Accessibility / Report Error

Genetic variability of Leishmania (Leishmania) infantum causing human visceral leishmaniasis in the Southeastern Brazil

ABSTRACT

Leishmania infantum is a protozoan that causes visceral leishmaniasis (VL) in the Americas and some regions of Europe. The disease is mainly characterized by hepatosplenomegaly and fever, and can be fatal. Factors related to the host and parasite can contribute to the transmission of Leishmania and the clinical outcome. The intraspecific genetic variability of L. infantum strains may be one of these factors. In this study, we evaluated the genetic variability of L. infantum obtained from bone marrow smear slides from patients in the Sao Paulo State, Brazil. For this, the minicircle of the kDNA hypervariable region was used as target by Sanger sequencing. By analyzing the similarity of the nucleotides and the maximum likelihood tree (Fasttree), we observed a high similarity (98%) among samples. Moreover, we identified four different profiles of L. infantum. In conclusion, L. infantum strains from Sao Paulo State, Brazil, showed low diversity measured by minicircle of the kDNA hypervariable region.

Leishmania infantum; Human visceral leishmaniasis; kDNA minicircle; Sequencing; Polymorphism

INTRODUCTION

Visceral leishmaniasis (VL) is a parasitic disease caused by two species of Leishmania; Leishmania (Leishmania) donovani; and Leishmania (L.) infantum (sin Leishmania (L.) chagasi), according to geographic region11. Van Griensven J, Diro E. Visceral leishmaniasis. Infect Dis Clin North Am. 2012;26:309-22., occurring autochthonously in developed and underdeveloped countries. In Brazil, VL is a zoonosis caused by L. infantum, transmitted mainly by Lutzomyia longalpis11. Van Griensven J, Diro E. Visceral leishmaniasis. Infect Dis Clin North Am. 2012;26:309-22.. The human disease, still endemic in the country, quickly spread to other regions and urban centers in the country, with a series of cases being observed since 1999 in the Sao Paulo State, Brazil. Currently, it is known that its expansion through the Sao Paulo State follows the route of the Marechal Rondon highway, in the west-east direction22. Cardim MF, Guirado MM, Dibo MR, Chiaravalloti-Neto F. Visceral leishmaniasis in the state of Sao Paulo, Brazil: spatial and space-time analysis. Rev Saude Publica. 2016;50:48.,33. Motoie G, Ferreira GE, Cupolillo E, Canavez F, Pereira-Chioccola VL. Spatial distribution and population genetics of Leishmania infantum genotypes in São Paulo State, Brazil, employing multilocus microsatellite typing directly in dog infected tissues. Infect Genet Evol. 2013;18:48-59.. A spread of human visceral leishmaniasis (HVL) was noted due to the large flow of people in these highways, with the first case reported in the Northwest region of Sao Paulo State. Some factors may be related to the spread of the disease, such as deforestation, construction of new roads, and immigration11. Van Griensven J, Diro E. Visceral leishmaniasis. Infect Dis Clin North Am. 2012;26:309-22.,22. Cardim MF, Guirado MM, Dibo MR, Chiaravalloti-Neto F. Visceral leishmaniasis in the state of Sao Paulo, Brazil: spatial and space-time analysis. Rev Saude Publica. 2016;50:48.. One of the factors may be related to the parasite since different strains of L. infantum are observed circulating across different geographic regions44. Alvarenga JS, Ligeiro CM, Gontijo CM, Cortes S, Campino L, Vago AR, et al MN. KDNA genetic signatures obtained by LSSP-PCR analysis of Leishmania (Leishmania) infantum isolated from the New and the Old World. PLoS One. 2012;7:e43363.. Genomic plasticity can be observed in Leishmania, which allows the parasite to adapt to different environments, including different vertebrate hosts55. Kuhls K, Keilonat L, Ochsenreither S, Schaar M, Schweynoch C, Presber W, et al. Isolated populations between and within the main endemic regions of visceral leishmaniasis. Microbes Infect. 2007;9:334-43.

