Molecular detection of Ehrlichia canisin dogs from the Pantanal of Mato Grosso State, Brazil

Detecção molecular de Ehrlichia canis em cães do Pantanal do Mato Grosso, Brasil

Abstracts

The present study evaluated the presence of EhrlichiaDNA in the blood samples of 320 dogs from the urban and rural areas of the municipality of Poconé, Pantanal region, Mato Grosso state, by Polymerase Chain Reaction (PCR), targeting the ehrlichial dsbgene. Risk factors for infection in dogs were also evaluated. Forty-eight (15%, 95% CI: 11.4-19.5%) dogs were positive: 25 (15.6%, 95% CI: 10.4-22.2%) from the urban area and 23 (14.4%, 95% CI: 9.3-20.8%) from the rural area (P > 0.05). Partial DNA sequence obtained from PCR products of 18 samples from the urban area and 16 samples from the rural area were 100% identical to E. canis from Brazil and the USA. This study reports the first E. canis molecular detection in dogs from the northern Pantanal region.

Dogs; tick borne disease; Ehrlichia canis ; Anaplasmataceae; Poconé; Brazil

O presente estudo avaliou a presença de DNA deEhrlichia spp. em 320 cães das áreas urbana e rural do município de Poconé, região do Pantanal de Mato Grosso, pela PCR visando o gene dsb. Os fatores de risco para a infecção em cães também foram avaliados. Quarenta e oito (15%, IC 95%: 11,4-19,5%) cães foram positivos, 25 (15,6%, IC 95%: 10,4-22,2%) da área urbana e 23 (14,37%, 95% CI: 9,3-20,8%) da área rural (P > 0,05). Sequências parciais de DNAs obtidos a partir de produtos da PCR de 18 amostras da área urbana e 16 da área rural foram 100% idênticas a E. canis do Brasil e EUA. Este estudo relata a primeira detecção molecular deE. canis em cães da região norte do Pantanal.

Cães; ectoparasitos; Ehrlichia canis ; Anaplasmataceae; Poconé; Brasil

Introduction

Bacteria of the genus Ehrlichia are tick-borne agents that cause significant diseases in domestic animals (McBRIDE; WALKER, 2010; DUMLER et al., 2001). In Brazil, Ehrlichia canis is the agent of canine monocytic ehrlichiosis (CME), a canine disease of nearly worldwide distribution, transmitted by the tick Rhipicephalus sanguineus (HARRUS; WANER, 2011; VIEIRA et al., 2011). In North America, dogs can also be infected by Ehrlichia chaffeensis and Ehrlichia ewingii, which are important agents of zoonoses vectored by Amblyomma ticks in that continent (McBRIDE; WALKER, 2010).

Some studies emphasized the possibility that Ehrlichiaspecies other than E. canis are circulating in Brazil, especially in the Pantanal area, a large periodically wetland area of Brazil that harbors high diversity of mammals and ticks (ALHO et al., 1987; BECHARA et al., 2000).Melo et al. (2011) reported high prevalence of anti-Ehrlichia antibodies in domestic dogs from the municipality of Poconé, a northern sub-region of Pantanal. Because some of these seropositive dogs were not infested by R. sanguineus ticks (they were rather infested by Amblyomma ticks), the authors speculated on the possible occurrence of differentEhrlichia species infecting dogs in the region. In the southern area of Pantanal, Widmer et al. (2011) reported a novel ehrlichial agent (genetically related to Ehrlichia ruminantium) infecting free-living jaguars (Panthera onca) and ticks. Additionally,E. chaffeensis was molecularly detected in Brazilian marsh deers (Blastocerus dichotomus) in a wetland area borderline of Mato Grosso do Sul and São Paulo states (MACHADO et al., 2006). Other reports include molecular detection of Ehrlichia sp. in Brazilian wild captive carnivore species maintained in several zoos in Brazil (ANDRÉ et al., 2010, 2012).

Since serological tests cannot distinguish between infection by E. canis and other Ehrlichia species (KELLY et al., 1994; ALLSOPP; ALLSOPP, 2001), the present study aimed to evaluate the presence of Ehrlichia species by molecular tools in blood samples of dogs from the municipality of Poconé, Pantanal region, Brazil, where higher canine seroprevalence of Ehrlichia spp. has been recently reported (MELO et al., 2011).

