rROP2 from Toxoplasma gondii as a potential vaccine against oocyst shedding in domestic cats

rROP2 de Toxoplasma gondii como potencial vacina contra a eliminação de oocistos em gatos domésticos

Dauton Luiz Zulpo Michelle Igarashi Ana Sue Sammi Joeleni Rosa dos Santos João Pedro Sasse Ivo Alexandre Leme da Cunha Alessandra Taroda Luiz Daniel de Barros Jonatas Campos de Almeida Mark Christopher Jenkins Italmar Teodorico Navarro João Luis Garcia About the authors

Abstract

The aim of the present study was to evaluate oocyst shedding in cats immunized by nasal route with T. gondii proteins ROP2. Twelve short hair cats (Felis catus) were divided in three groups G1, G2 and G3 (n=4). Animals from G1 received 100 μg of rROP2 proteins plus 20 μg of Quil-A, G2 received 100 μg of BSA plus 20 μg of Quil-A, and the G3 only saline solution (control group). All treatments were done by intranasal route at days 0, 21, 42, and 63. The challenge was performed in all groups on day 70 with ≅ 800 tissue cysts of ME-49 strain by oral route. Animals from G1 shed less oocysts (86.7%) than control groups. ELISA was used to detect anti-rROP2 IgG and IgA, however, there were no correlation between number of oocyst shedding by either IgG or IgA antibody levels. In the present work, in spite of lesser oocysts production in immunized group than control groups, it was not possible to associate the use of rROP2 via nostrils with protection against oocyst shedding. For the future, the use of either other recombinant proteins or DNA vaccine, in combination with rROP2 could be tested to try improving the efficacy of this kind of vaccine.

Keywords:
Definitive host; immunization; recombinant protein; toxoplasmosis

Resumo

O objetivo do presente estudo foi avaliar a eliminação de oocistos de Toxoplasma gondii em gatos imunizados pela via nasal com proteínas ROP2 de T. gondii. Doze gatos sem raça definida (Felis catus) foram divididos em três grupos experimentais G1, G2 e G3 (n = 4). Os animais do G1 receberam 100 μg de proteínas de rROP2 mais 20 μg de Quil-A, G2 recebeu 100 μg de albumina de soro bovino (BSA) junto com 20 μg de Quil-A, e o G3 recebeu apenas solução salina (grupo de controle). Todos os tratamentos foram realizados pela via intranasal nos dias 0, 21, 42 e 63. O desafio foi realizado em todos os grupos no dia 70 com aproximadamente 800 cistos de tecido da cepa ME-49 por via oral. Os animais de todos os grupos tiveram as suas fezes examinadas e o número de oocistos foi determinado durante 20 dias após o desafio. Os animais de G1 eliminaram menos oocistos (86,7%) do que os grupos controles. O ELISA foi utilizado para detectar IgG e IgA anti-rROP2, no entanto, não houve correlação entre o número de eliminhação de oocistos com os níveis de anticorpos IgG ou IgA. No presente trabalho, apesar da menor produção de oocistos no grupo imunizado (G1) em relação aos grupos controles (G2 e G3), não foi possível associar o uso de rROP2 pela via nasal com proteção contra eliminação de oocistos de T. gondii. Para o futuro, a utilização de outras proteínas recombinantes, ou mesmo vacina de DNA, em combinação com rROP2 poderia ser utilizada para tentar melhorar a eficácia deste tipo de vacina.

Palavras-chave:
Hospedeiro definitivo; imunização; proteína recombinante; toxoplasmose

Introduction

Toxoplasma gondii is a protozoan parasite with worldwide distribution (DUBEY & THULLIEZ, 1993Dubey JP, Thulliez P. Persistence of tissue cysts in edible tissues of cattle fed oocysts. Toxoplasma gondiiAm J Vet Res 1993; 54(2): 270-273. PMid:8430937.) which may be found in animals from the arctic (PRESTRUD et al., 2008Prestrud KW, Asbakk K, Mork T, Fuglei E, Tryland M, Su C. Direct high-resolution genotyping of Toxoplasma gondii in arctic foxes () in the remote arctic svalbard archipelago reveals widespread clonal Type II lineage. Vulpes lagopusVet Parasitol 2008; 158(1-2): 121-128. PMid:18922642. http://dx.doi.org/10.1016/j.vetpar.2008.08.020.
http://dx.doi.org/10.1016/j.vetpar.2008....
) rain forest (CAÑÓN-FRANCO et al., 2013Cañón-Franco WA, Araújo FA, López-Orozco N, Jardim MM, Keid LB, Dalla-Rosa C, et al. in free-ranging wild small felids from Brazil: molecular detection and genotypic characterization. Toxoplasma gondiiVet Parasitol 2013; 197(3-4): 462-469. PMid:23932730. http://dx.doi.org/10.1016/j.vetpar.2013.07.019.
http://dx.doi.org/10.1016/j.vetpar.2013....
) arid zones (NIETO & MELÉNDEZ, 1998Nieto SO, Meléndez RD. Seroprevalence of Toxoplasma gondii in goats from arid zones of Venezuela. J Parasitol 1998; 84(1): 190-191. PMid:9488366. http://dx.doi.org/10.2307/3284559.
http://dx.doi.org/10.2307/3284559...
), and even in marine mammals (DUBEY et al., 1998Dubey JP, Lunney JK, Shen SK, Kwok OC. Immunity to toxoplasmosis in pigs fed irradiated Toxoplasma gondii oocysts. J Parasitol 1998; 84(4): 749-752. PMid:9714205. http://dx.doi.org/10.2307/3284582.
http://dx.doi.org/10.2307/3284582...
). Toxoplasma gondii normally causes a subclinical infection in most animal species, however, a primary infection during pregnancy can cause foetal pathologies, as well as abortions in humans and some animal species (INNES et al., 2009Innes EA, Bartley PM, Buxton D, Katzer F. Ovine toxoplasmosis. Parasitology 2009; 136(14): 1887-1894. PMid:19995468. http://dx.doi.org/10.1017/S0031182009991636.
http://dx.doi.org/10.1017/S0031182009991...
; CARELLOS et al., 2014Carellos EVM, Caiaffa WT, Andrade GMQ, Abreu MNS, Januário JN. Congenital toxoplasmosis in the state of Minas Gerais, Brazil: a neglected infectious disease? Epidemiol Infect 2014; 142(3): 644-655. PMid:23823156. http://dx.doi.org/10.1017/S0950268813001507.
http://dx.doi.org/10.1017/S0950268813001...
).

The main sources of infection by T. gondii for human beings include the consumption of either vegetables or water contaminated with sporulated T. gondii oocysts or undercooked meat infected with tissue cysts. The risk of becoming infected depends on culinary habits, including the regular consumption of raw or undercooked meat and living in an environment with a higher risk of oocyst contamination (NAVARRO et al., 1992Navarro IT, Vidotto O, Giraldi N, Mitsuka R. Resistance of to sodium chloride and condiments in pork sausage. Toxoplasma gondiiBol Oficina Sanit Panam 1992; 112(2): 138-143. PMid:1531110.; DIAS et al., 2005Dias RA, Navarro IT, Ruffolo BB, Bugni FM, Castro MV, Freire RL. in fresh pork sausage and seroprevalence in butchers from factories in Londrina, Paraná state, Brazil. Toxoplasma gondiiRev Inst Med Trop 2005; 47(4): 185-189. PMid:16138196. http://dx.doi.org/10.1590/S0036-46652005000400002.
http://dx.doi.org/10.1590/S0036-46652005...
; JONES et al., 2006Jones JL, Muccioli C, Belfort R Jr, Holland GN, Roberts JM, Silveira C. Recently acquired infection, Brazil. Toxoplasma gondiiEmerg Infect Dis 2006; 12(4): 582-587. PMid:16704805. http://dx.doi.org/10.3201/eid1204.051081.
http://dx.doi.org/10.3201/eid1204.051081...
; SANTOS et al., 2010Santos TR, Nunes CM, Luvizotto MCR, Moura AB, Lopes WDZ, Costa AJ, et al. Detection of oocysts in environmental samples from public schools. Toxoplasma gondiiVet Parasitol 2010; 171(1-2): 53-57. PMid:20347524. http://dx.doi.org/10.1016/j.vetpar.2010.02.045.
http://dx.doi.org/10.1016/j.vetpar.2010....
; SILVA & LANGONI, 2016Silva RC, Langoni H. Risk factors and molecular typing of isolated from ostriches (Toxoplasma gondiiStruthio camelus) from a Brazilian slaughterhouse. Vet Parasitol 2016; 225(30): 73-80. PMid:27369578. http://dx.doi.org/10.1016/j.vetpar.2016.06.001.
http://dx.doi.org/10.1016/j.vetpar.2016....
). Cats play an important role in this process due to their close interactions with human beings where infected cats shed millions of oocysts in their feces that subsequently contaminate the environment (DUBEY, 1995Dubey JP. Duration of immunity to shedding of Toxoplasma gondii oocysts by cats. J Parasitol 1995; 81(3): 410-415. PMid:7776126. http://dx.doi.org/10.2307/3283823.
http://dx.doi.org/10.2307/3283823...
; GARCIA et al., 2007Garcia JL, Navarro IT, Biazzono L, Freire RL, Guimarães JS Jr, Cryssafidis AL, et al. Protective activity against oocyst shedding in cats vaccinated with crude rhoptry proteins of the Toxoplasma gondii by the intranasal route. Vet Parasitol 2007; 145(3-4): 197-206. PMid:17296268. http://dx.doi.org/10.1016/j.vetpar.2007.01.007.
http://dx.doi.org/10.1016/j.vetpar.2007....
).