6. Botilde Y, Laurent T, Tintaya WQ, Chicarro C, Canavate C, Cruz I, et al. Comparison of molecular markers for strain typing of Leishmania infantum. Infect Genet Evol. 2006;6:440-6.
-77. Cupolillo E., Cavalcanti AS, Ferreira GE, Boité MC, Morgado FN, Porrozzi R. Occurrence of multiple genotype infection caused by Leishmania infantum in naturally infected dogs. PLoS Negl Trop Dis. 2020;14:e0007986.. Its high genetic plasticity generates a high rate of genetic mutations, which can generate heterogeneity in Leishmania populations33. Motoie G, Ferreira GE, Cupolillo E, Canavez F, Pereira-Chioccola VL. Spatial distribution and population genetics of Leishmania infantum genotypes in São Paulo State, Brazil, employing multilocus microsatellite typing directly in dog infected tissues. Infect Genet Evol. 2013;18:48-59.,88. Alonso DP, Costa DL, Mendonça IL, Costa CH, Ribolla PE. Heterogeneity of Leishmania infantum chagasi kinetoplast DNA in Teresina (Brazil). Am J Trop Med Hyg. 2010;82:819-21.

9. Pasquali AK, Baggio RA, Boeger WA, Gonzalez-Britez N, Guedes DC, Chaves EC, et al. Dispersion of Leishmania (Leishmania) infantum in central-southern Brazil: Evidence from an integrative approach. PLoS Negl Trop Dis. 2019;13:e0007639.
-1010. Kaufer A, Stark D, Ellis J. A review of the systematics, species identification and diagnostics of the Trypanosomatidae using the maxicircle kinetoplast DNA: from past to present. Int J Parasitol. 2020;50:449-60.. Some studies have used different targets and methodologies to measure polymorphisms in Leishmania. In this context, various regions and genes, such as maxicircles, minicircles, hsp 70, ssrDNA, and microsatellites, are used to detect genetic polymorphisms of Leishmania33. Motoie G, Ferreira GE, Cupolillo E, Canavez F, Pereira-Chioccola VL. Spatial distribution and population genetics of Leishmania infantum genotypes in São Paulo State, Brazil, employing multilocus microsatellite typing directly in dog infected tissues. Infect Genet Evol. 2013;18:48-59.,44. Alvarenga JS, Ligeiro CM, Gontijo CM, Cortes S, Campino L, Vago AR, et al MN. KDNA genetic signatures obtained by LSSP-PCR analysis of Leishmania (Leishmania) infantum isolated from the New and the Old World. PLoS One. 2012;7:e43363.,77. Cupolillo E., Cavalcanti AS, Ferreira GE, Boité MC, Morgado FN, Porrozzi R. Occurrence of multiple genotype infection caused by Leishmania infantum in naturally infected dogs. PLoS Negl Trop Dis. 2020;14:e0007986.,88. Alonso DP, Costa DL, Mendonça IL, Costa CH, Ribolla PE. Heterogeneity of Leishmania infantum chagasi kinetoplast DNA in Teresina (Brazil). Am J Trop Med Hyg. 2010;82:819-21.,1010. Kaufer A, Stark D, Ellis J. A review of the systematics, species identification and diagnostics of the Trypanosomatidae using the maxicircle kinetoplast DNA: from past to present. Int J Parasitol. 2020;50:449-60.,1111. Cortes S, Mauricio I, Almeida A, Cristovão JM, Pratlong F, Dedet JP, et al. Application of kDNA as a molecular marker to analyse Leishmania infantum diversity in Portugal. Parasitol Int. 2006;55:277-83.. In this study, we used the hypervariable region of the kDNA minicircle to evaluate the presence of polymorphisms of L. infantum in samples from the Sao Paulo State, Brazil. This approach is due to the high discriminatory capacity of the kDNA minicircle in the sense of geographical regionalization of variant genotypes, previously described in the literature66. Botilde Y, Laurent T, Tintaya WQ, Chicarro C, Canavate C, Cruz I, et al. Comparison of molecular markers for strain typing of Leishmania infantum. Infect Genet Evol. 2006;6:440-6.,1111. Cortes S, Mauricio I, Almeida A, Cristovão JM, Pratlong F, Dedet JP, et al. Application of kDNA as a molecular marker to analyse Leishmania infantum diversity in Portugal. Parasitol Int. 2006;55:277-83.,1212. El Hamouchi A, Ejghal R, Hida M, Lemrani M. Intraspecific genetic variability in a population of Moroccan Leishmania infantum revealed by PCR-RFLP of kDNA minicircles. Acta Trop. 2017;169:142-9..