Materials and Methods

1. Study site and blood collection

The study was conducted in the municipality of Poconé (16° 15′ W; 56° 37′ S), 100 km southwest of Cuiabá, the capital of Mato Grosso state. Samples were obtained between July and September 2009 by Melo et al. (2011), who evaluated the prevalence of antibodies againstRickettsia spp. and E. canis, as well as the presence of ectoparasites in dogs from the related area. In the urban areas, samples were collected from 160 dogs of all (12) neighborhoods (∼13 dogs per neighborhood), whereas in the rural areas, samples were obtained from 160 dogs of 25 farms (∼4.7 dogs per farm) and three rural communities (∼14 dogs per community; Figure 1). The blood samples were collected from the jugular vein in vacuum tubes with ethylenediamine tetraacetic acid (EDTA) and stored in 1.5 mL microtubes at –20 °C until processing. A questionnaire was given to each dog owner in order to obtain information related to age, sex, ectoparasites infestation, habitat, and hunting practice. The sample protocol was approved by the Ethics Committee for Animal Research of the Federal University of Mato Grosso (Protocol number 23108.019742∕09-9).

Figure 1.
Poconé and neighboring municipalities of Mato Grosso State, Brazil, indicating the urban area (city of Poconé), 25 farms, and 3 rural communities where dogs were sampled in the present study. In the urban area, places where positive dogs were sampled are indicated (•).

2. Nucleic acid extraction and polymerase chain reaction

DNA was extracted from blood samples in EDTA solution using an UltraClean Blood DNA Isolation kit (MO BIO Laboratories Inc., Carlsbad, CA) according to the manufacturer's instructions. The DNA samples were initially processed by a PCR protocol designed to amplify a 409-bp fragment of the dsb gene of Ehrlichia genus (LABRUNA et al., 2007) using primers 330 forward (5′ GATGATGTCTGAAGATATGAAACAAAT 3′) and 728 reverse (5′ CTGCTCGTCTATTTTACTTCTTAAAGT 3)′. In addition, samples were also tested by a heminested-PCR targeting portions of 401-bp (1st reaction) and 349-bp (2^nd reaction) of thedsb gene of all Ehrlichia species (ALMEIDA, 2011, Table 1). PCR products were analyzed by 1.5% agarose gel electrophoresis stained with ethidium bromide and examined by UV transillumination. Samples that yielded amplicon of the expected size by the above PCR protocols were subjected to a dsbreal-time PCR in order to confirm previous findings through an E. canis-specific probe assay, as previously described (DOYLE et al., 2005). In all reactions, a positive control (DNA of E. canis-infected DH82 cells) as well as three negative controls (water) were included.

Table 1.
Ehrlichia species and primer sequences^*.

Ehrlichia species (Genbank accession number)	Primer Dsb-330 (forward) 5′-3′	Primer Dsb- 720 (reverse) 5′-3′	Primer Dsb – 380 (forward) 5′ - 3′
Primer sequence	GATGATGCTTGAAGATATSAAACAAAT	CTATTTTACTTCTTAAAGTTGATAWATC	ATTTTTAGRGATTTTCCAATACTTGG
E. chaffeensis (AF403711)	A.............C..........................................	...........................................A..................	....A......................................................
E. canis (AF403710)	A.............C..........................................	................................................................	....A.....C...............................................
E. muris (AY236484)	A.............C..........................................	.........C......T......................A....................	....A.....C..................C....T...........C......
E. ruminantium (AF308669)	A.............C..........................................	................................................................	............................................................
Anan strain (AY236485)	............................................................	...........................................A..................	....A.........................C....T...........C......

• ^*
  Primers used in heminested-PCR as follows: Dsb-330 and Dsb-720, in the first reaction; Dsb–380 and Dsb-720, in the second reaction.