In addition, Boyer et al. (2011)Boyer K, Hill D, Mui E, Wroblewski K, Karrison T, Dubey JP, et al. Unrecognized ingestion of oocysts leads to congenital toxoplasmosis and causes epidemics in north america. Toxoplasma gondiiClin Infect Dis 2011; 53(11): 1081-1089. PMid:22021924. http://dx.doi.org/10.1093/cid/cir667.
http://dx.doi.org/10.1093/cid/cir667...
showed that environmental contamination by T. gondii oocysts substantially contributes to the acquisition of T. gondii and the subsequent development of disease in humans. They went on to suggest a systematic screening of pregnant women and the development of a vaccine with the potential to prevent the fetal diseases caused by the acquisition of T. gondii during gestation in North America. Thus, production of an effective vaccine against T. gondii in cats would be desirable to prevent infections of intermediate hosts and human beings (GARCIA, 2009Garcia JL. Vaccination concepts against Toxoplasma gondii.Expert Rev Vaccines 2009; 8(2): 215-225. PMid:19196201. http://dx.doi.org/10.1586/14760584.8.2.215.
http://dx.doi.org/10.1586/14760584.8.2.2...
).

A live mutant strain (T-263) was used to protect against T. gondii oocyst shed in cats with very good results (FRENKEL et al., 1991Frenkel JK, Pfefferkorn ER, Smith DD, Fishback JL. Prospective vaccine prepared from a new mutant of for use in cats. Toxoplasma gondiiAm J Vet Res 1991; 52(5): 759-763. PMid:1854103.; FREYRE et al., 1993Freyre A, Choromanski L, Fishback JL, Popiel I. Immunization of cats with tissue cysts, bradyzoites, and tachyzoites of the T-263 strain of Toxoplasma gondii.J Parasitol 1993; 79(5): 716-719. PMid:8410543. http://dx.doi.org/10.2307/3283610.
http://dx.doi.org/10.2307/3283610...
; MATEUS-PINILLA et al., 1999Mateus-Pinilla NE, Dubey JP, Choromanski L, Weigel RM. A field trial of the effectiveness of a feline Toxoplasma gondii vaccine in reducing . T. gondii exposure for swineJ Parasitol 1999; 85(5): 855-860. PMid:10577720. http://dx.doi.org/10.2307/3285821.
http://dx.doi.org/10.2307/3285821...
), however, no other studies were performed in the past years, probably because frozen difficulties of bradyzoites used for vaccination. Additionally, with the adverse effects and the difficulties to preserve live and attenuated vaccines, the recombinant proteins may surpass these problems (JENKINS, 2001Jenkins MC. Advances and prospects for subunit vaccines against protozoa of veterinary importance. Vet Parasitol 2001; 101(3-4): 291-310. PMid:11707303. http://dx.doi.org/10.1016/S0304-4017(01)00557-X.
http://dx.doi.org/10.1016/S0304-4017(01)...
).

Nakaar et al. (2003)Nakaar V, Ngô HM, Aaronson EP, Coppens I, Stedman TT, Joiner KA. Pleiotropic effect due to targeted depletion of secretory rhoptry protein ROP2 in Toxoplasma gondii.J Cell Sci 2003; 116(11): 2311-2320. PMid:12711703. http://dx.doi.org/10.1242/jcs.00382.
http://dx.doi.org/10.1242/jcs.00382...
showed that T. gondii proteins ROP2 are the major determinant of proper biogenesis and maintenance of rhoptry structure, which is responsible for parasite invasion, replication and parasite-host cell interaction.

Therefore, the aim of the present study was to determine the efficacy of rROP2 from T. gondii administered by the nasal route to protect domestic cats against oocyst shedding.

Materials and Methods

Ethics Committee

This study was approved by the Institutional Ethics Committee in Animal Use (CEUA, protocol number 51/07).

Toxoplasma gondii strains

The RH and ME-49 T. gondii strains were used in the present study. The RH strain (genotype I) was initially isolated in 1937 from a case of acquired toxoplasmosis in a six year old boy (SABIN, 1941Sabin AB. Toxoplasmic encephalitis in children. J Am Vet Med Assoc 1941; 116(9): 801-807. http://dx.doi.org/10.1001/jama.1941.02820090001001.
http://dx.doi.org/10.1001/jama.1941.0282...
). The ME49 strain (genotype II) was isolated from muscles of sheep in the 1960s by Lunde & Jacobs (1983)Lunde MN, Jacobs L. Antigenic differences between endozoites and cystozoites of Toxoplasma gondii.J Parasitol 1983; 69(5): 806-808. PMid:6200590. http://dx.doi.org/10.2307/3281034.
http://dx.doi.org/10.2307/3281034...
. Those strains were used as following; RH for obtaining DNA to amplify rop2 gene and ME-49 was used for tissue cyst production. RH strain has been propagated in Swiss mice by intra-peritoneal route weekly in our laboratory. For tissue cyst formation, oocysts of ME-49, which were obtained from other study (ZULPO et al., 2012Zulpo DL, Headley SA, Biazzono L, Cunha IAL, Igarashi M, Barros LD, et al. Oocyst shedding in cats vaccinated by the nasal and rectal routes with crude rhoptry proteins of Toxoplasma gondii.Exp Parasitol 2012; 131(2): 223-230. PMid:22542988. http://dx.doi.org/10.1016/j.exppara.2012.04.006.
http://dx.doi.org/10.1016/j.exppara.2012...
), were used to infect ten mice with 50 sporulated oocysts each by the oral route and euthanatized 60 days after being infected, the burden of brain cysts were counted (IGARASHI et al., 2008Igarashi M, Kano F, Tamekuni K, Machado RZ, Navarro IT, Vidotto O, et al. Toxoplasma gondii: evaluation of an intranasal vaccine using recombinant proteins against brain cyst formation in BALB/c mice. Exp Parasitol 2008; 118(3): 386-392. PMid:18154953. http://dx.doi.org/10.1016/j.exppara.2007.10.002.
http://dx.doi.org/10.1016/j.exppara.2007...
) and prepared for challenge.

Construction of plasmids, expression and purification of rROP2

The protocols for obtaining of rROP2 were performed as previously described by Igarashi et al. (2010)Igarashi M, Zulpo DL, Cunha IAL, Barros LD, Pereira VF, Taroda A, et al. Toxoplasma gondii: humoral and cellular immune response of BALB/c mice immunized via intranasal route with rTgROP2. Rev Bras Parasitol Vet 2010; 19(4): 210-216. PMid:21184696. http://dx.doi.org/10.1590/S1984-29612010000400004.
http://dx.doi.org/10.1590/S1984-29612010...
.

Briefly, the DNA sequence of the gene encoding the rhoptry antigen ROP2 of T. gondii was obtained from Genbank database (Accession number: Z36906). Tachyzoites from T. gondii RH strain were used to isolate genomic DNA. This DNA was used as the template for amplification of gene rop2 by using a standard PCR amplification protocol. The amplification product was analysed by electrophoresis on 0.8% agarose gel stained with ethidium bromide. The antigen ROP2 (nt 1022-2125) has a predicted molecular mass of 54 kDa. The ROP2 open reading frame was amplified using the primers ROP2F (5’ATCGAATTCACGGATCCTGGAGAC3’-introduced EcoRI recognition site, underline) and ROP2R (5’TGAAAGCTTTCATGCCGGTTCTCC3’ – introduced HindIII recognition site, underlined) by a PCR assay.

