Binello E, Vaula G, Pinessi L. Association of the C677T polymorphism in the MTHFR gene with migraine: a meta-analysis. Cephalalgia. 2009;29(8):818-25.
  • 32. Wouters MG, Boers GH, Blom HJ, Trijbels FJ, Thomas CM, Borm GF, et al. Hyperhomocysteinemia: a risk factor in women with unexplained recurrent early pregnancy loss. Fertil Steril. 1993;60(5):820-5.
  • 33. Shields DC, Kirke PN, Mills JL, Ramsbottom D, Molloy AM, Burke H, et al. The "thermolabile" variant of methylenetetrahydrofolate reductase and neural tube defects: an evaluation of genetic risk and the relative importance of the genotypes of the embryo and the mother. Am J Hum Genet. 1999;64(4):1045-55.
  • 34. Rampersaud E, Melvin EC, Siegel D, Mehltretter L, Dickerson ME, George TM, et al. Updated investigations of the role of methylenetetrahydrofolate reductase in human neural tube defects. Clin Genet. 2003;63(3):210-4.
  • 35. González-Herrera L, García-Escalante G, Castillo-Zapata I, Canto-Herrera J, Ceballos-Quintal J, Pinto-Escalante D, et al. Frequency of the thermolabile variant C677T in the MTHFR gene and lack of association with neural tube defects in the State of Yucatan, Mexico. Clin Genet. 2002;62(5):394-8.
  • 36. van der Put NM, van den Heuvel LP, Steegers-Theunissen RP, Trijbels FJ, Eskes TK, Mariman EC, et al. Decreased methylene tetrahydrofolate reductase activity due to the 677CT mutation in families with spina bifida offspring. J Mol Med (Berl). 1996;74(11):691-4.
  • 37. van der Put NM, Eskes TK, Blom HJ. Is the common 677C T mutation in the methylenetetrahydrofolate reductase gene a risk factor for neural tube defects? A meta-analysis. QJM. 1997;90(2):111-5.

  • Correspondência:
    Egle Couto
    Avenida Alexander Flemming, 101
    Cidade Universitária Zeferino Vaz
    CEP: 13083-970
    Campinas (SP), Brasil

Datas de Publicação

  • Publicação nesta coleção
    09 Dez 2013
  • Data do Fascículo
    Out 2013

Histórico

  • Recebido
    19 Set 2013
  • Aceito
    09 Out 2013
Federação Brasileira das Sociedades de Ginecologia e Obstetrícia Av. Brigadeiro Luís Antônio, 3421, sala 903 - Jardim Paulista, 01401-001 São Paulo SP - Brasil, Tel. (55 11) 5573-4919 - Rio de Janeiro - RJ - Brazil
E-mail: editorial.office@febrasgo.org.br