3. Purification and genetic sequencing

Conventional PCR products were purified using illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare Bio-Sciences) according to manufacturer's instructions and sequenced directly using the primers Dsb–380 and Dsb-720 and Big Dye Kit (Applied Biosystems), according to manufacturer's instructions in ABI-PRISM 3100 Genetic Analyzer. The sequences were edited using SeqMan software (Lasergene, DNAstar, Madison, WI USA.) and similarity was analyzed using the program Basic Local Alignment Search Tool (BLAST two sequences analysis) (ALTSCHUL et al., 1990) to check for homology with corresponding sequences available in GenBank.

4. Statistical analysis

Prevalence values were calculated with a 95% confidence interval. The association between Ehrlichia infection in dogs and the independent variables was performed by the Chi-Square test (χ²), or Fisher's exact test when necessary. In the rural area, the presence of tick species in farms was evaluated as another variable. Variables that presented P ≤ 0.05 were considered significant. The statistical software EPIINFO 7.0 was used for analysis.

Results and Discussion

Forty-eight dogs (15%; 95% CI: 11.4- 19.5%) tested positive by both PCR and heminested-PCR, targeting portions of the ehrlichial dsb gene in order to increase the diagnostic sensitivity (ALMEIDA, 2011). All 48 dogs from the urban and rural areas were shown bydsb real-time PCR to contain E. canis DNA. Partial DNA sequences (250-bp) of 34 PCR-positive samples were generated; they were identical to each other and 100% identical to the multiple corresponding E. canis sequences available in GenBank (AF403710, CP000107, DQ460715, DQ460716). Dsb gene sequence from the identified E. canis isolate in this study was deposited in GenBank and assigned the nucleotide accession number JQ419757.1.

In the urban area, 25 dogs (15.6%; 95% CI: 10.4-22.2%) were positive, whereas in the rural area 23 dogs (14.4%; CI: 9.3-20.8%) from nine farms (36.0%) and all communities (100%) were positive (Table 2). However, no statistical difference for E. canis positivity between urban and rural dogs was observed (P > 0.05). Similar results were observed in the previous study by Melo et al. (2011), who detected, by IFAT, positive reaction againstEhrlichia spp. in 227 (70.9%) dogs: 119 (74.3%) from urban areas and 108 (67.5%) from rural areas (P > 0.05). Additionally, R. sanguineuswas present in all urban neighborhoods, and was not found in only three farms of the currently PCR positive dogs (Table 2); however, the presence of R. sanguineus ticks on the dogs studied was not considered a risk factor for E. canisinfection in the farms. Nevertheless, Melo et al. (2011) reported that some of these rural dogs were frequently taken to urban or suburban environments, which may explain the positivity forE. canis regardless of the presence of R. sanguineus in the farm. On the other hand, Amblyommaspp. were associated (P < 0.05) with the presence of PCR-negative dogs in the farms, emphasizing the relevance of R. sanguineus in the transmission of E. canis to dogs (HARRUS; WANER, 2011). Breed, sex and age were not associated with PCR positivity. Melo et al. (2011), studying this same dogs, reported greater frequency of seropositive dogs as they become older, probably due to a higher chance of becoming infested with ticks over time.

Table 2.
Detection of Ehrlichia canis DNA in dogs from the Pantanal and results of serological and ticks data in the municipality of Poconé

