Reposição volêmica com soluções salinas em pancreatite e perfil hepático de proteínas apoptóticas e de choque térmico

Ester Correia Sarmento Rios Ana Iochabel Soares Moretti Heraldo Possolo de Souza Irineu Tadeu Velasco Francisco Garcia Soriano Sobre os autores

Resumos

OBJETIVO: A falência hepática é uma consequência da inflamação sistêmica após pancreatite aguda. Avaliou-se o efeito da reposição volêmica com soluções salinas fisiológicas ou hipertônica na produção hepática de citocinas e na expressão de proteínas ativadas por choque térmico e proteínas ligadas à apoptose durante a pancreatite aguda. MÉTODOS: Ratos Wistar foram divididos em quatro grupos: C - animais controles não submetidos à lesão e nem ao tratamento; NT - animais submetidos à indução de pancreatite aguda e não tratados; SN - animais submetidos à indução de pancreatite aguda e tratados com solução salina normal (NaCl 0,9%); SH - animais submetidos à pancreatite aguda e tratados com solução salina hipertônica (NaCl 7,5%). A pancreatite aguda foi induzida por infusão retrógrada transduodenal de taurocolato de sódio 2,5% no ducto pancreático. Após 4, 12 e 24 horas da indução da pancreatite aguda, analisaram-se, no fígado, TNF-α, IL-1β, IL-6 e IL-10, caspase-2, caspase-7, APAF-1, AIF, HSP60 e HSP90. RESULTADOS: A caspase-2 diminuiu nos grupos SN e SH (p<0,05 versus C) após 12 horas. APAF-1, AIF e HSP90 permaneceram inalterados. Após 4 horas da indução, a capsase-7 aumentou no grupo NT (p<0,01 versus C), embora se mantendo em níveis basais nos grupos reperfundidos. A HSP60 aumentou em todos os grupos após 4 horas (p<0,001 versus C). No entanto, o grupo SH mostrou menor expressão de HSP60 que o grupo SN (p<0,05). A solução salina hipertônica manteve a produção de citocinas em níveis normais. A reperfusão com volume com solução salina normal ou hipertônica, modulou significativamente a expressão de caspase-7. CONCLUSÃO: A reposição volêmica com solução salina normal ou hipertônica foi efetiva em reduzir a caspase-7. Entretanto, somente a solução salina hipertônica foi capaz de regular a produção de citocinas e a expressão de HSP60 em todos os momentos analisados.

Proteínas de choque térmico; Apoptose; Pancreatite; Fígado


OBJECTIVE: Liver failure can occur as a consequence of the systemic inflammation after acute pancreatitis. We assessed the effect of volume repositioning with hypertonic saline solution or normal saline on hepatic cytokine production and the expression of heat-shock proteins and apoptotic proteins after acute pancreatitis. METHODS: Wistar rats were divided in four groups: C - control animals that were not subjected to insult or treatment; NT - animals that were subjected to acute pancreatitis and received no treatment; normal saline - animals that were subjected to acute pancreatitis and received normal saline (NaCl 0.9%); and HS - animals that were subjected to acute pancreatitis and received hypertonic saline solution (NaCl 7.5%). Acute pancreatitis was induced by retrograde transduodenal infusion of 2.5% sodium taurocholate into the pancreatic duct. At 4, 12 and 24 h following acute pancreatitis induction, TNF-alpha, IL-1-beta, IL-6 and IL-10, caspase-2 and -7, Apaf-1, AIF and HSP60 and 90 were analyzed in the liver. RESULTS: Casp2 decreased in the normal saline and hypertonic saline groups (p<0.05 versus. C) at 12 h. Apaf-1, AIF and HSP90 remained unchanged. At 4 h, Casp7 increased in the NT group (p<0.01 versus C), although it remained at the baseline levels in the reperfused groups. HSP60 increased in all of the groups at 4 h (p< 0.001 vs. C). However, the hypertonic saline group showed lower expression of HSP60 than the normal saline group (p<0.05). Hypertonic saline solution maintained the production of cytokines at normal levels. Volume reperfusion with normal or hypertonic saline significantly modulated the expression of Casp7. CONCLUSION: Volume replacement with hypertonic or normal saline was effective in reducing caspase 7. However, only hypertonic solution was capable of regulating cytokine production and HSP60 expression at all time points.

