Revista Brasileira de Sementes, Volume: 24, Issue: 2, Published: 2002
  • The effect of seed germination and seeding rate on corn stand establishment and yield

    Andreoli, Claudinei; Andrade, Ramiro V.; Zamora, Sérgio A.; Gordon, Monica

    Abstract in Portuguese:

    Uma das principais causas da baixa produtividade de milho é a qualidade da semente, que afeta o estande inicial, o vigor das plantas e, conseqüentemente, a produtividade. O objetivo deste trabalho foi determinar o efeito da germinação, um dos principais componentes da qualidade da semente e a densidade de semeadura no estabelecimento da cultura e na produtividade de milho. Quatro lotes de sementes de milho híbrido BRS 201, com germinação de 95%, 90%, 85% e 75%, foram semeados em três densidades de semeadura: 50, 60 e 70 mil sementes/ha na Embrapa Milho e Sorgo, Sete Lagoas. MG, em 1996/97 e 1997/98. Os parâmetros avaliados foram: emergência de plântulas 10 dias após a semeadura, índice de velocidade de emergência (IVE), número de espigas/ha, número de plantas/ha, produção de espigas/ha e produção de grãos/ha. A utilização de sementes com germinação inferior a 90% provocou reduções acentuadas na emergência de plântulas em campo, no número de plantas e consequentemente, na produtividade do milho BRS 201. O aumento da densidade de 50 para 70 mil sementes/ha na semeadura não compensou a redução da qualidade de semente. Para o acréscimo de 15% na germinação, foi observado, em média, um ganho de produtividade de 30%. Com base nos resultados deste trabalho, recomenda-se aos produtores de milho, a utilização de lotes de semente com germinação superior a 90% e densidade de semeadura entre 50 e 60 mil sementes/ha.

    Abstract in English:

    One of the main causes of low corn yield in Brazil is low seed quality that affects stand establishment and yield. The main goals of this research were to determine the effect of seed quality and seeding rate on corn stand establishment and yield. Four seed lots of hybrid corn BRS 201, with initial germination of 95%, 90%, 85% and 75% were sown at three seeding rates: 50, 60 and 70 thousand seeds/ha at Embrapa Milho and Sorgo, Sete Lagoas, MG, in 1996/97 and 1997/98. The parameters evaluated were: field emergence at 10 days after sowing, rate of emergence, ear number/ha, plant population/ha, ear production/ha and kernel yield/ha. Low seed vigor markedly reduced field emergence, plant vigor, number of plants, and yield. Increasing seeding rate did not overcome seed quality. There was a yield gain of 30% for seed quality improvement of 15%. Based on the results of this trial, we recommend that corn growers use seed lots with germination over 90% and seeding rate between 50 and 60.000 seeds/ha.
  • Procedures for cold test in maize seeds: prechilling and position of substrate inside the cold room

    Caseiro, Roseli Fátima; Marcos Filho, Julio

    Abstract in Portuguese:

    O teste de frio realizado em laboratórios brasileiros para avaliar o vigor das sementes de milho, geralmente é conduzido em caixas plásticas de 47 x 30 x 11cm, utilizando como substrato, aproximadamente 16 kg da mistura terra e areia. A necessidade do pré-resfriamento e a disposição do substrato no interior da câmara fria constituem fatores ainda não completamente definidos para a padronização desse teste. A pesquisa foi conduzida utilizando-se amostras de sementes de milho submetidas a três tratamentos: substrato e água não resfriados (T1); água previamente resfriada a 10ºC (T2) e substrato e água previamente resfriados a 10ºC (T3). Ao serem colocadas na câmara fria, quatro caixas representando cada tratamento foram superpostas, formando pilhas, e outras quatro foram dispostas horizontalmente ("lado a lado"). O resfriamento do substrato, no interior da câmara fria, foi monitorado através de avaliações da temperatura 2, 4, 8 e 26 horas após a instalação do teste. De acordo com o procedimento normalmente utilizado para a condução do teste de frio, após 7 dias as caixas foram transferidas para ambiente de laboratório e, a avaliação da germinação, realizada aos 7 dias após a transferência. Os resultados indicaram que a alternativa substrato e água pré-resfriados a 10ºC, em caixas dispostas horizontalmente, confere maior uniformidade ao teste de frio para sementes de milho, produzindo resultados consistentes e próximos da padronização.

    Abstract in English:

    The cold test for evaluating maize seed vigor is usually performed in plastic deep-boxes (47 x 30 x 11cm) filled with approximately 16 kg of sand/soil mixture. This study was conducted to verify the influence of prechilling the substrate in the cold test and of the arrangement of deep-boxes inside the cold room (stacked or placed side by side). These factors are not yet completely defined and contribute significantly to variations in cold test results in Brazilian seed laboratories. Maize seeds were submitted to three treatments: substrate and water without prechilling (T1); water prechilled to 10ºC before planting (T2) and substrate and water prechilled to 10ºC before planting (T3). Four deep-boxes of each treatment were stacked and 4 were placed side by side in the cold room. Prechilling of substrate inside the cold room was monitored by evaluating the substratum temperature at 2, 4, 8 and 26 hours after planting. After 7 days in cold chamber, the boxes were transferred to the laboratory (± 25ºC) and the germination was recorded 7 days after transfering. Results showed that the alternative "substrate and water prechilled to 10ºC (T3)", placed side by side, provided uniform conditions for the cold test in maize, producing more consistent results.
  • Comparison of vigour methods to evaluate tomato seeds

    Barros, Daniella Inácio; Nunes, Helber Véras; Dias, Denise Cunha Fernandes S.; Bhering, Maria Carmen

    Abstract in Portuguese:

    Sementes de tomate cultivar Santa Clara, representadas por quatro lotes, foram avaliadas com o objetivo de estudar a eficiência de diferentes testes de vigor na determinação da qualidade fisiológica de sementes desta espécie. Foram realizados os testes de germinação, primeira contagem de germinação, germinação a baixa temperatura, emergência das plântulas em solo, envelhecimento acelerado e deterioração controlada. Os resultados obtidos permitiram concluir que o teste de envelhecimento acelerado e a primeira contagem do teste de germinação não foram eficientes para separar os lotes em diferentes níveis de vigor. Os testes de germinação a baixa temperatura (18ºC) e emergência das plântulas em solo permitiram agrupar os lotes em dois níveis de vigor. O teste de deterioração controlada a 41ºC com o período de 48 horas e sementes com grau de umidade de 24% mostrou-se mais promissor, pois permitiu separar os lotes em níveis de vigor, apresentando similaridade com a classificação fornecida pelos resultados dos testes de germinação a baixa temperatura e emergência das plântulas em solo.

    Abstract in English:

    The objective of this study was to compare different methods for vigour evaluation of tomato seeds. Four seed lots of the Santa Clara cultivar were evaluated by the following tests: standard germination, first count of germination test, cool germination, accelerated aging, controlled deterioration and seedling emergence in soil. It was concluded that the accelerated aging and the first count of germination tests were not efficient in detecting differences among vigour levels of seed lots seed lot vigor levels. The cool germination and seedling emergence in soil tests identified seed lots of with high and low vigour levels. Similar classification in vigour levels were was obtained by the controlled deterioration test conducted at 41ºC for 48h and 24% seed moisture content.
  • Desiccation tolerance in coffee seeds (Coffea arabica L.)

    Brandão Junior, Delacyr da Silva; Vieira, Maria das Graças Guimarães Carvalho; Guimarães, Renato Mendes; Hilhorst, Henk W.M.

    Abstract in Portuguese:

    A aquisição da tolerância à dessecação pode ocorrer durante o desenvolvimento das sementes de diversas espécies. Entretanto, para sementes de cafeeiro, os resultados apresentados pela literatura ainda não são conclusivos. A presente pesquisa foi desenvolvida com os objetivos de verificar em que estádio de desenvolvimento sementes de Coffea arabica adquirem tolerância à dessecação e o efeito imediato e ao longo do armazenamento e da secagem na viabilidade e no vigor destas sementes. Foram utilizadas sementes de cafeeiro da cultivar Acaiá Cerrado colhidas nos estádios verde (chumbão), verde cana e cereja. Uma amostra das sementes não foi submetida à secagem (controle) e outra foi secada em estufa de circulação forçada, regulada à temperatura constante de 30ºC, até atingir grau de umidade de 15%. Posteriormente, as sementes foram acondicionadas em recipientes de vidro de 200 mL hermeticamente fechados e mantidos em câmara à temperatura de 10ºC e 50% UR. As avaliações foram efetuadas aos zero, 3, 6 e 9 meses de armazenamento, sendo avaliado o grau de umidade, a qualidade fisiológica, por meio dos testes de germinação, protrusão radicular, percentagem de raízes secundárias, emergência em câmara de crescimento e índice de velocidade de emergência. De acordo com os resultados, sementes de cafeeiro apresentam elevação do nível de tolerância à dessecação à medida em que se desenvolvem. Sementes secadas a 15% de umidade mantêm a qualidade fisiológica ao longo de nove meses de armazenamento sob condições de 10ºC e 50% de UR e embalagem hermética, enquanto as não secadas (50% de umidade) apresentam queda linear ao longo do armazenamento.

    Abstract in English:

    Desiccation tolerance acquisition is a phenomenon which may occur during the development of seeds of several species, but it has been little investigated for coffee seeds. The present research was carried out to ascertain at which stage of coffee seed development tolerance to desiccation is acquired. Seeds of Coffea arabica cultivar Acaiá Cerrado harvested at three maturation stages, green, yellow and reddish were used. Part of the seeds was dried in forced air, under constant temperature of 30ºC until the seed moisture content reached 15%. Then the seeds were stored in hermetic containers in a cool chamber at 10ºC and 50% relative humidity. The evaluation was made after zero, 3, 6 and 9 months of storage, looking at moisture content, physiological conditions through the germination test, radical protrusion, percentage of secondary roots, emergence in growth room, emergence speed index. According to the results it was possible to conclude that coffee seeds present an increased desiccation tolerance as they reach later development stages. Seeds harvested at the green and yellow stages presented a decline in the production of secondary roots and percentage of seedling emergence. Drying seeds to 15% moisture content provided conditions to keep physiological quality throughout 9 months storage at 10ºC and 50% relative humidity. Non dried seeds (50% moisture content) presented a linear reduction in the physiological quality when stored at 10ºC, 50% relative humidity in hermetic containers.
  • Comparison of methods to evaluate the physiological quality in seeds of calendula

    Silveira, Maria Angelica Moreira; Villela, Francisco Amaral; Tillmann, Maria Ângela André

    Abstract in Portuguese:

    A calêndula (Calendula officinalis L.) é uma planta com propriedades medicinais utilizada na produção de fitoterápicos e na indústria de cosméticos. A semente é insumo básico, devendo atender aos requisitos de qualidade fisiológica para garantir o estabelecimento de cultivos com alta produtividade. Para avaliar a eficiência de métodos que permitam separar lotes de sementes de calêndula em níveis de vigor, foram utilizados quatro lotes com diferentes origens e tempos de armazenamento. Os lotes foram avaliados qualitativamente pelos testes de germinação, teor de água das sementes, peso de matéria seca das sementes, peso de 1000 sementes, primeira contagem da germinação, emissão de raiz primária, condutividade elétrica, emergência de plântulas, índice de velocidade de emergência das plântulas, comprimento de plântulas, peso de matéria verde e seca de plântulas. Os testes de primeira contagem da germinação, emissão da raiz primária e índice de velocidade de emergência das plântulas permitem a separação dos lotes de sementes de calêndula em níveis de vigor. A combinação das informações fornecidas pela comparação de médias e pela análise de correlação entre diferentes testes de vigor e o teste de emergência em campo possibilita melhor avaliação da qualidade de sementes.