Locality*	N°. tested dogs	Detection of Ehrlichia DNA		Number of seroreactive dogs toEhrlichia spp. (%)a	Ticks found in dogsa
		N°. positive (%)	Related species
Urban area	160	25 (15.6)	E. canis	119 (74.3)	R. sanguineus, A. cajennense
Farm 1	06	0	-	0	-
Farm 2	17	0	-	13 (76.4)	R. sanguineus, A. cajennense
Farm 3	10	0	-	7 (70.0)	A. cajennense
Farm 4	09	1 (11.1)	E. canis	8 (88.8)	R. sanguineus, A. cajennense
Farm 5	07	1 (14.2)	E. canis	7 (100.0)	R. sanguineus, A. cajennense
Farm 6	04	1 (25.0)	E. canis	3 (75.0)	R. sanguineus, A. cajennense
Farm 7	08	4 (50.0)	E. canis	7 (87.5)	R. sanguineus, A. cajennense
Farm 8	04	2 (50.0)	E. canis	4 (100.0)	-
Farm 9	04	1 (25.0)	E. canis	3 (75.0)	R. sanguineus, A. cajennense
Farm 10	06	1 (16.6)	E. canis	2 (3.3)	A. cajennense
Farm 11	04	1 (25.0)	E. canis	2 (50.0)	-
Farm 12	04	0	-	2 (50.0)	R. sanguineus
Farm 13	02	0	-	1 (50.0)	R. sanguineus
Farm 14	02	0	-	0	R. sanguineus
Farm 15	05	2 (40.0)	E. canis	5 (100.0)	R. sanguineus
Farm 16	05	0	-	4 (80.0)	A. cajennense
Farm 17	02	0	-	2 (100.0)	-
Farm 18	01	0	-	0	A. cajennense
Farm 19	03	0	-	0	A. cajennense
Farm 20	02	0	-	2 (100.0)	A. cajennense
Farm 21	03	0	-	1 (33.3)	A. cajennense
Farm 22	02	0	-	1 (50.0)	A. cajennense
Farm 23	03	0	-	1 (33.3)	A. cajennense, A. ovale
Farm 24	03	0	-	2 (66.6)	A. cajennense, A. ovale
Farm 25	02	0	-	1 (50.0)	A. cajennense
Community 1	22	3 (13.6)	E. canis	12 (54.5)	R. sanguineus, A. cajennense, A. ovale
Community 2	09	2 (22.2)	E. canis	9 (100.0)	R. sanguineus, A. cajennense
Community 3	11	4 (36.3)	E. canis	9 (81.8)	R. sanguineus, A. cajennense, A. ovale

• ^a
  According to Melo et al. (2011); N° - number; % - percentage.

Despite the recent reports of ehrlichial agents other than E. canis in Brazil (MACHADO et al., 2006; SILVEIRA et al., 2012; ANDRÉ et al., 2010, 2012; SACCHI et al., 2012), molecular detection of new genotypic variants in Brazilian wildlife animals has been reported, since those animals play the role of sentinels for vector-borne pathogens because they can act as hosts for both bacteria and arthropod, including wildlife of the Pantanal region (WIDMER et al., 2011). However, the present work failed to detect Ehrlichia species different from E. canisinfecting dogs from northern Pantanal, even though we used a high sensitive PCR capable of detecting all known Ehrlichia species (LABRUNA et al., 2007). These data corroborated previous studies that reported E. canis as the onlyEhrlichia species that has been isolated in vitro from dogs in Brazil (AGUIAR et al., 2007, 2008; TORRES et al., 2002).

Acknowledgements

This work was supported by ‘Fundação de Amparo à Pesquisa do Estado de Mato Grosso’ (FAPEMAT) and ‘Conselho Nacional de Desenvolvimento Científico e Tecnológico’ (CNPQ). Scholarships were provided by ‘Coordenação de Aperfeiçoamento de Pessoal de Nível Superior’ (CAPES) to LGFS and ALTM, by FAPEMAT to RW, and by CNPQ to MBL and DMA.