Heat-shock proteins; Apoptosis; Pancreatitis; Liver


ARTIGO ORIGINAL

Reposição volêmica com soluções salinas em pancreatite e perfil hepático de proteínas apoptóticas e de choque térmico

Ester Correia Sarmento Rios; Ana Iochabel Soares Moretti; Heraldo Possolo de Souza; Irineu Tadeu Velasco; Francisco Garcia Soriano

Laboratório de Investigação Médica (LIM-51), Departamento de Emergências Clínicas, Faculdade de Medicina, Universidade de São Paulo - USP - São Paulo (SP), Brasil

Autor correspondente

RESUMO

OBJETIVO: A falência hepática é uma consequência da inflamação sistêmica após pancreatite aguda. Avaliou-se o efeito da reposição volêmica com soluções salinas fisiológicas ou hipertônica na produção hepática de citocinas e na expressão de proteínas ativadas por choque térmico e proteínas ligadas à apoptose durante a pancreatite aguda.

MÉTODOS: Ratos Wistar foram divididos em quatro grupos: C - animais controles não submetidos à lesão e nem ao tratamento; NT - animais submetidos à indução de pancreatite aguda e não tratados; SN - animais submetidos à indução de pancreatite aguda e tratados com solução salina normal (NaCl 0,9%); SH - animais submetidos à pancreatite aguda e tratados com solução salina hipertônica (NaCl 7,5%). A pancreatite aguda foi induzida por infusão retrógrada transduodenal de taurocolato de sódio 2,5% no ducto pancreático. Após 4, 12 e 24 horas da indução da pancreatite aguda, analisaram-se, no fígado, TNF-α, IL-1β, IL-6 e IL-10, caspase-2, caspase-7, APAF-1, AIF, HSP60 e HSP90.

RESULTADOS: A caspase-2 diminuiu nos grupos SN e SH (p<0,05 versus C) após 12 horas. APAF-1, AIF e HSP90 permaneceram inalterados. Após 4 horas da indução, a capsase-7 aumentou no grupo NT (p<0,01 versus C), embora se mantendo em níveis basais nos grupos reperfundidos. A HSP60 aumentou em todos os grupos após 4 horas (p<0,001 versus C). No entanto, o grupo SH mostrou menor expressão de HSP60 que o grupo SN (p<0,05). A solução salina hipertônica manteve a produção de citocinas em níveis normais. A reperfusão com volume com solução salina normal ou hipertônica, modulou significativamente a expressão de caspase-7.

CONCLUSÃO: A reposição volêmica com solução salina normal ou hipertônica foi efetiva em reduzir a caspase-7. Entretanto, somente a solução salina hipertônica foi capaz de regular a produção de citocinas e a expressão de HSP60 em todos os momentos analisados.

Descritores: Proteínas de choque térmico; Apoptose; Pancreatite; Fígado

INTRODUÇÃO

A falência hepática pode ocorrer em consequência da síndrome da resposta inflamatória sistêmica em decorrência da pancreatite aguda. Em nossos estudos anteriores, nós demonstramos o aumento nos níveis de perioxidação lipídica e de degradação na matriz extracelular no fígado, após pancreatite.(1) Além disso, observamos aumento nos níveis de enzimas hepáticas no sangue, indicando dano às células do fígado. A lesão hepática associada à pancreatite aguda é mediada por citocinas inflamatórias produzidas no interior de macrófagos residentes nos tecidos ativados por mediadores inflamatórios liberados sistemicamente pelo pâncreas.(2) O fígado, por sua vez, participa da inflamação sistêmica, liberando vários mediadores inflamatórios e e levando à lesão de outros órgãos.(3,4) As substâncias sistemicamente liberadas durante a pancreatite, como o óxido nítrico e radicais livres, podem interferir na respiração da mitocôndria hepática e induzir apoptose.(5,6) A morte da célula apoptótica pode desempenhar um papel importante na mortalidade e na morbidade da pancreatite aguda grave.(7) A via apoptótica, por meio de receptores de morte ou pela via mitocondrial, ativa a cascata final da caspase para morte celular.(8) A sinalização de receptores da morte celular tem sido associada à apoptose em várias doenças hepáticas agudas, como as induzidas por álcool e a doença hepática colestática.(9) A apoptose relacionada à pancreatite aguda grave é reconhecida por ser desencadeada pela via mitoncondrial.(3)

A morte celular foi observada nas formas apoptótica e necrótica, tanto na pancreatite clínica como na experimental.(10) As evidências atuais sugerem que a quantidade e o equilíbrio entre apoptose e necrose influenciam a gravidade da pancreatite aguda.(11) Recentemente, revelou-se que proteínas ativadas por de choque térmico (HSPs, do inglês heat-shock proteins) e seus cofatores estão associados às vias apoptótica e necrótica.(12) HSPs são chaperonas moleculares que estabilizam e reconstroem proteínas intercelulares danificadas, evitando a agregação de proteína intracelular e tornando as células resistentes ao dano celular induzido por estresse.(13)