PCR product was obtained with 1103 pb size, this fragment was digested overnight with EcoRI and HindIII endonucleases and ligated into pTrcHis B (Invitrogen, life Technologies, USA) following manufacturer’s recommendations. Sequence analysis of the DNA fragment cloned in plasmid was carried out using the DNA sequencer software.

Transformed Escherichia coli DH5-α bacteria were identified on LB/ampicillin agar plates by QIAprep Miniprep Kit (Qiagen) and colony-PCR with the same primers. Positive clones were confirmed by sequencing and then they were transferred into E. coli Rosetta (DE3). Soluble fraction was applied directly onto Ni-NTA Superflow resin (Qiagen) pre equilibrated with 20mM sodium phosphate, 500mM sodium chloride, pH 7.8 for soluble samples. The recombinant soluble antigen was eluted from resin by gravity flow with native elution buffer (200mM monobasic sodium phosphate and 5M NaCl pH 4.0), after 30 min incubation in elution buffer and gentle agitation at room temperature. Escherichia coli Rosetta 2 cells transformed with pTrcHis-TgROP2 showed high levels (~1 mg.mL–1) of recombinant protein after 4 hours of IPTG induction. A 54kDa protein was obtained and used for immunization of cats.

Immunization and challenge of cats

Twelve short hair domestic cats (Felis catus), of both sexes, between 3 and 6 months of age, were randomly allocated in individual cages; all cats received only commercially dry food and tap water ad libitum. Those animals were selected from kittens that were abandoned at Veterinary Hospital in University campus (Universidade Estadual de Londrina). The cats needed to be serum negative for T. gondii and free from T. gondii oocysts shedding. For this, sera and feces from all animals were sent to Parasitology laboratory from Londrina Veterinary Hospital to perform indirect immunofluorescence assay (cut-off of 16) and sucrose flotation, respectively.

The cats were divided into three groups, each group containing four animals: G1 animals received 100 µg of rROP2 plus Quil-A (20 µg); G2 received 100 µg of bovine serum albumin (BSA) plus Quil-A (20 µg) and G3 received only saline solution. The animals within treatment protocols were immunized nasally (100 µl of final solution was administrated in each animal per nostril). Intranasal vaccination was achieved by the introduction of an adapted stomach tube half-way through the nostrils of each cat. All inoculations were performed on days 0, 21, 42, and 63 of the experiment.

G1, G2 and G3 animals were challenged on day 70 with 800 tissue cysts of the ME-49 strain (contained in a volume of 2 mL) administered via stomach tube, after which they were injected with 5 mL of saline, at challenge day these animals were anesthetized with tiletamine plus zolazepam (Zoletil®, Virbac-Brazil, 3.15 mg/kg/IM).

Measurements of oocyst shedding by sucrose flotation

Feces from each cat were collected daily from 1st until 20th day after challenge and examined microscopically for oocysts as described by Garcia et al. (2007)Garcia JL, Navarro IT, Biazzono L, Freire RL, Guimarães JS Jr, Cryssafidis AL, et al. Protective activity against oocyst shedding in cats vaccinated with crude rhoptry proteins of the Toxoplasma gondii by the intranasal route. Vet Parasitol 2007; 145(3-4): 197-206. PMid:17296268. http://dx.doi.org/10.1016/j.vetpar.2007.01.007.
http://dx.doi.org/10.1016/j.vetpar.2007....
and Zulpo et al. (2012)Zulpo DL, Headley SA, Biazzono L, Cunha IAL, Igarashi M, Barros LD, et al. Oocyst shedding in cats vaccinated by the nasal and rectal routes with crude rhoptry proteins of Toxoplasma gondii.Exp Parasitol 2012; 131(2): 223-230. PMid:22542988. http://dx.doi.org/10.1016/j.exppara.2012.04.006.
http://dx.doi.org/10.1016/j.exppara.2012...
. Briefly, feces obtained over a period of 24 h were diluted in a small volume of distilled water; 1 g of this material were admixed with 10 mL of sucrose solution (specific gravity, 1.18), filtered, and centrifuged (1200 x g for 10 min). One drop of solution, removed from the meniscus, was examined microscope. When oocysts were detected the supernatant was collected (approximated 9 mL) admixed with 40 mL of water in a 50 mL tube, and centrifuged (1200 x g) for 10 min. The supernatant was discarded and the sediment elevated to 1 mL with water. The number of oocysts was then determined in four white blood cells chambers of a hemocytometer (Neubauer Chamber).

Genotyping of tissue cysts and oocysts

Sample of tissue cysts of challenge and pool of feces from each group was collected to perform the genetic characterization of T. gondii. Tissue cysts and feces underwent to DNA extraction using a commercial kit following the manufacturer’s instructions (NucleoSpin® Tissue, Macherey-Nagel, Germany). Genotyping was performed using multilocus PCR-RFLP with 11 genetic markers (SAG1, 5’-3’SAG2, alt.SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1 and Apico) as previously described (SU et al., 2010Su C, Shwab EK, Zhou P, Zhu XQ, Dubey JP. Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii.Parasitology 2010; 137(1): 1-11. PMid:19765337. http://dx.doi.org/10.1017/S0031182009991065.
http://dx.doi.org/10.1017/S0031182009991...
). DNA from strains GT1, PTG, CTG, TgCgCa1, MAS, TgCatBr5, TgCatBr64 and TgRsCr1 were used as positive controls. All digested PCR product were analyzed by agarose gel electrophoresis, stained with Sybr Safe (Invitrogen®, USA), visualized under UV light and photographed using a gel documentation system (Safe imager, Invitrogen®, USA).

Enzyme-linked immunosorbent assay (ELISA)-IgG and IgA

Blood was collected from jugular vein on days 0, 21, 42, 63, 70, 85, 100, 115 and 130 of the experiment to evaluate antibody levels. Sera were obtained and kept at -20°C. Optimal dilutions were established by using checkerboard titrations with dilutions of sera and conjugates. Proteins from rROP2 of T. gondii were used as antigens to coat the flat-bottom 96-well polystyrene microtitration plates (Nunc-Immuno Plate, MaxiSorp, Denmark) with 0.1 mL of the antigens (5 µg/mL) diluted in 0.1 M carbonate buffer (pH 9.6) by incubation overnight at 6 oC. The plates were rinsed thrice with PBS-tween 20 (50 mM tris, pH 7.4, containing 150 mM sodium chloride and 0.05% tween 20) and non-specific immune sites were blocked by incubation for 1 h at 37 o C with carbonate buffer and 8% nonfat dry milk. Control and sample sera were diluted (1:100 for IgG and 1:20 for IgA) in PBS-tween 20 and 5% nonfat dry milk and 0.1 mL of this mixture was added to the wells of microtitre plates in duplicate. Further, the plates were incubated for 1 h at 37 °C for IgG and overnight at 6 oC for IgA detection. After rinsing, the conjugate for IgG detection (HRP anti-cat IgG antibodies, Bethyl Lab, Montgomery, TX, USA) were diluted 1:10,000 in PBS-tween 20 and 5% nonfat dry milk, after which 0.1 mL of the mixture was added to each well and incubated for 1 h at 37 °C. For IgA detection, an additional step was added, a goat anti-cat IgA antibody were diluted 1:2,000 and left for 2 h at 37 °C, three rinses were performed and HRP rabbit anti-goat IgG antibodies were diluted 1:1,000 and incubated for 1 h at 37 °C. After rinsing, the peroxidase activity was revealed by adding 0.1 mL of orthophenylenediamine solution (40 mg ortho-phenylenediamine/100 mL of 0.1 M phosphate citrate buffer, pH 6.0, and 40 µL of H2O2), and the reaction was stopped by adding 0.05 mL of 1 N of HCl. The optical density (OD) was read at 490 nm in an ELISA microplate reader. Positive and negative control sera were included in every plate and a corrected OD value was calculated according to the formula described before (GARCIA et al., 2007Garcia JL, Navarro IT, Biazzono L, Freire RL, Guimarães JS Jr, Cryssafidis AL, et al. Protective activity against oocyst shedding in cats vaccinated with crude rhoptry proteins of the Toxoplasma gondii by the intranasal route. Vet Parasitol 2007; 145(3-4): 197-206. PMid:17296268. http://dx.doi.org/10.1016/j.vetpar.2007.01.007.
http://dx.doi.org/10.1016/j.vetpar.2007....
). A serum was considered to be positive when ODcorr > [OD mean (from negative control sera, n = 11) + 2SD (standard deviation from negative control sera)].