    Abstract in English:

    Calendula (Calendula officinalis L.) is a plant with medicinal properties used in phytotherapic production and in the cosmetic industry. Seed is the basic input, so requirements of physiological quality to guarantee the establishment of cultivations with high productivity is essencial. Four lots were used with different origins and storage times of storage to evaluate the efficiency of methods that allow separation of lots of calendula seeds in vigor levels. The lots were evaluated using germination test, seed moisture content, seed dry matter weight, weight of 1000 seeds, first count of the germination test, emission of primary root, electrical conductivity, seedling emergence, speed of seedling emergence, seedling length, seedling green matter and dry matter weight. The tests of first count of the germination, emission of the primary root, and speed of seedling emergence index allowed the separation of the lots in vigor levels. The combination of the information supplied by the comparison of averages and for the correlation analysis between different vigor test and seedling emergency facilitates better evaluation of the seed quality.
  • Physiological maturation of calendula seeds (Calendula officinalis L.)

    Silveira, Maria Angelica Moreira; Villela, Francisco Amaral; Tillmann, Maria Ângela André

    Abstract in Portuguese:

    A pesquisa teve como objetivo estudar o processo de maturação das sementes de calêndula. A partir de 50% dos botões florais em antese, foi feita a marcação das flores, sendo a coleta das sementes realizada em seis épocas: 20, 24, 28, 32, 36 e 40 dias após a antese (DAA). Em cada coleta, as sementes foram separadas pelo tamanho (maior e menor), e classificadas conforme a Tabela de Munsell (Munsell,1977) conforme as colorações observadas: verde, verde claro, creme, marrom claro e marrom escuro. Em seguida, foram realizadas as determinações de teor de água, peso da matéria seca das sementes, germinação e avaliações de qualidade fisiológica: primeira contagem da germinação e emissão de raiz primária. O maior acúmulo de matéria seca ocorreu entre 28 e 32 DAA, quando ainda havia sementes com coloração verde claro, entretanto, aos 36 DAA as sementes mostraram maior viabilidade e vigor (primeira contagem da germinação e emissão de raiz primária) não havendo diferença entre sementes de maior e menor tamanho, que apresentavam colorações creme, marrom claro e marrom escuro. Embora não tenha ocorrido coincidência temporal entre acúmulo de matéria seca, germinação e vigor, a maturidade fisiológica ocorre entre 28 e 32 DAA, estando as sementes com teor de água médio de 36%, sendo indicada a colheita aos 36 DAA com teor de água médio de 20%, antes de ocorrer a deiscência dos frutos aos 40 DAA.

    Abstract in English:

    The experiment was carried out using vigorous plants placed in individual vases to study the maturation process of calendula seeds. When 50% of the florets in were anthesis, the flowers were selected. The seeds were harvested at six times after the anthesis: 20, 24, 28, 32, 36 and 40 days after the anthesis (DAA). At each harvest, the seeds, due to their disuniformity, were separated in larger (equal or longer or wider than 9,0 mm and 2,5 mm) and smaller, as well as for coloring: green, pale green, cream, paler brown and dark brown. The determinations were: moisture content, seed dry matter weight, germination test, first account of the germination and primary root emission. It was observed that the largest accumulation of dry matter occurred in the period between 28 and 32 DAA when there were still seeds with pale green coloration, but the germination and vigor (first account of the germination and emission of primary root) were superior to 36 DAA, and there was no difference between larger and smaller seeds and they presented cream, pale brown and dark brown colorings. Although there was no coincidence in time among dry matter accumulation, germination and vigor, it is possible to consider that the point of physiological maturity happened between 28 and 32 DAA with moisture content of 36%. Harvesting is suggested at 36 DAA with moisture content aT 20%, before fruit dehiscence of the fruits.
  • Sensibility of rice seed (Oryza sativa L.) submitted to chemical polluters originary from human activity

    Moraes, Dario Munt de; Abreu, Claudete Miranda; Melo, Paulo Trajano Burck Santos; Lima, Adriane Alves; Rodrigues, Rosimeri Rocha; Duarte, Giseli Loureiro

    Abstract in Portuguese:

    A contaminação de áreas com poluentes químicos pode ocasionar estresse na maioria das plantas. Assim, a finalidade desta pesquisa foi analisar e descrever o efeito de poluentes na germinação e no vigor de sementes de arroz. Foi utilizada uma amostra de sementes de arroz cv. BR-IRGA 410, safra 2000/2001. As sementes foram embebidas por uma hora nos seguintes poluentes químicos: fenol (C6H6O), ácido bórico (H3BO3), cloreto de amônio (NH4Cl) e potássio fosfato monobásico (KH2PO4), nas concentrações de zero (controle); cinco; 10 e 15mg l-1. Logo após a embebição as sementes foram submetidas ao teste de germinação; primeira contagem da germinação; índice de velocidade de emergência das plântulas; emergência das plântulas em casa de vegetação; condutividade elétrica; comprimento da parte aérea e das raízes das plântulas e massa da matéria fresca e seca da parte aérea e raízes das plântulas. Dentre os poluentes químicos, nas concentrações testadas, o NH4Cl e o KH2PO4, foram os que mais afetaram a qualidade fisiológica das sementes de arroz, acarretando diminuição no vigor.