A reposição volêmica, principalmente aquela com solução salina hipertônica, demonstrou benefícios em vários aspectos fisiopatológicos de muitas doenças, em razão da melhora da hipoperfusão tecidual; da diminuição do consumo de oxigênio; da disfunção endotelial e da depressão cardíaca; além da redução da ampla gama de citocinas pró-inflamatórias e de várias espécies oxidantes.(14,15) Nós reportamos, anteriormente, que a terapia com solução salina hipertônica reduz o estresse oxidativo e a degeneração tecidual hepática após pancreatite.(1) Em adição, nosso grupo mostrou os efeitos da solução salina hipertônica na expressão e na atividade de várias proteínas, incluindo a HSPs no pulmão(16,17) e no fígado.(1) No entanto, não há dados na literatura acerca do efeito da solução hipertônica na apoptose hepática durante a pancreatite. Neste estudo, nós avaliamos o efeito da solução salina normal (NaCl 0,9%) e da hipertônica (NaCl 7,5%) na expressão de proteínas apoptóticas e na de HSPs, além da correlação desses fatores com a inflamação durante a pancreatite.

MÉTODOS

Indução da pancreatite

Todos os experimentos foram conduzidos de acordo com as diretrizes estabelecidas pelo Comitê de Ética em Pesquisa da Faculdade de Medicina da Universidade de São Paulo (USP). Ratos Wistar machos com peso entre 270 e 320 g foram anestesiados por via subcutânea com quetamina (10 mg/kg) e xilazina (8 mg/kg). A pancreatite aguda foi induzida pelo método bem estabelecido de infusão retrógrada de taurocolato de sódio 2,5% (1,0 mL/kg; Sigma, St. Louis, MO, USA) no ducto pancreático transduodenal, com angiocateter 24-gauge, numa taxa de infusão constante de 1 mL/min. O ducto biliar foi clampeado com pinça microcirúrgica do tipo "bulldog" no hilo hepático, para evitar o vazamento da solução de taurocolato no fígado. A pinça no hilo hepático foi liberada após a injeção. A literatura relata que esse modelo de pancreatite causa lesão hepática e reproduz a mortalidade e as mudanças patofisiológicas da pancreatite humana.(18) No presente estudo, as análises foram realizadas em quatro grupos: grupo controle (C), que consistiu de animais que não sofreram lesão e nem foram tratados; o grupo não tratado (NT), que consistiu de animais nos quais a pancreatite foi induzida mas que não foram tratados; o grupo solução salina normal (SN), com animais nos quais a pancreatite foi induzida e os mesmos foram tratados com bólus intravenoso de solução salina normal (0,9% NaCl, 34 mL/kg); e o grupo de solução salina hipertônica (SH), com animais nos quais a pancreatite foi induzida e solução salina hipertônica (7,5% NaCl, 4 mL/kg) foi administrada pela veia jugular interna, por um período de 5 minutos, 1 hora após a indução da pancreatite. O volume infundido de solução salina normal foi equivalente a 4 mL/kg da solução hipertônica em relação ao teor de sódio. Os animais foram sacrificados e os fígados coletados 4, 12 e 24 após a indução da pancreatite.