References

• Aguiar DM, Cavalcante GT, Pinter A, Labruna MB. Prevalence of Ehrlichia canis (Rickettsiales: Anaplasmataceae) in dogs and Rhipicephalus sanguineus (Acari: Ixodidae) ticks from Brazil. J Med Entomol 2007(1); 44:126-132. http:∕∕dx.doi.org∕10.1603∕0022-2585(2007)44[126:POECRA]2.0.CO;2
  » http:∕∕dx.doi.org∕10.1603∕0022-2585(2007)44[126:POECRA]2.0CO;2
• Aguiar DM, Hagiwara MK, Labruna MB. In vitro isolation and molecular characterization of an Ehrlichia canis strain from São Paulo, Brazil. Braz J Microbiol 2008; 39(3): 489-493. http:∕∕dx.doi.org∕10.1590∕S1517-83822008000300014
  » http:∕∕dx.doi.org∕10.1590∕S1517-83822008000300014
• Alho CJR, Lacher Júnior TE, Campos ZMS, Gonçalves HC. Mamíferos da Fazenda Nhumirim, sub-região de Nhecolândia, Pantanal do Mato Grosso do Sul. I – Levantamento preliminar de espécies. Rev-Bras Zool 1987; 4(2): 151-164. http:∕∕dx.doi.org∕10.1590∕S0101-81751987000200007
  » http:∕∕dx.doi.org∕10.1590∕S0101-81751987000200007
• Almeida AP. Pesquisa de Rickettsia, Ehrlichia, Anaplasma, Babesia, Hepatozoon e Leishmania em Cachorro-do-mato (Cerdocyon thous) de vida livre do Estado do Espírito Santo. [Thesis] São Paulo: Universidade de São Paulo; 2011.
• Allsopp MTEP, Allsopp BA. Novel Ehrlichia Genotype Detected in Dogs in South Africa. J Clin Microbiol 2001; 39(11): 4204-4207. PMid:11682562 PMCid:88519. http:∕∕dx.doi.org∕10.1128∕JCM.39.11.4204-4207.2001
  » http:∕∕dx.doi.org∕10.1128∕JCM.39.11.4204-4207.2001
• Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215(3): 403-410. PMid:2231712.
• André MR, Adania CH, Machado RZ, Allegretti SM, Felippe PAN, Silva KF, et al. Molecular and Serologic Detection of Ehrlichia spp. in Endangered Brazilian Wild Captive Felids. J. Wildl Dis 2010; 46(3): 1017-1023. PMid:20688716.
• André MR, Dumler JS, Scorpio DG, Teixeira RHF, Allegretti SM, Machado RZ. Molecular detection of tick-borne bacterial agents in Brazilian and exotic captive carnivores. Ticks Tick Borne Dis 2012; 3(4): 247-253. PMid:22749737. http:∕∕dx.doi.org∕10.1016∕j.ttbdis.2012.04.002
  » http:∕∕dx.doi.org∕10.1016∕j.ttbdis.2012.04.002
• Bechara GH, Szabó MP, Duarte JM, Matushima ER, Pereira MC, Keirans JE, et al. Ticks associated with wild animals in the Nhecolândia Pantanal, Brazil. Ann N Y Acad Sci 2000; 916: 289-297. PMid:11193635. http:∕∕dx.doi.org∕10.1111∕j.1749-6632.2000.tb05303.x
  » http:∕∕dx.doi.org∕10.1111∕j.1749-6632.2000.tb05303.x
• Doyle CK, Labruna MB, Breitschwerdt EB, Tang YW, Corstvet RE, Hegarty BC, et al. Detection of Medically Important Ehrlichia by Quantitative Multicolor TaqMan Real-Time Polymerase Chain Reaction of the dsb Gene. J Mol Diagn 2005; 7(4): 504-510. http:∕∕dx.doi.org∕10.1016∕S1525-1578(10)60581-8
  » http:∕∕dx.doi.org∕10.1016∕S1525-1578(10)60581-8
• Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Rikihisa Y, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms PMid:11760958. http:∕∕dx.doi.org∕10.1099∕00207713-51-6-2145of Ehrlichia phagocytophila. Int J Syst Evol Microbiol 2001; 51(6): 2145-2165.
  » http:∕∕dx.doi.org∕10.1099∕00207713-51-6-2145
• Harrus S, Waner T. Diagnosis of canine monocytotropic ehrlichiosis (Ehrlichia canis): An overview. Vet J 2011; 187(3): 292-296. PMid:20226700. http:∕∕dx.doi.org∕10.1016∕j.tvjl.2010.02.001