    Abstract in English:

    The contamination of areas with chemical polluters may cause stress on the majority of plants. In such case, the purpose of this research was to evaluate and to describe the effect of the polluters on germination and vigor of the rice seeds submitted to chemical polluters from human activity. Rice seeds of cultivar BR IRGA 410, crop year 2000/2001 were used. The seeds were soaked up by one hour in the following chemical polluters: phenol (C6H6O), boric acid (H3BO3), chlorate ammonium (NH4Cl) and potassium phosphate monobasic (KH2PO4), on zero (control), 5, 10 and 15mg l-1 quantities. Thereupon the soaking, the seeds were evaluated through the germination test, the first count in the germination test, the emergency rate index of the seedlings, the emergency of the seedlings in greenhouse conditions, the electric conductivity, the length of shoot and roots of the seedlings and the dry weight of the root and shoot of the seedlings. Among the chemical polluters the NH4Cl and KH2PO4, were those which affected most the physiological quality of rice seeds causing decrease on the vigor.
  • Action of gibberellic acid (GA3) on dormancy and activity of alpha-amylase in rice seeds

    Vieira, Antônio Rodrigues; Vieira, Maria das Graças Guimarães Carvalho; Fraga, Antônio C.; Oliveira, João Almir; Santos, Custódio D. dos

    Abstract in Portuguese:

    Para avaliar a eficiência do ácido giberélico (GA3) na superação da dormência de sementes de arroz, bem como a atividade da enzima alfa-amilase como indicador do grau dessa dormência, foram utilizadas sementes da cultivar irrigada Urucuia, que apresentam alta intensidade de dormência pós-colheita. Para tanto, as sementes foram submetidas à pré-secagem em estufa de circulação forçada de ar a 40ºC por 7 dias e à submersão em 30 ml de soluções de GA3 nas concentrações de 0, 10, 30 e 60 mg/litro de H2O, nos tempos de 2, 24 e 36 horas. Após os tratamentos, foi determinada a atividade da alfa-amilase através da eletroforese em gel de poliacrilamida e da espectrofotometria. Simultaneamente, foi realizado o teste de germinação. Pelos resultados, observa-se que houve ganho na germinação e na atividade da alfa-amilase em maiores concentrações e tempos de embebição das sementes em GA3. A embebição das sementes em 60 mg GA3/litro H2O por 36 horas apresenta-se eficiente como um tratamento rápido na superação da dormência de sementes de arroz, sendo equivalente a estufa de circulação forçada de ar a 40ºC por 7 dias. A atividade da enzima alfa-amilase apresentou-se como um eficiente marcador do grau de dormência das sementes.

    Abstract in English:

    To evaluate the effectiveness of gibberellic acid (GA3) in breaking rice seed dormancy and the use of alpha-amylase enzyme activity as an indicator of the dormancy level, seed from the intensively dormant irrigated cultivar Urucuia were used. The seeds were submitted to a pre-drying process in a forced air circulation chamber under 40ºC during 7 days and submersed in 30 mL of GA3 solution under 0, 10, 30 and 60 mg/L H2O concentrations, during 2, 24 and 36 hours. After the treatments, the alpha-amylase activity was determined by using the polyacrilamide electrophoresis and spectrophotometry. At the same time, the germination test was made. The results indicated a gain in germination and in alpha-amylase activity in higher concentrations and soaking time of seeds in GA3. These observations support the conclusion that soaking seed in 60 mg GA3/L during 36 hours can be used as a quick and efficient treatment in breaking rice seed dormancy and is equivalent to the forced air circulation chamber at 40ºC during 7 days. The alpha-amylase enzyme activity proved to be as an efficient marker of the seeds dormancy level.
  • The flooding effects on the bean seed germination and vigor of bean seeds

    Custódio, Ceci Castilho; Machado Neto, Nelson Barbosa; Ito,; Vivan, Márcia Regina

    Abstract in Portuguese:

    Este trabalho foi conduzido no Laboratório de Análise de Sementes da Faculdade de Ciências Agrárias da Universidade Oeste Paulista (UNOESTE), Presidente Prudente - SP, com o objetivo de avaliar os efeitos causados pelo alagamento na germinação e no vigor de sementes de feijão. As sementes foram submetidas aos tratamentos de alagamento por períodos de 0, 8, 16, 24, 32, 40 e 48 horas a 25ºC. Durante os tratamentos foram realizadas as avaliações de grau de umidade inicial e final, e após os mesmos, teste de germinação e avaliação do comprimento de hipocótilo e de raiz, peso seco da parte aérea e raiz. Os resultados mostraram que a germinação e o vigor das sementes decresceram com o alagamento, havendo decréscimo médio de 55 pontos percentuais na germinação, com 8 horas de alagamento. Ocorreu diferenciação de lotes através da germinação com sementes que passaram por períodos de alagamento iguais ou superiores a 8 horas. O número de sementes mortas e a inibição ao desenvolvimento de raiz e hipocótilo foram crescentes com o aumento do período de submersão. Desta forma, concluiu-se que o alagamento, por 8 horas, pode causar prejuízos irreversíveis ao estabelecimento da cultura do feijoeiro, bem como, se empregado em laboratório, pode ser um bom indicativo para diferenciação de níveis de qualidade fisiológica em sementes de feijão.