Reação em cadeia da polimerase via transcriptase reversa semiquantitativa

A reação em cadeia da polimerase via transcriptase reversa semiquantitativa (RT-PCR) foi utilizada para determinar os níveis de RNA mensageiro (mRNA) no tecido hepático. O RNA total foi extraído dos fígados congelado dos ratos com o reagente TRIzol® (Invitrogen, Carlsbad, CA), seguindo as instruções do fabricante. O RNA foi dissolvido em dietilpirocarbonato (DEPC) tratado com água e espectrofotometricamente quantificado a 260 nm. A primeira fita de c-DNA foi gerada adicionando-se RNA (1 µg) a uma mistura que continha 1 µL de transcriptase reversa ImProm-IITM (Promega, Madison, USA); 1µL (0,5 µg/µL) de oligo (dT); 20 U/µL de inibidor recombinante de RNAse RNasin®; 3 mM de MgCl2; 6 µL de tampão de reação ImProm-IITM 5X (Promega, Madison, USA); e 1 µL (0,5 mM) de mistura do dNTP (Invitrogen, Carlsbad, CA), num volume final de 20 µL. A transcrição reversa foi realizada a 42ºC, por 50 minutos, seguida de inativação por calor da transcriptase reversa a 70ºC, por 10 minutos. A amplificação por PCR foi realizada utilizando-se o equipamento Programmable Thermal Controller (MJ Research PTC-200, Watertown MA, USA). A solução de PCR continha 1 µL da síntese da primeira fita de cDNA; 2,5 µL de tampão de reação 10X PCR; 2 mM de MgCl2; 0,5 mM de mistura do dNTP; 1 pmol/µ de cada primer específico; 2,5 U/µL de polimerase TaqDNA (Invitrogen, Carlsbad, CA), num volume final de 25 µL. Para avaliar a abundância relativa dos transcritos entre as amostras, a RT-PCR relativa foi realizada com primers RNA ribossomal 18S, num controle interno. Os produtos da PCR foram resolvidos por eletroforese em 1% de gel de agarose, corado com brometo de etídio EtBr (Horizon, Life-Technologies, USA) e visualizado com luz ultravioleta por sistema de imagem de vídeo (Pharmacia). A avaliação densitométrica de gel corado com EtBr foi realizada com software Gene Tools (Syngene, Cambridge, MA, USA). Os dados foram representados como uma função de log OD do produto do gene alvo contra o log OD do rRNA 18S. As sequências de primers específicos (Invitrogen, Carlsbad, CA) foram: rRNA (320bp) senso: GAAAGATGGTGAACTATGCC e antissenso: TTACCAAAAGTGGCCCACTA; HSP60 (213pb) senso: TGACACCCTTTCTTCCAACC e antissenso: AGCAAAGGGGCTAATCCAGT; HSP90 (247pb) senso: GATTGACATCATCCCCAACC e antissenso: CTAGCCAACACCCTGAGAGC.

Western blot

Amostras de tecido congelado foram pulverizadas com nitrogênio líquido e homogeneizadas em um tampão contendo 1% de TX-100; 20 mM de Tris (pH 8,0); 10% de glicerol; 135 nM de NaCl e inibidores para enzimas proteolíticas (40 ug/mL de fluoreto de fenilmetilsulfonil e 10 ug/mL de pepstatina; Sigma, St, Louis, MO). Após a separação dos resíduos, por meio de centrifugação por 45 minutos a 14.000 g, os sobrenadantes foram preservados e a concentração proteica foi determinada pelo método de Bradford (Bio-Rad, Hercules, CA). As amostras foram armazenadas a -80ºC até serem analisadas. A expressão proteica foi realizada utilizando-se eletroforese em gel de SDS-poliacrilamida. Os tecidos hepáticos extraídos (25 a 100 ug/mL) foram à ebulição em volumes semelhantes de tampão de carregamento (150 mM de Tris-HCl; pH 6,8; 4% de SDS; 20% de glicerol; 15% de beta-mercaptoetanol; e 0,01% de azul de bromofenol) e submetidos à eletroforese em gel de poliacrilamida 10%. Após separação eletroforética, as proteínas foram transferidas para membrana Hybond-P (Amersham Pharmacia Biotech, Buckinghamshire, England). As membranas foram bloqueadas com leite desnatado 5% em solução salina tamponada Tris e Tween 20 (TBST) 0,5% por 1 hora. Foram utilizados anticorpos primários contra: caspase-2 (rabbit, 1:1000, Santa Cruz Biotechnology 623); caspase-7 (rabbit, 1:1000, sc-337773); fator apoptótico 1 ativador de proteases (APAF-1, sigla do inglês apoptotic protease activating factor 1, goat, 1:1000, sc-26685); fator de indução da apoptose (AIF, sigla do inglês apoptosis-inducing factor, rabbit, 1:1000, ab32516, Abcam); HSP60 (goat, 1:1000, sc1052); HSP90 a/β (goat, 1:1000, sc1055); e beta-actina (1:10000, Sigma, A5441). Todos foram incubados a 4ºC durante à noite. Após duas lavagens com TBST, diluiu-se Ab secundário conjugado com peroxidase de rábano (goat anti-rabbit polyclonal sc2004 ou rabbit anti-goat sc2768, Santa Cruz Biotechnology) na proporção 1:5.000 por 2 horas. Os resíduos foram lavados duas vezes em TBST por 30 minutos e incubados com kit de detecção de reagentes de realce de quimioluminiscência SuperSignal (Pierce, Rockford, IL, USA) e expostos a filme fotográfico Kodak O-OMAT-AR (Kodak, Rochester, NY). A intensidade da banda do mesmo blot original foi quantificada pelo software Image J (Research Services Branch, National Institutes of Health, Bethesda, MD, USA) e normalizada a níveis de controle (controle=1).(17)

Cálculo das citocinas

As amostras de plasma foram coletadas imediatamente antes do sacrifício. As citocinas fator de necrose tumoral-alfa (TNF-α), interleucina (IL) 6, IL-1β e IL-10 foram medidas pelo método ELISA, de acordo com instruções do fabricante (R&D Technologies, USA).