Statistical comparisons

Wilcoxon-Mann-Whitney U test was used to determine statistical differences in oocysts shedding and antibodies response. A p ≤ 0.05 was considered as statistically significant. Protection against oocysts elimination in cats was evaluated by estimating the preventable fraction (PF) as previously described (GARCIA et al., 2007Garcia JL, Navarro IT, Biazzono L, Freire RL, Guimarães JS Jr, Cryssafidis AL, et al. Protective activity against oocyst shedding in cats vaccinated with crude rhoptry proteins of the Toxoplasma gondii by the intranasal route. Vet Parasitol 2007; 145(3-4): 197-206. PMid:17296268. http://dx.doi.org/10.1016/j.vetpar.2007.01.007.
http://dx.doi.org/10.1016/j.vetpar.2007....
) with modifications: PF= (P2-P1)/P2; where P2 = mean of oocysts shedding among group unvaccinated (G3) and P1 = mean of oocysts shedding among group vaccinated (G1 or G2).

Results

According with antibodies production (Figure 1), only cats from G1 demonstrated IgG and IgA levels above cut-off at the time of challenge (day 70). The antibody OD averages showed by G1, before challenge, was IgG63=0.197±0.141 and IgG70=0.294±0.283, and IgA63=0.230±0.289 and IgA70=0.349±0.340 at days 63 and 70, respectively. Additionally, after challenge, cats from G1 produced comparatively more IgA (IgA85=0.561±0.358) at day 85 than cats from G2 (IgA85=0.325±0.013) and G3 (IgA85=0.040±0.056). Cats from all groups seroconverted after challenge (Figure 1).

Figure 1
rROP2-serum IgG and IgA antibody responses of cats evaluated by the indirect enzyme-linked immunosorbent assay (MEAN ± SD). G1, vaccinated with rROP2 plus Quil-A, G2 received bovine serum albumin (BSA) plus Quil-A and G3 received only saline, by nasal route. Treatments were made at days 0, 21, 42, and 63. All groups received a challenge of 800 cysts from the ME-49 strain on day 70 (dashed arrow). Dashed line indicates positive cut-off.

The efficacy of protection against oocyst shedding was evaluated by counting of oocyst excreted during 20 days of the experiment. Thus, the total average oocyst shedding/g of feces showed that animals from G1 (OOPG: 2.49x105) shed fewer oocysts than the animals from G2 (OOPG: 3.79 x105) and G3 (OOPG: 1.88 x 106); however, there was no statistically significant differences (p>0.05) (Table 1 and Figure 2). Additionally, the averages for pre patent period (PPP), patent period (PP), and peak oocyst shedding are shown in Table 1. The preventable fractions (PF) of groups were PFG1 x G3= 86.7% and PFG1 x G2= 23.9%, and PFG2 x G3 =82.5 (Table 1). All samples genotyped were characterized as type II.

Table 1
The dynamics of Toxoplasma gondii oocyst shedding after challenge with ME-49 strain. Cats from G1 were vaccinated with rROP2 plus Quil-A, G2 received bovine serum albumin (BSA) plus Quil-A and G3 received only saline, by nasal route. All groups received a challenge of 800 cysts from the ME-49 strain on day 70.
Figure 2
Toxoplasma gondii oocyst shedding in cats immunized with rROP2 (G1), G2 were adjuvant control and G3 were saline control. Challenged was performed at day 70 with 800 tissue cysts of ME-49 strain of T. gondii (a: Total of oocysts shedding / g of feces x 103; b: Mean of oocyst shed by four animals).

Discussion

In the present study, we observed that cats that were immunized with rROP2 by the nasal route shed less oocysts 23,9 and 86.7% than control groups G2 and G3, respectively, however, there was no statistical differences. This result could be considered remarkable considering ROP2 is only one protein among over 20,000 from T. gondii (WASMUTH et al., 2009Wasmuth J, Daub J, Peregrín-Alvarez JM, Finney CAM, Parkinson J. The origins of apicomplexan sequence innovation. Genome Res 2009; 19(7): 1202-1213. PMid:19363216. http://dx.doi.org/10.1101/gr.083386.108.
http://dx.doi.org/10.1101/gr.083386.108...
); and immunization with additional recombinant proteins could improve the efficacy of this type of vaccine. A vaccine that decreases oocyst shedding in cats is very desirable. This vaccine would decrease environmental contamination by oocysts and consequently reduce the risk of infection in animals and humans. Contact with the ground and oocyst infection were described as major risks for acquiring T. gondii during pregnancy (DECAVALAS et al., 1990Decavalas G, Papapetropoulou M, Giannoulaki E, Tzigounis V, Kondakis XG. Prevalence of Toxoplasma gondii antibodies in gravidas and recently aborted women and study of risk factors. Eur J Epidemiol 1990; 6(2): 223-226. PMid:2361547. http://dx.doi.org/10.1007/BF00145798.
http://dx.doi.org/10.1007/BF00145798...
; LOPES-MORI et al., 2013Lopes-Mori FMR, Mitsuka-Breganó R, Bittencourt LHFB, Dias RCF, Gonçalves DD, Capobiango JD, et al. Gestational toxoplasmosis in Paraná State, Brazil: prevalence of IgG antibodies and associated risk factors. Braz J Infect Dis 2013; 17(4): 405-409. PMid:23665010. http://dx.doi.org/10.1016/j.bjid.2012.12.003.
http://dx.doi.org/10.1016/j.bjid.2012.12...
). It is estimated that cats infected for the first time with T. gondii are able to produce millions of oocysts with an annual environmental contamination of approximately 94 to 4,671 oocysts/m2 (DABRITZ et al., 2007Dabritz HA, Miller MA, Atwill ER, Gardner IA, Leutenegger CM, Melli AC, et al. Detection of -like oocysts in cat feces and estimates of the environmental oocyst burden. Toxoplasma gondiiJ Am Vet Med Assoc 2007; 231(11): 1676-1684. PMid:18052801. http://dx.doi.org/10.2460/javma.231.11.1676.
http://dx.doi.org/10.2460/javma.231.11.1...
). These data demonstrated the need to control oocyst shedding in cats, however, few studies have been conducted with this aim (GARCIA, 2009Garcia JL. Vaccination concepts against Toxoplasma gondii.Expert Rev Vaccines 2009; 8(2): 215-225. PMid:19196201. http://dx.doi.org/10.1586/14760584.8.2.215.
http://dx.doi.org/10.1586/14760584.8.2.2...
; VERMA & KHANNA, 2013Verma R, Khanna P. Development of Toxoplasma gondii vaccine: a global challenge. Hum Vaccin Immunother 2013; 9(2): 291-293. PMid:23111123. http://dx.doi.org/10.4161/hv.22474.
http://dx.doi.org/10.4161/hv.22474...
; CORNELISSEN et al., 2014Cornelissen JB, Van Der Giessen JW, Takumi K, Teunis PF, Wisselink HJ. An experimental dose response challenge model to study therapeutic or vaccine efficacy in cats. Toxoplasma gondiiPLoS One 2014; 9(9): e104740. PMid:25184619. http://dx.doi.org/10.1371/journal.pone.0104740.
http://dx.doi.org/10.1371/journal.pone.0...
; GARCIA et al., 2014Garcia JL, Innes EA, Katzer F. Current progress toward vaccines against Toxoplasma gondii.Vaccine (Auckl) 2014; 4(1): 23-37. http://dx.doi.org/10.2147/VDT.S57474.
http://dx.doi.org/10.2147/VDT.S57474...
).