    Abstract in English:

    This work study was carried out to evaluate the effects of different flooding periods during germination and in the bean seeds vigor at UNOESTE Seed Analysis Laboratory. Seeds were submitted to flooding periods of 0, 8, 16, 24, 32, 40 and 48h at 25ºC. Moisture content was taken before and after flooding periods. The germination test and physiological parameters, such as hypocotyl and root length and their dry weights, were obtained after periods of flooding. Results showed that germination and vigor decreased subsequently to flooding, germination decreased 55 percentage points after 8h of seed submersion. There were differentiation differences between among seed lots in germination tests after flooding periods equal to, or higher than 8h. Dead seed number and inhibition in hypocotyl and root development, shown in this work study, increased with the submersion time. In conclusion, eight hours of flooding cause irreversible damage to bean culture establishment, and the same periods of submersion, in the laboratory, could be a very good indicative to differentiate seed physiological quality.
  • Temperature and availability of oxygen in flooded rice seedling growth

    Wielewicki, Angélica Polenz; Barros, Antonio Carlos S. Albuquerque

    Abstract in Portuguese:

    Embora o Rio Grande do Sul seja responsável por cerca de 40 % da produção brasileira de arroz, a lavoura arrozeira gaúcha tem atravessado uma crise que está relacionada, entre outros fatores, com baixa competitividade, alto custo de produção e produtividade média abaixo do potencial genético dos genótipos utilizados. Uma das formas que se tem adotado para produzir respostas mais efetivas a essa crise reside na utilização do sistema pré-germinado, buscando diminuir custos de produção e aumentar a produtividade e, em função disso, ampliar a competitividade. Tendo em vista essas considerações, o presente trabalho tem como objetivos comparar o desenvolvimento inicial de plântulas de arroz de genótipos utilizados no RS (BR IRGA 409, BR IRGA 410, IRGA 416 e IRGA 417) sob diferentes temperaturas (20, 25 e 30ºC) e avaliar o crescimento inicial das plântulas em condições de aerobiose e anaerobiose. Nos tratamentos de anaerobiose as sementes ficaram 24 horas submersas, 24 horas em aerobiose e retornaram para a anaerobiose até o 14º dia. Os resultados dos testes permitem concluir que: a) o genótipo BR IRGA 409 mostrou-se menos adaptado à semeadura em anaerobiose, quando em temperatura de 20ºC ; b) em anaerobiose, os genótipos apresentaram crescimento radicular maior em temperaturas mais altas.

    Abstract in English:

    Although the southern state of Rio Grande do Sul (RS) is responsible for about 40% of the Brazilian rice yield, its rice growing sector has been facing a crisis which is related, among other factors, to a profile of low competitiveness, high production costs and an average yield which is below the genetic potential of the varieties used. One of the ways which has been used to produce more effective responses to such crises lies in the use of a pre-germinated system, as a way of lowering production costs alongside with increasing productivity and thus enhancing competitiveness. Bearing such considerations in mind, this paper aims at comparing the initial development of rice seedlings of genotypes grown in RS (BR IRGA 409, BR IRGA 410, IRGA 416 e IRGA 417) at different temperatures (20, 25 e 30ºC) and evaluating the initial growth of seedlings under aerobic and anaerobic conditions. In the anaerobiosis treatments, the seeds were submerged for 24 hours, then were kept in aerobiosis for 24 hours and were finally kept in anaerobiosis for fourteen days. The results of the tests allowed the conclusion that: a) The BR IRGA 409 genotype is better adapted to early sowing in the anaerobiosis condition when the temperature is 20ºC; b) In anaerobiosis, the genotypes showed a more prominent radicular growth at higher temperatures.
  • Preparation of sample, temperature and drying periods in the determination of the moisture content of camu-camu (Myrciaria dubia (H.B.K.) McVaugh) seeds

    Gentil, Daniel Felipe de Oliveira; Ferreira, Sidney Alberto do Nascimento

    Abstract in Portuguese:

    O presente estudo teve como objetivo avaliar a preparação das subamostras (sementes inteiras e cortadas), temperaturas (80 e 105ºC) e períodos de secagem (12, 24, 36, 48, 60, 72 e 96 horas) na determinação do grau de umidade de sementes de camu-camu. Paralelamente, foi avaliado o número de sementes por quilograma, visando a utilização da tabela de tolerâncias máximas permitidas para as diferenças entre duas subamostras, e analisada a variação dos resultados de grau de umidade entre subamostras de lotes de sementes. Desse modo, foi verificado que o número de sementes por quilograma é inferior a 5000 unidades e que 33% dos lotes ultrapassaram as tolerâncias de grau de umidade admitidas pelas Regras de Análise de Sementes brasileiras. Por outro lado, não foi possível estabelecer o método mais apropriado à determinação do grau de umidade das sementes dessa espécie, mas foram considerados como inadequados a combinação sementes cortadas/temperatura de 105ºC, em qualquer período de exposição, e as combinações de sementes inteiras e de sementes cortadas na temperatura de 80ºC/12 horas de exposição.

    Abstract in English:

    The objective of the present study was the appraisal of the preparation of samples (whole and cut seeds), temperatures (80 and 105ºC) and drying periods (12, 24, 36, 48, 60, 72 and 96 hours) in the determination of the moisture content of camu-camu seeds. The number of seeds was evaluated by kilogram, using a table of maximum tolerances allowed for differences between two samples, and the variation in the results of moisture content among samples of seed lots was analyzed. Thus, it was verified that the number of seeds per kilogram was inferior to 5000 units and that 33% of the lots exceeded the tolerances of moisture content allowed by the Brazilian Rules for Testing Seeds. On the other hand, it was not possible to establish the most appropriate method to determine the moisture content of the seeds of this species, but the combination cut seeds/temperature 105ºC, in any exposition period, and the combinations of whole seeds and cut seeds in the temperature of 80ºC/12 hours of exposition were considered inadequate.
  • Electrical conductivity test in function of the number of seeds and the amount of water for pearl millet seeds