Análise histológica

Após a fixação em formalina 10%, os tecidos hepáticos foram embebidos em parafina e cortados em secções de 4 a 6 μm. Estas foram coradas com hematoxilina-eosina e analisadas qualitativamente por luz microscópica. Foi analisada a ocorrência de dano hepático, como áreas de necrose, hemorragia, infiltrados inflamatórios e vacuolização do citoplasma. As imagens foram geradas por microscópio (Leica) conectado a uma câmera (Sony Trinitron CCD, Sony, Japan) e a um computador.

Análise estatística

Os dados foram expressos como média±desvio padrão da média (DPM). As análises foram realizadas usando o software SigmaStat Statistical (SigmaStat Software Inc., Chicago, IL, USA), versão 3.1. As comparações entre os grupos testados foram feitas pela análise de variância one-way (one-way ANOVA), e o teste de Tukey post-hoc foi utilizado para comparar grupos individuais (NT, SN e SH comparados entre eles mesmos e com um único grupo controle para todos os períodos) e por tempo (4, 12 e 24 horas). Valor de p<0,05 foi considerado significante.

RESULTADOS

Produção de citocinas

Quatro horas após a indução da pancreatite, observou-se aumento dos níveis plasmáticos de IL-1β (Figura 1A) nos grupos NT e SH (p<0,05 versus C). Após 12 horas, os níveis plasmáticos de IL-1β permaneceram aumentados no grupo NT (p<0,001 versus C e SH; p<0,01 versus SN). A terapia com soluções salinas normal e hipertônica manteve os níveis normais.



Os níveis plasmáticos de IL-10 (Figura 1B) aumentaram no grupo NT 4 (p<0,05 versus C; p<0,01 versus SN e SH) e 24 horas (p<0,05 versus C) após a indução da pancreatite. Os níveis de citocinas aumentaram no grupo SN após 12 horas (p<0,05 versus C).

Os níveis hepáticos de IL-1β (Figura 2A) aumentaram significativamente no grupo SN (p<0,05 versus C) após 4 horas. Após 12 e 24 horas, não observamos nenhuma diferença estatística na liberação hepática de IL-1β entre os grupos. A produção hepática de IL-10 (Figura 2B) não mudou no fígado durante as primeiras 4 horas após a indução da pancreatite. No entanto, os níveis de IL-10 aumentaram no grupo NT após 12 horas (p<0,05 versus C, SN, SH) e, após 24 horas, no grupo SN (p<0,05 versus C).



Os níveis plasmático e hepático de TNF-α e IL-6 não mudaram em nenhum grupo durante as 24 horas (dados não apresentados).

Expressão de proteínas apoptóticas

Para estudar o processo de morte celular, investigou-se a expressão das proteínas apoptóticas: APAF-1, AIF, caspase-2 e caspase-7.

As expressões de APAF-1 (Figura 3) e AIF (Figura 4) permaneceram nos níveis basais durante 24 horas.



Os precursores da caspase-2 (51kDa) e da caspase-2L foram expressos no fígado. A expressão da caspase-2L (Figura 5) não mudou nas primeiras 4 horas. Após 12 horas da indução da pancreatite, os grupos tratados com solução salina normal e hipertônica mostraram uma diminuição da expressão de caspase-2 comparada ao grupo controle (p<0,05). Após 24 horas, a expressão da caspase-2 reduziu-se em todos os grupos submetidos à pancreatite (p<0,01 versus C).


Houve aumento da expressão de caspase-7 (Figura 6) no grupo NT 4 horas após a indução (p<0.01 versus C). No entanto, os tratamentos com soluções salinas normal e hipertônica mantiveram a expressão basal dessa proteína. Após 12 e 24 horas, a expressão de caspase-7 se normalizou em todos os grupos.


Expressão gênica e proteica de HSP60 e HSP90

Não se observou nenhuma alteração na expressão gênica de HSP60 (Figura 7A) durante as 24 horas. No entanto, 4 horas após a indução da pancreatite, a expressão proteica de HSP60 (Figura 7B) aumentou em todos os grupos (p<0,001 versus C). Nesse momento, a expressão de HSP60 foi mais baixa no grupo SH em relação ao grupo SN (p<0,05). A expressão de HSP90 (Figura 8) não foi alterada em nenhum dos grupos estudados.




Análise histológica

A análise histológica qualitativa (Figura 9) mostrou áreas de necrose bem como a ocorrência de hemorragia, infiltrado inflamatório e vacuolização do citoplasma no fígado dos animais sacrificados 12 horas após a indução da pancreatite e sem tratamento.