Previously studies (GARCIA et al., 2007Garcia JL, Navarro IT, Biazzono L, Freire RL, Guimarães JS Jr, Cryssafidis AL, et al. Protective activity against oocyst shedding in cats vaccinated with crude rhoptry proteins of the Toxoplasma gondii by the intranasal route. Vet Parasitol 2007; 145(3-4): 197-206. PMid:17296268. http://dx.doi.org/10.1016/j.vetpar.2007.01.007.
http://dx.doi.org/10.1016/j.vetpar.2007....
; ZULPO et al., 2012Zulpo DL, Headley SA, Biazzono L, Cunha IAL, Igarashi M, Barros LD, et al. Oocyst shedding in cats vaccinated by the nasal and rectal routes with crude rhoptry proteins of Toxoplasma gondii.Exp Parasitol 2012; 131(2): 223-230. PMid:22542988. http://dx.doi.org/10.1016/j.exppara.2012.04.006.
http://dx.doi.org/10.1016/j.exppara.2012...
) with immunization in cats by the nasal route against T. gondii oocyst shedding have reported 66.6% and 98.6% protection, respectively. However, these authors immunized the animals with crude rhoptry antigens and challenged cats with VEG (600 cysts) and ME-49 (800 cysts) strains, respectively. The dynamics of oocyst shedding that were observed in the present study were similar to those that were described previously. Furthermore, ME-49 is the most frequently used T. gondii strain for challenging cats (DUBEY & THULLIEZ, 1989Dubey JP, Thulliez P. Serologic diagnosis of toxoplasmosis in cats fed tissue cysts. Toxoplasma gondiiJ Am Vet Med Assoc 1989; 194(9): 1297-1299. PMid:2722663.; LAPPIN et al., 1994Lappin MR, Bush DJ, Reduker DW. Feline serum antibody responses to and characterization of target antigens. Toxoplasma gondiiJ Parasitol 1994; 80(1): 73-80. PMid:8308661. http://dx.doi.org/10.2307/3283348.
http://dx.doi.org/10.2307/3283348...
; BURNEY et al., 1995Burney DP, Lappin MR, Cooper C, Spilker MM. Detection of specific IgA in the serum of cats. Toxoplasma gondiiAm J Vet Res 1995; 56(6): 769-773. PMid:7653886.; DUBEY, 1995Dubey JP. Duration of immunity to shedding of Toxoplasma gondii oocysts by cats. J Parasitol 1995; 81(3): 410-415. PMid:7776126. http://dx.doi.org/10.2307/3283823.
http://dx.doi.org/10.2307/3283823...
; DUBEY et al., 1995Dubey JP, Lappin MR, Thulliez P. Long-term antibody responses of cats fed tissue cysts. Toxoplasma gondiiJ Parasitol 1995; 81(6): 887-893. PMid:8544059. http://dx.doi.org/10.2307/3284035.
http://dx.doi.org/10.2307/3284035...
; ZULPO et al., 2012Zulpo DL, Headley SA, Biazzono L, Cunha IAL, Igarashi M, Barros LD, et al. Oocyst shedding in cats vaccinated by the nasal and rectal routes with crude rhoptry proteins of Toxoplasma gondii.Exp Parasitol 2012; 131(2): 223-230. PMid:22542988. http://dx.doi.org/10.1016/j.exppara.2012.04.006.
http://dx.doi.org/10.1016/j.exppara.2012...
), and it is able to produce a larger amount of oocysts compared with the VEG strain (DUBEY, 1995Dubey JP. Duration of immunity to shedding of Toxoplasma gondii oocysts by cats. J Parasitol 1995; 81(3): 410-415. PMid:7776126. http://dx.doi.org/10.2307/3283823.
http://dx.doi.org/10.2307/3283823...
).

In contrast to our study, (MISHIMA et al., 2002Mishima M, Xuan X, Yokoyama N, Igarashi I, Fujisaki K, Nagasawa H, et al. Recombinant feline herpesvirus type 1 expressing ROP2 antigen inducible protective immunity in cats. Toxoplasma gondiParasitol Res 2002; 88(2): 144-149. PMid:11936503. http://dx.doi.org/10.1007/s004360100429.
http://dx.doi.org/10.1007/s004360100429...
) used a DNA vaccine expressing ROP2, and they did not reduce oocyst shedding in cats. This could be related to the fact that DNA vaccines are usually administered via a systemic route, whereas we used an intranasal route. This fact was reported by Frenkel & Smith (1982)Frenkel JK, Smith DD. Immunization of cats against shedding of Toxoplasma oocysts. J Parasitol 1982; 68(5): 744-748. PMid:7131181. http://dx.doi.org/10.2307/3280978.
http://dx.doi.org/10.2307/3280978...
, who observed that only 25% of cats that developed systemic antibodies did not shed oocysts when challenged with T. gondii. Frenkel et al. (1991)Frenkel JK, Pfefferkorn ER, Smith DD, Fishback JL. Prospective vaccine prepared from a new mutant of for use in cats. Toxoplasma gondiiAm J Vet Res 1991; 52(5): 759-763. PMid:1854103. found that the primary focus of immunity against oocyst shedding is the intestinal epithelium of kittens. The local protection of secretory IgA in the intestine mucosa against T. gondii was described previously (MCLEOD et al., 1988McLeod R, Frenkel JK, Estes RG, Mack DG, Eisenhauer PB, Gibori G. Subcutaneous and intestinal vaccination with tachyzoites of and acquisition of immunity to peroral and congenital toxoplasma challenge. Toxoplasma gondiiJ Immunol 1988; 140(5): 1632-1637. PMid:3346545.; BONENFANT et al., 2001Bonenfant C, Dimier-Poisson I, Velge-Roussel F, Buzoni-Gatel D, Del Giudice G, Rappuoli R, et al. Intranasal immunization with SAG1 and nontoxic mutant heat-labile enterotoxins protects mice against Toxoplasma gondii.Infect Immun 2001; 69(3): 1605-1612. PMid:11179334. http://dx.doi.org/10.1128/IAI.69.3.1605-1612.2001.
http://dx.doi.org/10.1128/IAI.69.3.1605-...
; DIMIER-POISSON et al., 2006Dimier-Poisson I, Aline F, Bout D, Mévélec MN. Induction of protective immunity against toxoplasmosis in mice by immunization with Toxoplasma gondii RNA. Vaccine 2006; 24(10): 1705-1709. PMid:16256251. http://dx.doi.org/10.1016/j.vaccine.2005.09.053.
http://dx.doi.org/10.1016/j.vaccine.2005...
).

Animals from G2, which received BSA plus Quil-A, showed less oocyst shedding than control group (G3). This could be associated with immune modulation of Quil-A. This adjuvant was described as being capable of inducing strong Th1 and Th2 responses and moderate CTL responses (COX & COULTER, 1997Cox JC, Coulter AR. Adjuvants - a classification and review of their modes of action. Vaccine 1997; 15(3): 248-256. PMid:9139482. http://dx.doi.org/10.1016/S0264-410X(96)00183-1.
http://dx.doi.org/10.1016/S0264-410X(96)...
; PAEPENMÜLLER & MÜLLER-GOYMANN, 2014Paepenmüller T, Müller-Goymann CC. Influence of Quil A on liposomal membranes. Int J Pharm 2014; 475(1-2): 138-146. PMid:25107288. http://dx.doi.org/10.1016/j.ijpharm.2014.08.007.
http://dx.doi.org/10.1016/j.ijpharm.2014...
). Additionally, the Quil-A adjuvant is widely used in animals, has a low cost and a simple design, and is generally safe (COX & COULTER, 1997Cox JC, Coulter AR. Adjuvants - a classification and review of their modes of action. Vaccine 1997; 15(3): 248-256. PMid:9139482. http://dx.doi.org/10.1016/S0264-410X(96)00183-1.
http://dx.doi.org/10.1016/S0264-410X(96)...
; GARCIA et al., 2007Garcia JL, Navarro IT, Biazzono L, Freire RL, Guimarães JS Jr, Cryssafidis AL, et al. Protective activity against oocyst shedding in cats vaccinated with crude rhoptry proteins of the Toxoplasma gondii by the intranasal route. Vet Parasitol 2007; 145(3-4): 197-206. PMid:17296268. http://dx.doi.org/10.1016/j.vetpar.2007.01.007.
http://dx.doi.org/10.1016/j.vetpar.2007....
; IGARASHI et al., 2010Igarashi M, Zulpo DL, Cunha IAL, Barros LD, Pereira VF, Taroda A, et al. Toxoplasma gondii: humoral and cellular immune response of BALB/c mice immunized via intranasal route with rTgROP2. Rev Bras Parasitol Vet 2010; 19(4): 210-216. PMid:21184696. http://dx.doi.org/10.1590/S1984-29612010000400004.
http://dx.doi.org/10.1590/S1984-29612010...
; CUNHA et al., 2012Cunha IAL, Zulpo DL, Bogado ALG, Barros LD, Taroda A, Igarashi M, et al. Humoral and cellular immune responses in pigs immunized intranasally with crude rhoptry proteins of plus Quil-A. Toxoplasma gondiiVet Parasitol 2012; 186(3-4): 216-221. PMid:22137347. http://dx.doi.org/10.1016/j.vetpar.2011.11.034.
http://dx.doi.org/10.1016/j.vetpar.2011....
).