  » http:∕∕dx.doi.org∕10.1016∕j.tvjl.2010.02.001
• Kelly PJ, Matthewman LA, Mahan SM, Semu S, Peter T, Mason PR, et al. Serological evidence for antigenic relationships between Ehrlichia canis and Cowdria ruminantium. Res Vet Sci 1994; 56(2): 170-174. http:∕∕dx.doi.org∕10.1016∕0034-5288(94)90100-7
  » http:∕∕dx.doi.org∕10.1016∕0034-5288(94)90100-7
• Labruna MB, McBride JW, Camargo LM, Aguiar DM, Yabsley M.J, Davidson WR, et al. A preliminary investigation of Ehrlichia species in ticks, humans, dogs, and capybaras from Brazil. Vet Parasitol 2007; 143(2):189-195. PMid:16962245. http:∕∕dx.doi.org∕10.1016∕j.vetpar.2006.08.005
  » http:∕∕dx.doi.org∕10.1016∕j.vetpar.2006.08.005
• Machado RZ, Duarte JM, Dagnone AS, Szabó MP. Detection of Ehrlichia chaffeensis in Brazilian marsh deer (Blastocerus dichotomus). Vet Parasitol 2006; 139(1-3): 262-266. PMid:16621285. http:∕∕dx.doi.org∕10.1016∕j.vetpar.2006.02.038
  » http:∕∕dx.doi.org∕10.1016∕j.vetpar.2006.02.038
• McBride JW, Walker DH. Progress and obstacles in vaccine development for the ehrlichioses. Expert Rev Vaccines 2010; 9(9): 1071-1082. PMid:20822349 PMCid:2951016. http:∕∕dx.doi.org∕10.1586∕erv.10.93
  » http:∕∕dx.doi.org∕10.1586∕erv.10.93
• Melo ALT, Martins TF, Horta MC, Moraes-Filho J, Pacheco RC, Labruna MB, et al. Seroprevalence and risk factors to Ehrlichia spp. and Rickettsia spp. in dogs from the Pantanal Region of Mato Grosso State, Brazil. Ticks Tick Borne Dis 2011; 2(4): 213-218. PMid:22108015. http:∕∕dx.doi.org∕10.1016∕j.ttbdis.2011.09.007
  » http:∕∕dx.doi.org∕10.1016∕j.ttbdis.2011.09.007
• Sacchi ABV, Duarte JMB, André MR, Machado RZ. Prevalence and molecular characterization of Anaplasmataceae agents in free-ranging Brazilian marsh deer (Blastocerus dichotomus). Comp Immunol Microbiol Infect Dis 2012; 35(4): 325-334. PMid:22381686. http:∕∕dx.doi.org∕10.1016∕j.cimid.2012.02.001
  » http:∕∕dx.doi.org∕10.1016∕j.cimid.2012.02.001
• Silveira JAG, Rabelo EML, Ribeiro MFB. Molecular Detection of Tick- Borne Pathogens of the Family Anaplasmataceae in Brazilian Brown Brocket Deer (Mazama gouazoubira, Fischer, 1814) and Marsh Deer (Blastocerus dichotomus, Illiger, 1815); Transbound Emerg Dis; 2012; 59(4): 353-360. PMid:22136597. http:∕∕dx.doi.org∕10.1111∕j.1865-1682.2011.01278.x
  » http:∕∕dx.doi.org∕10.1111∕j.1865-1682.2011.01278.x
• Torres HM, Massard CL, Figueiredo MJ, Ferreira T, Almosny NRP. Isolamento e propagação da Ehrlichia canis em células DH82 e obtenção de antígeno para a reação de imunofluorescência indireta. Rev Bras Cienc Vet 2002; 9(2): 77-82.
• Vieira RFC, Biondo AW, Guimarães MAS, Santos AP, Santos RP, Dutra LH, et al. Ehrlichiosis in Brazil. Rev Bras Parasitol Vet 2011; 20(1): 1-12. PMid:21439224. http:∕∕dx.doi.org∕10.1590∕S1984-29612011000100002
  » http:∕∕dx.doi.org∕10.1590∕S1984-29612011000100002
• Widmer CE, Azevedo FC, Almeida AP, Ferreira F, Labruna MB. Tickborne bacteria in free-living jaguars (Panthera onca) in Pantanal, Brazil. Vector Borne Zoonotic Dis. 2011; 11(8): 1001-1005. http:∕∕dx.doi.org∕10.1089∕vbz.2011.0619
  » http:∕∕dx.doi.org∕10.1089∕vbz.2011.0619

Publication Dates

• Publication in this collection
  Mar 2013

History

• Received
  13 Aug 2012
• Accepted
  1 Dec 2012