    Gaspar, Carolina Maria; Nakagawa, João

    Abstract in Portuguese:

    Foram realizados dois experimentos, com os objetivos de estudar o efeito da correção do valor da condutividade elétrica da solução de embebição (mS cm-1 g¹) em função da condutividade da água e os efeitos do número de sementes e da quantidade de água sobre a condutividade elétrica da solução de embebição, visando o aprimoramento da metodologia deste teste na avaliação do vigor de sementes de milheto. Utilizaram-se três lotes de sementes, sendo o lote 1 representado pela cultivar Comum e os lotes 2 e 3 pela cultivar BN2. No experimento 1 foram avaliadas as condutividades elétricas de 10, 20, 30, 40, 50, 60, 70, 80, 90 e 100 sementes do lote 1, embebidas em 100 ml de água. No experimento 2 foram estudadas as combinações de 25, 50 e 100 sementes e 50, 75 e 100 ml de água para os três lotes. Os testes de condutividade foram conduzidos à temperatura de 25ºC, com 24h de embebição. Empregou-se o delineamento experimental inteiramente casualizado, com quatro repetições por tratamento. Pode-se concluir que: a condutividade da água exerce influência sobre o valor calculado da condutividade elétrica da solução de embebição de sementes de milheto, quando o valor da condutividade da solução é baixo; a utilização de 100 sementes e 100 ml de água foi a melhor combinação para a realização do teste de condutividade elétrica para as sementes de milheto, pois melhor identificou as diferenças entre os lotes.

    Abstract in English:

    Two experiments were carried out to study the correction effect of the electrical conductivity value of the imbibition solution (mS cm-1 g-1) as affected by the conductivity of the water used in the test and the effects seed number and volume of water on the electric conductivity of the imbibition solution, to improve the methodology for this test in the evaluation of pearl millet seed vigor. Three seed lots were used, lot 1 represented by cv. Comum and the lots 2 and 3 by cv. BN2. In experiment 1 the electrical conductivities of 10, 20, 30, 40, 50, 60, 70, 80, 90 and 100 seeds of lot 1 were evaluated and placed in 100 ml distilled water. In experiment 2 the combinations of 25, 50 and 100 seeds and 50, 75 and 100 ml of water were studied for the three lots. The conductivity tests were carried out at 25 Cº, with 24h imbibition. The statistical model was the complete randomized block, with four replications for all the treatments. The conductivity of the water used in the test influenced the calculated value of the electrical conductivity of the imbibition solution for pearl millet seeds, when the value of the conductivity of the solution is low. The best combination for the electrical conductivity test for pearl millet seeds was 100 seeds and 100 ml of water, because it identified best the differences among the lots.
  • Stylosanthes scabra J. Vogel seeds germination as affected by breaking hardness of seeds and fruits

    Araujo, Eduardo Fontes; Araujo, Roberto Fontes; Silva, Roberto Ferreira da; Galvão, João Carlos Cardoso

    Abstract in Portuguese:

    O presente trabalho foi desenvolvido com a finalidade de avaliar diferentes métodos de superação da dureza das sementes e dos frutos, separadamente, de Stylosanthes scabra. Os métodos avaliados foram: testemunha, calor seco a 85ºC durante 10, 12 e 14 horas, ácido sulfúrico concentrado por cinco e dez minutos e imersão em água fervendo durante um minuto. No teste de germinação, registraram-se as porcentagens de germinação (plântulas normais), de plântulas anormais, de sementes duras e de sementes mortas. Concluiu-se que o melhor tratamento foi a escarificação das sementes com o ácido sulfúrico, independente do tempo de imersão; para escarificação dos frutos, um tempo de imersão superior a 10 minutos deve merecer posteriores estudos. O calor seco não superou o problema da impermeabilidade da cobertura protetora e a água fervendo causou a morte de praticamente todas as sementes.

    Abstract in English:

    This study was carried out to evaluate methods of breaking Stylosanthes scabra seed and fruit hardness, separately. The methods evaluated were: control dry heat at 85ºC for 10, 12, and 14 hours, immersion in concentrated sulphuric acid for five and 10 minutes, and immersion in boiling water for one minute. The germination test consisted of evaluating normal seedlings (germination percentage), abnormal seedlings, hard seeds and dead seeds. It was concluded that the best treatment was seed scarification with concentrated sulfuric acid for five and 10 minutes. In relation to fruit scarification, an immersion time longer than 10 minutes deserves further study. The dry heat treatment did not overcome the impermeabily of the seed covering layers. Boiling water led to the death of more than 90% of the seeds.
  • Electrical conductivity test in function of the period and the temperature of imbibition solution for seeds of pearl millet

    Gaspar, Carolina Maria; Nakagawa, João

    Abstract in Portuguese:

    O presente trabalho objetivou estudar os efeitos de período e temperatura de embebição sobre os resultados do teste de condutividade elétrica para a avaliação do vigor de sementes de milheto (Pennisetum americanum L.). Foram realizados dois experimentos. No primeiro, estudaram-se os períodos de embebição de 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 e 24 horas, à temperatura de 25ºC, e no segundo as temperaturas de 20, 25, 30, 35 e 40ºC, em período de embebição mais promissor do primeiro experimento. Os testes foram realizados com três lotes de sementes, sendo o lote 1 representado pela cultivar Comum e os lotes 2 e 3 pela cultivar BN2, utilizando-se para cada repetição 100 sementes em 100ml de água para embebição. Empregou-se delineamento experimental inteiramente casualizado, com quatro repetições por tratamento. Os resultados mostram que é possível reduzir o período de embebição das sementes para duas horas e que nesse período a temperatura teve pouca influência. Assim sendo, a temperatura de 25ºC, durante a embebição, parece a mais conveniente para a condução deste teste.