Herein, ROP2 protein was chosen because it is the major protein involved in the biogenesis and maintenance of rhoptry structure, parasite invasion, replication and host cell interaction (NAKAAR et al., 2003Nakaar V, Ngô HM, Aaronson EP, Coppens I, Stedman TT, Joiner KA. Pleiotropic effect due to targeted depletion of secretory rhoptry protein ROP2 in Toxoplasma gondii.J Cell Sci 2003; 116(11): 2311-2320. PMid:12711703. http://dx.doi.org/10.1242/jcs.00382.
http://dx.doi.org/10.1242/jcs.00382...
); it has been observed in all subgroups (I, II, and III) and stages of the life of the parasite (FISCHER et al., 1996Fischer HG, Reichmann G, Hadding U. Toxoplasma proteins recognized by protective T lymphocytes. Curr Top Microbiol Immunol 1996; 219(1): 175-182. PMid:8791699.). Additionally, ROP2 was recognized by a human T-cell clone isolated from an immune donor specifically for the parasite and produced high levels of IFN-γ (SAAVEDRA et al., 1991Saavedra R, De Meuter F, Decourt JL, Hérion P. Human T cell clone identifies a potentially protective 54-kDa protein antigen of Toxoplasma gondii cloned and expressed in Escherichia coli.J Immunol 1991; 147(6): 1975-1982. PMid:1716289.). For all of these reasons, ROP2 has been used for vaccine studies (UGGLA et al., 1988Uggla A, Araujo FG, Lunden A, Lovgren K, Remington JS, Morein B. Immunizing effects in mice of two iscom preparations. Toxoplasma gondiiZentralbl Veterinarmed B 1988; 35(4): 311-314. PMid:3420996.; VERCAMMEN et al., 2000Vercammen M, Scorza T, Huygen K, De Braekeleer J, Diet R, Jacobs D, et al. DNA vaccination with genes encoding antigens GRA1, GRA7, and ROP2 induces partially protective immunity against lethal challenge in mice. Toxoplasma gondiiInfect Immun 2000; 68(1): 38-45. PMid:10603366. http://dx.doi.org/10.1128/IAI.68.1.38-45.2000.
http://dx.doi.org/10.1128/IAI.68.1.38-45...
; LEYVA et al., 2001Leyva R, Hérion P, Saavedra R. Genetic immunization with plasmid DNA coding for the ROP2 protein of Toxoplasma gondii.Parasitol Res 2001; 87(1): 70-79. PMid:11199854. http://dx.doi.org/10.1007/s004360000296.
http://dx.doi.org/10.1007/s004360000296...
; DZIADEK et al., 2009Dziadek B, Gatkowska J, Brzostek A, Dziadek J, Dzitko K, Dlugonska H. Toxoplasma gondii: The immunogenic and protective efficacy of recombinant ROP2 and ROP4 rhoptry proteins in murine experimental toxoplasmosis. Exp Parasitol 2009; 123(1): 81-89. PMid:19508869. http://dx.doi.org/10.1016/j.exppara.2009.06.002.
http://dx.doi.org/10.1016/j.exppara.2009...
; IGARASHI et al., 2010Igarashi M, Zulpo DL, Cunha IAL, Barros LD, Pereira VF, Taroda A, et al. Toxoplasma gondii: humoral and cellular immune response of BALB/c mice immunized via intranasal route with rTgROP2. Rev Bras Parasitol Vet 2010; 19(4): 210-216. PMid:21184696. http://dx.doi.org/10.1590/S1984-29612010000400004.
http://dx.doi.org/10.1590/S1984-29612010...
; DZIADEK & BRZOSTEK, 2012Dziadek B, Brzostek A. Recombinant ROP2, ROP4, GRA4 and SAG1 antigen-cocktails as possible tools for immunoprophylaxis of toxoplasmosis: what’s next? Bioengineered 2012; 3(6): 358-364. PMid:22892593. http://dx.doi.org/10.4161/bioe.21541.
http://dx.doi.org/10.4161/bioe.21541...
).

According to genotyping, all oocyst samples were characterized as type II. This was expected because the challenge was performed with ME49, which is a type II clonal strain. The type II strain is the most common strain associated with human toxoplasmosis in patients with AIDS, as well as in congenital infections in animals and humans (HOWE & SIBLEY, 1995Howe DK, Sibley LD. comprises three clonal lineages: correlation of parasite genotype with human disease. Toxoplasma gondiiJ Infect Dis 1995; 172(6): 1561-1566. PMid:7594717. http://dx.doi.org/10.1093/infdis/172.6.1561.
http://dx.doi.org/10.1093/infdis/172.6.1...
). A vaccine that decreases oocyst shedding of the type II strain could prevent environmental contamination and may reduce the incidence of new cases of toxoplasmosis in livestock and humans.

In summary, despite of lesser oocysts production in immunized group than control groups, it was not possible to associate the use of rROP2 via nasal route with protection against T. gondii oocyst shedding. We are now working to produce more recombinant proteins (ROP18, GRA5, GRA7) from T. gondii to use in combination with rROP2 what could improve the efficacy of this type of vaccine. Further studies should be conducted to evaluate the effect of Quil-A on the immune system of cats against T. gondii.

Acknowledgements

The authors would like to thank Coordenação de Aperfeicoamento de Pessoal de Nivel Superior (CAPES), and Conselho Nacional de Desenvolvimento Cientifico e Tecnologico (CNPq, grants 474924/2011-4; 303901/2012-8; 443026/2014-9), and Fundação Araucária (121/2010). JL Garcia and IT Navarro are recipient of CNPq fellowships.