Não se observaram diferenças entre os tratamentos com soluções isotônica e hipertônica.

DISCUSSÃO

Nós já havíamos demonstramos a ocorrência de lesão hepática durante a pancreatite e os benefícios da administração da solução salina.(1,16) O presente estudo mostrou o perfil de citocinas e a expressão de proteínas apoptóticas e HSPs no fígado após a indução de pancreatite aguda. Os dados corroboram a hipótese da solução salina hipertônica ser um modulador imunológico, por mostrar os efeitos da tonicidade sódica por si só, como nos trabalho anteriores.

Embora se reconheça que as alterações primárias na produção das citocinas ocorram precocemente, nós observamos mudanças na produção sistêmica e local de duas citocinas após o estabelecimento da pancreatite, durante o período estudado. O grupo submetido à pancreatite sem tratamento com volume teve aumento nos níveis plasmáticos de IL-1β e IL-10 após 4 horas. Após 12 horas, este grupo mostrou aumento dos níveis de IL-1β e IL-10 no plasma e no tecido, respectivamente. Outro estudo demonstrou níveis aumentados de citocinas no plasma após a pancreatite; contudo, o teor hepático das citocinas não foi estudado.(18)

A presente análise do perfil das citocinas hepáticas demonstra que a solução salina mantém o nível normal durante 24 horas. Um aumento discreto nos níveis plasmáticos de IL-1β ocorreu durante as primeiras 4 horas após a indução da pancreatite. A IL-1β é conhecida como uma das principais citocinas mediadoras da resposta inflamatória aguda. A liberação controlada dessa citocina pode induzir a produção de NO, importante para a perfusão hepática e prevenção da apoptose no fígado.(19) É interessante observar que os animais tratados com solução salina normal tiveram pelo menos uma das citocinas estudadas elevada em algum dos períodos analisados.

O aumento das citocinas pró-inflamatórias ja foi associado a à morte celular.(20) Nesse contexto, medimos vários elementos que participam do evento apoptótico. A pancreatite induz dano hepático e causa aumento na expressão da caspase-7. No entanto, neste estudo, o mesmo não aconteceu com a caspase-2, o AIF e o APF-1 - proteínas relacionadas às vias intrínsecas da apoptose. Devemos considerar que a via de sinalização que culmina na apoptose pode ser regulada e revertida em vários pontos.(8) Além disso, a regulação da apoptose está ainda mais relacionada à ativação das caspases que ao teor das proteínas intracelulares,(21) como as atividades das caspases e a relação delas com o NO. A nitrosilação da caspase modula a atividade dessas proteínase, por outro lado, poderia interferir nos eventos finais da via de apoptose.(22) Ambos os tratamentos, com solução salina normal e hipertônica, foram capazes de manter a expressão de casapse-7 em níveis basais. Essa modulação da caspase pode interferir no potencial apoptótico.(23,24)

A necrose também deve ser considerada um evento importante na lesão hepática. Na verdade, observamos necrose na análise histológica. Em nossos estudos anteriores, a indução de pancreatite causou a morte da célula hepática com a liberação de alanina aminotransferase (ALT) no plasma.(25) O aumento da enzima hepática no sangue está correlacionado à lesão hepática. No fígado, a necrose geralmente é consequência de perturbação metabólica aguda com depleção do ATP, como ocorre na isquemia/reperfusão e na hepatotoxicidade aguda induzida por drogas.(26) A melhora da perfusão hepática com a administração de volume reestabelece o fornecimento de oxigênio e, consequentemente, a produção de ATP,(27) evitando necrose celular.

A indução da pancreatite por ceruleína aumentou a expressão gênica de HSPs e, simultaneamente, diminuiu a expressão dessas proteínas.(28) Neste modelo experimental de pancreatite, o perfil gênico de HSP60 e HSP90 não mudou. Da mesma forma, a expressão da proteína HSP60 aumentou 4 horas após a indução da pancreatite. A HSP60 está envolvida na regulação do sistema imune e pode ativar os receptores do tipo toll (toll-like), causando a liberação de NO. Anteriormente, nós reportamos que animais submetidos à pancreatite e tratados com solução salina normal apresentaram aumento da produção de NO concomitantemente ao aumento de vários mediadores inflamatórios.(25) Além do aumento de HSP60 em todos os grupos, o grupo tratado com solução hipertônica apresentou menor expressão de proteínas que grupo tratado com solução salina normal. Sabe-se que as HSPs são produzidas em resposta ao estresse e são reguladas pelo fator de choque térmico, que é inativado sob condições sem estresse.(29) Na verdade, mostramos os efeitos da solução salina hipertônica na redução da lesão hepática e na inflamação durante a pancreatite, além de sua correlação com a redução da HSP70.