    Abstract in English:

    Two experiments were carried out [with the purpose of studying] to study the effects of imbibition period and temperature of imbibition on the results of the electrical conductivity test for the evaluation the vigor of pearl millet to evaluate pearl millet (Pennisetum americanum L.) seeds vigor. In the first experiment was studied the imbibition periods of 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 hours, [to the temperature of] at 25ºC were studied, and in the second at the temperatures of 20, 25, 30, 35 and 40ºC, (in a more promising imbibition period more promising of than the first experiment.????) AD Three seeds lots were compared, lot 1 represented by cv. Comum and the lots 2 and 3 by cv. BN2. Four replicates of 100 seeds in 100ml of imbibition water were employed for all the treatments. The experimental design was the complete entirely randomized block, with four replications for all the treatments. Results indicated that the period of imbibition period can be reduced to two hours and that in this period the temperature had little influence on the results. As such, 25ºC seems a convenient imbibition temperature for the conduction of this test.
  • Use of the relative growth rate of seedlings to evaluate soybean seeds vigor

    Schuab, Sandra Regina Pelegrinello; Braccini, Alessandro de Lucca e; França Neto, José de Barros; Scapim, Carlos Alberto; Meschede, Dana Kátia

    Abstract in Portuguese:

    O presente trabalho teve por objetivo estabelecer a metodologia da taxa de crescimento das plântulas na avaliação do vigor de sementes de soja. Para tanto, sementes de soja provenientes de dez lotes foram avaliadas por meio dos testes de emergência de plântulas em campo, de germinação (primeira contagem e contagem final), de envelhecimento acelerado, de frio, de tetrazólio (1-3 e 1-5), de condutividade elétrica, de comprimento de plântula, de biomassa seca das plântulas e da taxa de crescimento das plântulas. O delineamento experimental utilizado foi o inteiramente casualizado com quatro repetições. Os resultados foram submetidos à análise de variância e de correlação. As médias foram comparadas por meio do teste de agrupamento de Scott-Knott. A taxa de crescimento das plântulas apresentou correlação significativa (p < 0,01) com todos os testes avaliados e foi considerada satisfatória na avaliação do vigor das sementes de soja.

    Abstract in English:

    A study was carried out to set up the methodology of the relative growth rate of seedlings to evaluate soybean seed vigor. Soybean seeds of ten commercial seed lots were evaluated by the following tests: field emergence, germination (first and final count), accelerated aging, cold, tetrazolium (1-3 and 1-5), electrical conductivity, seedling length, dry biomass and relative growth rate of seedlings. The experimental design used was the completely randomized block with four replications. The results were submitted to variance and correlation analysis. The average results were compared by means of the Scott-Knott grouping test. The relative growth rate of seedlings showed significant correlation (p < 0.01) with all the evaluated seed vigor tests and was considered satisfactory in evaluating soybean seed vigor.
  • Methods of comparison to evaluate broccoli seed lot vigor

    Martins, Cibele Chalita; Martinelli-Seneme, Adriana; Castro, Marcia Maria; Nakagawa, João; Cavariani, Cláudio

    Abstract in Portuguese:

    Os testes de vigor e o teste de germinação são componentes essenciais no controle de qualidade das empresas de produção de sementes. Com o objetivo de verificar a eficiência de diferentes testes de vigor e de variações de suas metodologias na avaliação da qualidade de sementes de couve-brócolos visando diferenciação de lotes e previsão de emergência em bandeja, cinco lotes de sementes do híbrido Flórida foram submetidos aos seguintes testes: germinação; primeira contagem de germinação; emissão de raiz primária (após 48, 56, 72, 80 e 96 h após a instalação do teste de germinação); emergência de plântulas em substrato; envelhecimento acelerado com água (1g de sementes mantidas a 41ºC por 48 e 72 h a 100%UR); envelhecimento acelerado com solução saturada de sal (mesmo procedimento do item anterior, porém usando solução de NaCl, 40% e 76%UR); condutividade elétrica (50 sementes em 25 mL de água destilada a 25ºC e leituras após 2, 4, 6, 8 e 24 h). Todos os testes apresentaram correlação significativa com a porcentagem de emergência de plântulas em substrato, a 1% de probabilidade. Os testes de envelhecimento acelerado com solução saturada de sal por 48 h e de condutividade elétrica após 8 e 24 h de embebição foram eficientes e tiveram resultados semelhantes aos da emergência em substrato. Os testes da primeira contagem de germinação, emissão da raiz primária após 56 h e envelhecimento acelerado com solução saturada de sal por 72 h, apresentaram-se mais eficientes que a emergência de plântulas em substrato na diferenciação do vigor dos lotes.