References

  • Bonenfant C, Dimier-Poisson I, Velge-Roussel F, Buzoni-Gatel D, Del Giudice G, Rappuoli R, et al. Intranasal immunization with SAG1 and nontoxic mutant heat-labile enterotoxins protects mice against Toxoplasma gondii.Infect Immun 2001; 69(3): 1605-1612. PMid:11179334. http://dx.doi.org/10.1128/IAI.69.3.1605-1612.2001
    » http://dx.doi.org/10.1128/IAI.69.3.1605-1612.2001
  • Boyer K, Hill D, Mui E, Wroblewski K, Karrison T, Dubey JP, et al. Unrecognized ingestion of oocysts leads to congenital toxoplasmosis and causes epidemics in north america. Toxoplasma gondiiClin Infect Dis 2011; 53(11): 1081-1089. PMid:22021924. http://dx.doi.org/10.1093/cid/cir667
    » http://dx.doi.org/10.1093/cid/cir667
  • Burney DP, Lappin MR, Cooper C, Spilker MM. Detection of specific IgA in the serum of cats. Toxoplasma gondiiAm J Vet Res 1995; 56(6): 769-773. PMid:7653886.
  • Cañón-Franco WA, Araújo FA, López-Orozco N, Jardim MM, Keid LB, Dalla-Rosa C, et al. in free-ranging wild small felids from Brazil: molecular detection and genotypic characterization. Toxoplasma gondiiVet Parasitol 2013; 197(3-4): 462-469. PMid:23932730. http://dx.doi.org/10.1016/j.vetpar.2013.07.019
    » http://dx.doi.org/10.1016/j.vetpar.2013.07.019
  • Carellos EVM, Caiaffa WT, Andrade GMQ, Abreu MNS, Januário JN. Congenital toxoplasmosis in the state of Minas Gerais, Brazil: a neglected infectious disease? Epidemiol Infect 2014; 142(3): 644-655. PMid:23823156. http://dx.doi.org/10.1017/S0950268813001507
    » http://dx.doi.org/10.1017/S0950268813001507
  • Cornelissen JB, Van Der Giessen JW, Takumi K, Teunis PF, Wisselink HJ. An experimental dose response challenge model to study therapeutic or vaccine efficacy in cats. Toxoplasma gondiiPLoS One 2014; 9(9): e104740. PMid:25184619. http://dx.doi.org/10.1371/journal.pone.0104740
    » http://dx.doi.org/10.1371/journal.pone.0104740
  • Cox JC, Coulter AR. Adjuvants - a classification and review of their modes of action. Vaccine 1997; 15(3): 248-256. PMid:9139482. http://dx.doi.org/10.1016/S0264-410X(96)00183-1
    » http://dx.doi.org/10.1016/S0264-410X(96)00183-1
  • Cunha IAL, Zulpo DL, Bogado ALG, Barros LD, Taroda A, Igarashi M, et al. Humoral and cellular immune responses in pigs immunized intranasally with crude rhoptry proteins of plus Quil-A. Toxoplasma gondiiVet Parasitol 2012; 186(3-4): 216-221. PMid:22137347. http://dx.doi.org/10.1016/j.vetpar.2011.11.034
    » http://dx.doi.org/10.1016/j.vetpar.2011.11.034
  • Dabritz HA, Miller MA, Atwill ER, Gardner IA, Leutenegger CM, Melli AC, et al. Detection of -like oocysts in cat feces and estimates of the environmental oocyst burden. Toxoplasma gondiiJ Am Vet Med Assoc 2007; 231(11): 1676-1684. PMid:18052801. http://dx.doi.org/10.2460/javma.231.11.1676
    » http://dx.doi.org/10.2460/javma.231.11.1676
  • Decavalas G, Papapetropoulou M, Giannoulaki E, Tzigounis V, Kondakis XG. Prevalence of Toxoplasma gondii antibodies in gravidas and recently aborted women and study of risk factors. Eur J Epidemiol 1990; 6(2): 223-226. PMid:2361547. http://dx.doi.org/10.1007/BF00145798
    » http://dx.doi.org/10.1007/BF00145798
  • Dias RA, Navarro IT, Ruffolo BB, Bugni FM, Castro MV, Freire RL. in fresh pork sausage and seroprevalence in butchers from factories in Londrina, Paraná state, Brazil. Toxoplasma gondiiRev Inst Med Trop 2005; 47(4): 185-189. PMid:16138196. http://dx.doi.org/10.1590/S0036-46652005000400002
    » http://dx.doi.org/10.1590/S0036-46652005000400002
  • Dimier-Poisson I, Aline F, Bout D, Mévélec MN. Induction of protective immunity against toxoplasmosis in mice by immunization with Toxoplasma gondii RNA. Vaccine 2006; 24(10): 1705-1709. PMid:16256251. http://dx.doi.org/10.1016/j.vaccine.2005.09.053
    » http://dx.doi.org/10.1016/j.vaccine.2005.09.053
  • Dubey JP. Duration of immunity to shedding of Toxoplasma gondii oocysts by cats. J Parasitol 1995; 81(3): 410-415. PMid:7776126. http://dx.doi.org/10.2307/3283823
    » http://dx.doi.org/10.2307/3283823
  • Dubey JP, Lappin MR, Thulliez P. Long-term antibody responses of cats fed tissue cysts. Toxoplasma gondiiJ Parasitol 1995; 81(6): 887-893. PMid:8544059. http://dx.doi.org/10.2307/3284035
    » http://dx.doi.org/10.2307/3284035
  • Dubey JP, Lunney JK, Shen SK, Kwok OC. Immunity to toxoplasmosis in pigs fed irradiated Toxoplasma gondii oocysts. J Parasitol 1998; 84(4): 749-752. PMid:9714205. http://dx.doi.org/10.2307/3284582
    » http://dx.doi.org/10.2307/3284582
  • Dubey JP, Thulliez P. Serologic diagnosis of toxoplasmosis in cats fed tissue cysts. Toxoplasma gondiiJ Am Vet Med Assoc 1989; 194(9): 1297-1299. PMid:2722663.
  • Dubey JP, Thulliez P. Persistence of tissue cysts in edible tissues of cattle fed oocysts. Toxoplasma gondiiAm J Vet Res 1993; 54(2): 270-273. PMid:8430937.
  • Dziadek B, Brzostek A. Recombinant ROP2, ROP4, GRA4 and SAG1 antigen-cocktails as possible tools for immunoprophylaxis of toxoplasmosis: what’s next? Bioengineered 2012; 3(6): 358-364. PMid:22892593. http://dx.doi.org/10.4161/bioe.21541
    » http://dx.doi.org/10.4161/bioe.21541
  • Dziadek B, Gatkowska J, Brzostek A, Dziadek J, Dzitko K, Dlugonska H. Toxoplasma gondii: The immunogenic and protective efficacy of recombinant ROP2 and ROP4 rhoptry proteins in murine experimental toxoplasmosis. Exp Parasitol 2009; 123(1): 81-89. PMid:19508869. http://dx.doi.org/10.1016/j.exppara.2009.06.002
    » http://dx.doi.org/10.1016/j.exppara.2009.06.002
  • Fischer HG, Reichmann G, Hadding U. Toxoplasma proteins recognized by protective T lymphocytes. Curr Top Microbiol Immunol 1996; 219(1): 175-182. PMid:8791699.
  • Frenkel JK, Pfefferkorn ER, Smith DD, Fishback JL. Prospective vaccine prepared from a new mutant of for use in cats. Toxoplasma gondiiAm J Vet Res 1991; 52(5): 759-763. PMid:1854103.
  • Frenkel JK, Smith DD. Immunization of cats against shedding of Toxoplasma oocysts. J Parasitol 1982; 68(5): 744-748. PMid:7131181. http://dx.doi.org/10.2307/3280978
    » http://dx.doi.org/10.2307/3280978
  • Freyre A, Choromanski L, Fishback JL, Popiel I. Immunization of cats with tissue cysts, bradyzoites, and tachyzoites of the T-263 strain of Toxoplasma gondii.J Parasitol 1993; 79(5): 716-719. PMid:8410543. http://dx.doi.org/10.2307/3283610
    » http://dx.doi.org/10.2307/3283610
  • Garcia JL. Vaccination concepts against Toxoplasma gondii.Expert Rev Vaccines 2009; 8(2): 215-225. PMid:19196201. http://dx.doi.org/10.1586/14760584.8.2.215
    » http://dx.doi.org/10.1586/14760584.8.2.215
  • Garcia JL, Innes EA, Katzer F. Current progress toward vaccines against Toxoplasma gondii.Vaccine (Auckl) 2014; 4(1): 23-37. http://dx.doi.org/10.2147/VDT.S57474
    » http://dx.doi.org/10.2147/VDT.S57474
  • Garcia JL, Navarro IT, Biazzono L, Freire RL, Guimarães JS Jr, Cryssafidis AL, et al. Protective activity against oocyst shedding in cats vaccinated with crude rhoptry proteins of the Toxoplasma gondii by the intranasal route. Vet Parasitol 2007; 145(3-4): 197-206. PMid:17296268. http://dx.doi.org/10.1016/j.vetpar.2007.01.007
    » http://dx.doi.org/10.1016/j.vetpar.2007.01.007
  • Howe DK, Sibley LD. comprises three clonal lineages: correlation of parasite genotype with human disease. Toxoplasma gondiiJ Infect Dis 1995; 172(6): 1561-1566. PMid:7594717. http://dx.doi.org/10.1093/infdis/172.6.1561
    » http://dx.doi.org/10.1093/infdis/172.6.1561
  • Igarashi M, Kano F, Tamekuni K, Machado RZ, Navarro IT, Vidotto O, et al. Toxoplasma gondii: evaluation of an intranasal vaccine using recombinant proteins against brain cyst formation in BALB/c mice. Exp Parasitol 2008; 118(3): 386-392. PMid:18154953. http://dx.doi.org/10.1016/j.exppara.2007.10.002