Os benefícios da administração de fluido hipertônico foram demonstrados recentemente em pacientes com choque séptico.(30) Este estudo corrobora e elucida o papel da solução salina na regulação do sistema imune, o que está além dos efeitos hemodinâmicos.

CONCLUSÃO

A reposição volêmica com solução salina normal ou hipertônica foi efetiva em reduzir a caspase-7. Entretanto, somente a solução salina hipertônica foi capaz de regular a produção de citocinas e a expressão de HSP60 em todos os momentos analisados.

AGRADECIMENTOS

Os autores agradecem o apoio financeiro concedido pela Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP).

  • Autor correspondente:
    Francisco Garcia Soriano
    LIM-51, Faculdade de Medicina, Universidade de São Paulo
    Avenida Dr. Arnaldo, 455, 3º andar, sala 3.189 - Cerqueira César
    CEP: 01246-903 - São Paulo (SP), Brasil
    E-mail:
  • Submetido em 3 de Setembro de 2012

    Aceito em 31 de Outubro de 2012

    Conflitos de interesse: Nenhum.

    Estudo realizado no Laboratório de Investigação Médica, Departamento de Emergências Clínicas, Faculdade de Medicina, Universidade de São Paulo - USP - São Paulo (SP), Brasil.

    • 1. Rios EC, Moretti AI, Souza HP, Velasco IT, Soriano FG. Hypertonic saline reduces metalloproteinase expression in liver during pancreatitis. Clin Exp Pharmacol Physiol. 2010;37(1):35-9.
    • 2. Murr MM, yang J, Fier a, kaylor p, mastorides s, norman Jg. Pancreatic elastase induces liver injury by activating cytokine production within Kupffer cells via nuclear factor-Kappa B. J Gastrointest Surg. 2002;6(3):474-80.
    • 3. Sha H, Ma Q, Jha RK, Xu F, Wang L, Wang Z, et al. Resveratrol ameliorates hepatic injury via the mitochondrial pathway in rats with severe acute pancreatitis. Eur J Pharmacol. 2008;601(1-3):136-42.
    • 4. Tsung A, Sahai R, Tanaka H, Nakao A, Fink MP, Lotze MT, et al. The nuclear factor HMGB1 mediates hepatic injury after murine liver ischemia-reperfusion. J Exp Med. 2005;201(7):1135-43.
    • 5. Hori Y, Takeyama Y, Ueda T, Shinkai M, Takase K, Kuroda Y. Macrophage-derived transforming growth factor-beta1 induces hepatocellular injury via apoptosis in rat severe acute pancreatitis. Surgery. 2000;127(6):641-9.
    • 6. Takeyama Y. Significance of apoptotic cell death in systemic complications with severe acute pancreatitis. J Gastroenterol. 2005;40(1):1-10.
    • 7. Takeyama Y, Hori Y, Takase K, Ueda T, Yamamoto M, Kuroda Y. Apoptotic cell death of hepatocytes in rat experimental severe acute pancreatitis. Surgery. 2000;127(1):55-64.
    • 8. Hotchkiss RS, Nicholson DW. Apoptosis and caspases regulate death and inflammation in sepsis. Nat Rev Immunol. 2006;6(11):813-22.
    • 9. Yoon JH, Gores GJ. Death receptor-mediated apoptosis and the liver. J Hepatol. 2002;37(3):400-10.
    • 10. Bhatia M. Apoptosis versus necrosis in acute pancreatitis. Am J Physiol Gastrointest Liver Physiol. 2004;286(2):G189-96.
    • 11. Criddle DN, Gerasimenko JV, Baumgartner HK, Jaffar M, Voronina S, Sutton R, et al. Calcium signalling and pancreatic cell death: apoptosis or necrosis? Cell Death Differ. 2007;14(7):1285-94.
    • 12. Takayama S, Reed JC, Homma S. Heat-shock proteins as regulators of apoptosis. Oncogene. 2003;22(56):9041-7.
    • 13. Tsan MF, Gao B. Cytokine function of heat shock proteins. Am J Physiol Cell Physiol. 2004;286(4):C739-44.
    • 14. Velasco IT, Pontieri V, Rocha e Silva M Jr, Lopes OU. Hyperosmotic NaCl and severe hemorrhagic shock. Am J Physiol. 1980;239(5):H664-73.
    • 15. Friedman G, Soriano FG, Rios EC. Sepsis volume reposition with hypertonic saline solution. Rev Bras Ter Intensiva. 2008;20(3):267-77.