    Abstract in English:

    The vigor tests and germination test are essential components of seed quality control to the seed industry. This research was understaken to study an adequate method to estimate vigor in different seed lots and to predict seedling emergence on spedling trays. Five lots of broccoli `Florida' hybrid seeds were submitted to the following tests: germination; first germination count; primary root emission (48, 56, 72, 80, and 96 hour after sowing); seedling emergence on spedling trays; accelerated aging with water (1 g of seeds maintained at 41ºC during 48 and 72 hours); accelerated aging with salt (the same procedure of last item, but using 40% NaCl solution); electrical conductivity (50 seeds in 25 mL of distilled water at 25 ºC and evaluations after 2, 4, 6, 8, and 24 hours imbibition). All the tests presented significant correlation with emergence on spedling trays at 1% probability level. The accelerated aging tests with saturated salt solution during 48 hours and the electrical conductivity after 8 and 24 hours imbibitions showed similar results at emergence on spedling trays. The first germination count, primary root emission after 56 hours and accelerated aging with salt during 72 hours were more efficient than emergence on spedling trays to differentiate vigor among seed lots.
  • Seeds germination of Operculina macrocarpa (L.) Farwel and Operculina alata (Ham.) Urban

    Medeiros Filho, Sebastião; França, Edson Alves de; Innecco, Renato

    Abstract in Portuguese:

    Várias espécies vegetais nativas produzem sementes que, mesmo vivas, apresentam dificuldades para germinar. Assim, foram conduzidos dois experimentos com o objetivo de identificar métodos para a superação da dormência de sementes de Operculina macrocarpa e para a germinação de sementes de O. macrocarpa e Operculina alata. No primeiro, sementes de O. macrocarpa foram submetidas a oito tratamentos visando a superação de dormência: frio seco, calor úmido, imersão em água oxigenada, água quente e em ácido sulfúrico, frio úmido, escarificação mecânica, embebição em nitrato de potássio, além da testemunha, determinando-se os percentuais de germinação, de sementes duras e de mortas. No segundo ensaio, sementes de O. macrocarpa e O. alata, após escarificadas, foram semeadas em substratos de areia e de papel e colocadas para germinar sob cinco combinações de luz e temperatura: luz contínua a 25ºC constante; luz contínua com temperaturas alternadas (20ºC/16h-35ºC/8h); escuro contínuo a 25ºC constante; escuro contínuo com temperaturas alternadas (20ºC/16h-35ºC/8h) e alternância de luz e temperaturas (luz/35ºC/8h-escuro/20ºC/16h). Determinaram-se o percentual e o índice de velocidade de germinação. Concluiu-se que Operculina macrocarpa apresenta sementes dormentes, destacando-se a escarificação mecânica como o método mais eficiente para a sua superação; o substrato papel, associado à temperatura de 20-35ºC e em ausência de luz, é o mais indicado para a germinação de sementes de Operculina macrocarpa e Operculina alata.

    Abstract in English:

    Viable seeds of several native plant species present difficulties to germinate. Two trials were carried out to identify appropriate methodology to overcome seed dormancy in Operculina macrocarpa and Operculina alata. In the first one, the seeds of Operculata macrocarpa were submitted to the following treatments: dry cooling; wet heat; immersion in peroxide, immersion in hot water, immersion in sulfuric acid; wet cooling; mechanical scarification; soaking in potassium nitrate; and the control. Percentage of germination, hard seeds and dead seeds were determined. In the second trial, seeds of Operculina macrocarpa and Operculina alata were scarified and sown on paper and sand substrates and set to germinate under five different environmental conditions: continuous light and constant temperature (25ºC), continuous light and alternating temperatures (20ºC/16h-35ºC/8h), continuous darkness and constant temperature, continuous darkness with alternating temperatures (20ºC/16h-35ºC/8h), and alternating light and temperatures (light/35ºC/8h-darkness/20ºC/16h). Percentage and time to germination were determined. Mechanical scarification was the most efficient method to break dormancy in Operculina macrocarpa; towel paper, temperature between 20-30ºC and darkness were appropriate conditions for seed germination of Operculina macrocarpa and Operculina alata.
  • Tests for evaluating the physiological quality of millet seeds Comunicação Técnica

    Aguilera, Líder Ayala; Melo, Paulo Trajano Burck Santos; Maia, Manoel de Souza; Villela, Francisco Amaral

    Abstract in Portuguese:

    Este trabalho teve por objetivo avaliar a eficiência comparativa de diferentes testes para a avaliação de vigor de sementes de milheto (Pennisetum americanum (L) Leeke). Seis lotes foram avaliados pelos testes de germinação, teste de frio, condutividade elétrica, emergência em areia, massa seca das plântulas, peso de mil sementes, e emergência e altura de plantas em campo. O delineamento experimental foi o inteiramente casualizado com quatro repetições. Os resultados indicaram que o teste de frio permite separar lotes de sementes de milheto com diferentes níveis de qualidade fisiológica; o teste de massa seca de plântulas não mostrou associação com a expressão de vigor de sementes de milheto.

    Abstract in English:

    The objective of this study was to evaluate the comparative efficiency of different tests in assessing the vigor of millet seed lots (Pennisetum americanum (L) Leeke). Six lots were evaluated by the following tests: germination test, cold test, electrical conductivity, emergence on sand, seedling dry mass, weight of thousand seeds and both emergency and height of seedlings in the field. The experiment was a completely randomized block design with four replications. The results showed that: a) the cold test separated millet seed lots into different physiological quality levels; and b) the seedling dry mass test did not show association with the vigor expression of millet seeds.
  • RT-PCR patterning for alpha-amylase messenger RNA identification in germinating maize seeds Comunicação Técnica

    Dantas, Bárbara França; Aragão, Carlos Alberto; Araújo-Junior, João Pessoa; Rodrigues, João Domingos; Cavariani, Cláudio; Nakagawa, João

    Abstract in Portuguese:

    Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

    Abstract in English:

    During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94ºC/4 minutes, 34 cycles of 94ºC /1 minute, 42ºC/1 minute and 72ºC/1,5 minutes, and finally 72ºC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. The RT-PCR is an eficient method for alpha-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about alpha-amylase sinthesis kinetics.
Associação Brasileira de Tecnologia de Sementes R. Raja Gabaglia, 1110 , 86060-190 Londrina - PR Brasil, Tel./Fax: (55 43) 3025 5120 - Londrina - PR - Brazil
E-mail: abrates@abrates.org.br