    » http://dx.doi.org/10.1016/j.exppara.2007.10.002
  • Igarashi M, Zulpo DL, Cunha IAL, Barros LD, Pereira VF, Taroda A, et al. Toxoplasma gondii: humoral and cellular immune response of BALB/c mice immunized via intranasal route with rTgROP2. Rev Bras Parasitol Vet 2010; 19(4): 210-216. PMid:21184696. http://dx.doi.org/10.1590/S1984-29612010000400004
    » http://dx.doi.org/10.1590/S1984-29612010000400004
  • Innes EA, Bartley PM, Buxton D, Katzer F. Ovine toxoplasmosis. Parasitology 2009; 136(14): 1887-1894. PMid:19995468. http://dx.doi.org/10.1017/S0031182009991636
    » http://dx.doi.org/10.1017/S0031182009991636
  • Jenkins MC. Advances and prospects for subunit vaccines against protozoa of veterinary importance. Vet Parasitol 2001; 101(3-4): 291-310. PMid:11707303. http://dx.doi.org/10.1016/S0304-4017(01)00557-X
    » http://dx.doi.org/10.1016/S0304-4017(01)00557-X
  • Jones JL, Muccioli C, Belfort R Jr, Holland GN, Roberts JM, Silveira C. Recently acquired infection, Brazil. Toxoplasma gondiiEmerg Infect Dis 2006; 12(4): 582-587. PMid:16704805. http://dx.doi.org/10.3201/eid1204.051081
    » http://dx.doi.org/10.3201/eid1204.051081
  • Lappin MR, Bush DJ, Reduker DW. Feline serum antibody responses to and characterization of target antigens. Toxoplasma gondiiJ Parasitol 1994; 80(1): 73-80. PMid:8308661. http://dx.doi.org/10.2307/3283348
    » http://dx.doi.org/10.2307/3283348
  • Leyva R, Hérion P, Saavedra R. Genetic immunization with plasmid DNA coding for the ROP2 protein of Toxoplasma gondii.Parasitol Res 2001; 87(1): 70-79. PMid:11199854. http://dx.doi.org/10.1007/s004360000296
    » http://dx.doi.org/10.1007/s004360000296
  • Lopes-Mori FMR, Mitsuka-Breganó R, Bittencourt LHFB, Dias RCF, Gonçalves DD, Capobiango JD, et al. Gestational toxoplasmosis in Paraná State, Brazil: prevalence of IgG antibodies and associated risk factors. Braz J Infect Dis 2013; 17(4): 405-409. PMid:23665010. http://dx.doi.org/10.1016/j.bjid.2012.12.003
    » http://dx.doi.org/10.1016/j.bjid.2012.12.003
  • Lunde MN, Jacobs L. Antigenic differences between endozoites and cystozoites of Toxoplasma gondii.J Parasitol 1983; 69(5): 806-808. PMid:6200590. http://dx.doi.org/10.2307/3281034
    » http://dx.doi.org/10.2307/3281034
  • Mateus-Pinilla NE, Dubey JP, Choromanski L, Weigel RM. A field trial of the effectiveness of a feline Toxoplasma gondii vaccine in reducing . T. gondii exposure for swineJ Parasitol 1999; 85(5): 855-860. PMid:10577720. http://dx.doi.org/10.2307/3285821
    » http://dx.doi.org/10.2307/3285821
  • McLeod R, Frenkel JK, Estes RG, Mack DG, Eisenhauer PB, Gibori G. Subcutaneous and intestinal vaccination with tachyzoites of and acquisition of immunity to peroral and congenital toxoplasma challenge. Toxoplasma gondiiJ Immunol 1988; 140(5): 1632-1637. PMid:3346545.
  • Mishima M, Xuan X, Yokoyama N, Igarashi I, Fujisaki K, Nagasawa H, et al. Recombinant feline herpesvirus type 1 expressing ROP2 antigen inducible protective immunity in cats. Toxoplasma gondiParasitol Res 2002; 88(2): 144-149. PMid:11936503. http://dx.doi.org/10.1007/s004360100429
    » http://dx.doi.org/10.1007/s004360100429
  • Nakaar V, Ngô HM, Aaronson EP, Coppens I, Stedman TT, Joiner KA. Pleiotropic effect due to targeted depletion of secretory rhoptry protein ROP2 in Toxoplasma gondii.J Cell Sci 2003; 116(11): 2311-2320. PMid:12711703. http://dx.doi.org/10.1242/jcs.00382
    » http://dx.doi.org/10.1242/jcs.00382
  • Navarro IT, Vidotto O, Giraldi N, Mitsuka R. Resistance of to sodium chloride and condiments in pork sausage. Toxoplasma gondiiBol Oficina Sanit Panam 1992; 112(2): 138-143. PMid:1531110.
  • Nieto SO, Meléndez RD. Seroprevalence of Toxoplasma gondii in goats from arid zones of Venezuela. J Parasitol 1998; 84(1): 190-191. PMid:9488366. http://dx.doi.org/10.2307/3284559
    » http://dx.doi.org/10.2307/3284559
  • Paepenmüller T, Müller-Goymann CC. Influence of Quil A on liposomal membranes. Int J Pharm 2014; 475(1-2): 138-146. PMid:25107288. http://dx.doi.org/10.1016/j.ijpharm.2014.08.007
    » http://dx.doi.org/10.1016/j.ijpharm.2014.08.007
  • Prestrud KW, Asbakk K, Mork T, Fuglei E, Tryland M, Su C. Direct high-resolution genotyping of Toxoplasma gondii in arctic foxes () in the remote arctic svalbard archipelago reveals widespread clonal Type II lineage. Vulpes lagopusVet Parasitol 2008; 158(1-2): 121-128. PMid:18922642. http://dx.doi.org/10.1016/j.vetpar.2008.08.020
    » http://dx.doi.org/10.1016/j.vetpar.2008.08.020
  • Saavedra R, De Meuter F, Decourt JL, Hérion P. Human T cell clone identifies a potentially protective 54-kDa protein antigen of Toxoplasma gondii cloned and expressed in Escherichia coli.J Immunol 1991; 147(6): 1975-1982. PMid:1716289.
  • Sabin AB. Toxoplasmic encephalitis in children. J Am Vet Med Assoc 1941; 116(9): 801-807. http://dx.doi.org/10.1001/jama.1941.02820090001001
    » http://dx.doi.org/10.1001/jama.1941.02820090001001
  • Santos TR, Nunes CM, Luvizotto MCR, Moura AB, Lopes WDZ, Costa AJ, et al. Detection of oocysts in environmental samples from public schools. Toxoplasma gondiiVet Parasitol 2010; 171(1-2): 53-57. PMid:20347524. http://dx.doi.org/10.1016/j.vetpar.2010.02.045
    » http://dx.doi.org/10.1016/j.vetpar.2010.02.045
  • Silva RC, Langoni H. Risk factors and molecular typing of isolated from ostriches (Toxoplasma gondiiStruthio camelus) from a Brazilian slaughterhouse. Vet Parasitol 2016; 225(30): 73-80. PMid:27369578. http://dx.doi.org/10.1016/j.vetpar.2016.06.001
    » http://dx.doi.org/10.1016/j.vetpar.2016.06.001
  • Su C, Shwab EK, Zhou P, Zhu XQ, Dubey JP. Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii.Parasitology 2010; 137(1): 1-11. PMid:19765337. http://dx.doi.org/10.1017/S0031182009991065
    » http://dx.doi.org/10.1017/S0031182009991065
  • Uggla A, Araujo FG, Lunden A, Lovgren K, Remington JS, Morein B. Immunizing effects in mice of two iscom preparations. Toxoplasma gondiiZentralbl Veterinarmed B 1988; 35(4): 311-314. PMid:3420996.
  • Vercammen M, Scorza T, Huygen K, De Braekeleer J, Diet R, Jacobs D, et al. DNA vaccination with genes encoding antigens GRA1, GRA7, and ROP2 induces partially protective immunity against lethal challenge in mice. Toxoplasma gondiiInfect Immun 2000; 68(1): 38-45. PMid:10603366. http://dx.doi.org/10.1128/IAI.68.1.38-45.2000
    » http://dx.doi.org/10.1128/IAI.68.1.38-45.2000
  • Verma R, Khanna P. Development of Toxoplasma gondii vaccine: a global challenge. Hum Vaccin Immunother 2013; 9(2): 291-293. PMid:23111123. http://dx.doi.org/10.4161/hv.22474
    » http://dx.doi.org/10.4161/hv.22474
  • Wasmuth J, Daub J, Peregrín-Alvarez JM, Finney CAM, Parkinson J. The origins of apicomplexan sequence innovation. Genome Res 2009; 19(7): 1202-1213. PMid:19363216. http://dx.doi.org/10.1101/gr.083386.108
    » http://dx.doi.org/10.1101/gr.083386.108
  • Zulpo DL, Headley SA, Biazzono L, Cunha IAL, Igarashi M, Barros LD, et al. Oocyst shedding in cats vaccinated by the nasal and rectal routes with crude rhoptry proteins of Toxoplasma gondii.Exp Parasitol 2012; 131(2): 223-230. PMid:22542988. http://dx.doi.org/10.1016/j.exppara.2012.04.006
    » http://dx.doi.org/10.1016/j.exppara.2012.04.006

Publication Dates

  • Publication in this collection
    Jan-Mar 2017

History

  • Received
    17 Nov 2016
  • Accepted
    07 Feb 2017
Colégio Brasileiro de Parasitologia Veterinária FCAV/UNESP - Departamento de Patologia Veterinária, Via de acesso Prof. Paulo Donato Castellane s/n, Zona Rural, , 14884-900 Jaboticabal - SP, Brasil, Fone: (16) 3209-7100 RAMAL 7934 - Jaboticabal - SP - Brazil
E-mail: cbpv_rbpv.fcav@unesp.br