    • 16. Moretti AI, Rios EC, Soriano FG, de Souza HP, Abatepaulo F, Barbeiro DF, et al. Acute pancreatitis: hypertonic saline increases heat shock proteins 70 and 90 and reduces neutrophil infiltration in lung injury. Pancreas. 2009;38(5):507-14.
    • 17. Yoshioka S, Mukae H, Ishii H, Kakugawa T, Ishimoto H, Sakamoto N, et al. Alpha-defensin enhances expression of HSP47 and collagen-1 in human lung fibroblasts. Life Sci. 2007;80(20):1839-45.
    • 18. Machado MC, Coelho AM, Pontieri V, Sampietre SN, Molan NA, Soriano F, et al. Local and systemic effects of hypertonic solution (NaCl 7.5%) in experimental acute pancreatitis. Pancreas. 2006;32(1):80-6.
    • 19. Liu L, Stamler JS. NO: an inhibitor of cell death. Cell Death Differ. 1999;6(10):937-42.
    • 20. Mokhtari D, Kerblom B, Mehmeti I, Wang X, Funa NS, Olerud J, et al. Increased Hsp70 expression attenuates cytokine-induced cell death in islets of Langerhans from Shb knockout mice. Biochem Biophys Res Commun. 2009;387(3):553-7.
    • 21. Chen T, Yang I, Irby R, Shain KH, Wang HG, Quackenbush J, et al. Regulation of caspase expression and apoptosis by adenomatous polyposis coli. Cancer Res. 2003;63(15):4368-74.
    • 22. Li J, Billiar TR, Talanian RV, Kim YM. Nitric oxide reversibly inhibits seven members of the caspase family via S-nitrosylation. Biochem Biophys Res Commun. 1997;240(2):419-24.
    • 23. Zheng TS, Flavell RA. Divinations and surprises: genetic analysis of caspase function in mice. Exp Cell Res. 2000;256(1):67-73.
    • 24. Matikainen T, Perez GI, Zheng TS, Kluzak TR, Rueda BR, Flavell RA, et al. Caspase-3 gene knockout defines cell lineage specificity for programmed cell death signaling in the ovary. Endocrinology. 2001;142(6):2468-80.
    • 25. Rios EC, Moretti AS, Velasco IT, Souza HP, Abatepaulo F, Soriano FG. Hypertonic saline and reduced peroxynitrite formation in experimental pancreatitis. Clinics (Sao Paulo) 2011;66(3):469-76.
    • 26. Malhi H, Gores GJ, Lemasters JJ. Apoptosis and necrosis in the liver: a tale of two deaths? Hepatology. 2006;43(2 Suppl 1):S31-44.
    • 27. Angelos MG, Murray HN, Gorsline RT, Klawitter PF. Glucose, insulin and potassium (GIK) during reperfusion mediates improved myocardial bioenergetics. Resuscitation. 2002;55(3):329-36.
    • 28. Strowski MZ, Sparmann G, Weber H, Fiedler F, Printz H, Jonas L, et al. Caerulein pancreatitis increases mRNA but reduces protein levels of rat pancreatic heat shock proteins. Am J Physiol. 1997;273(4 Pt 1):G937-45.
    • 29. Kohn G, Wong HR, Bshesh K, Zhao B, Vasi N, Denenberg A, et al. Heat shock inhibits tnf-induced ICAM-1 expression in human endothelial cells via I kappa kinase inhibition. Shock. 2002;17(2):91-7.
    • 30. van Haren FM, Sleigh J, Boerma EC, La Pine M, Bahr M, Pickkers P, et al. Hypertonic fluid administration in patients with septic shock: a prospective randomized controlled pilot study. Shock. 2012;37(3):268-75.

    Autor correspondente: Francisco Garcia Soriano LIM-51, Faculdade de Medicina, Universidade de São Paulo Avenida Dr. Arnaldo, 455, 3º andar, sala 3.189 - Cerqueira César CEP: 01246-903 - São Paulo (SP), Brasil E-mail: gsoriano@usp.br

    Datas de Publicação

    • Publicação nesta coleção
      31 Jan 2013
    • Data do Fascículo
      Dez 2012

    Histórico

    • Recebido
      03 Set 2012
    • Aceito
      31 Out 2012
    Associação de Medicina Intensiva Brasileira - AMIB Rua Arminda, 93 - Vila Olímpia, CEP 04545-100 - São Paulo - SP - Brasil, Tel.: (11) 5089-2642 - São Paulo - SP - Brazil
    E-mail: rbti.artigos@amib.com.br