MATERIALS AND METHODS

Ethics statement

This study was approved by the IMT-USP Research Ethics Committee, CAEE protocol Nº: 45561115.0.0000.0065.

Samples

Samples prepared in Giemsa-stained smears on microscope slides were obtained from 66 bone marrow aspirates from patients with visceral leishmaniasis, from January 2007 to June 2016, provided by Instituto Adolfo Lutz. The samples were from different regions from Sao Paulo State (23° 32’ 51” S 46° 38’ 19” W), located in Southeastern Brazil.

Molecular procedures

DNA extraction

The smears stained with Giemsa on microscope slides were subjected to a previous hydration step to eliminate excess dyes and facilitate scraping of the fixed material, allowing greater recovery of the genetic material. They were immersed in alcohols, for 5 min, in decreasing concentrations of ethanol: 100%, 90%, 80%, 70%, ending in distilled water. After hydration, the samples were subjected to DNA extraction following the Qiagen manufacturer’s instructions and the DNA was quantified by NanoDrop 1000 (Thermo Scientific TM, USA).

Polymerase chain reaction

Positive samples were subjected to the MC1 and MC2 primers (5’ GTTAGCCGATGGTGGTCTTG 3’ CACCCATTTTTCCGATTTTG 3’), specific for the Leishmania (Leishmania) subgenus of the donovani complex. PCR (MC1/MC2) amplified 447bp of the partial sequence of the minicircles, following the PCR-kDNA protocol1212. El Hamouchi A, Ejghal R, Hida M, Lemrani M. Intraspecific genetic variability in a population of Moroccan Leishmania infantum revealed by PCR-RFLP of kDNA minicircles. Acta Trop. 2017;169:142-9.. The amplified products were purified following the manufacturer recommendations of QIAquick PCR purification kit (Qiagen, Switzerland).

Sequencing and genetic analysis

For the sequencing reaction, the BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, USA) was used. Sequencing reading was performed on the ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, USA). For genetic identity analysis, the results were presented in a frequency distribution of identity pairs in a graphical interface.

The similarity between Brazilian sequences and some strains of Leishmania spp. is indicated by color percentages, according to the scale pattern indicated in each diagram. For the phylogenetic analysis, the best model was selected according to the likelihood ratio test (LRT) implemented in the jModeltest tool. The maximum likelihood phylogenetic tree was inferred using the GTR+ gamma correction and the model proportion of invariant locations. Branch support was obtained by the approximate likelihood ratio test (aLRT) and is shown in a color scale.

RESULTS

DNA extraction from fixed and stained smears on microscope slides using the modified QIAamp Mini Kit (Qiagen, Switzerland) yielded an average of 20 ng/µL and 1.8 (260/280) as a quality reference standard. Of the 66 screened samples, 22 were amplified and were positive for L. infantum DNA by PCR-kDNA (MC1/MC2), which corresponds to a fragment of 447 bp (Figure 1).

Figure 1
Agarose gel electrophoresis (1.8%) of amplified DNA from bone marrow smear of patients with visceral leishmaniasis after PCR-kDNA (MC1/MC2 primers). M-100 (ladder of 100bp), PC (Positive Control), 1 and 2 (promastigote DNA added to healthy individual DNA), CN (negative control), 3 and 4 (patient samples); M-100 (ladder of 100 bp).

When analyzing the nucleotide similarity of the kDNA minicircle, the Sao Paulo State samples showed homogeneity, with 98% of similarity among them when compared with isolates available on GenBank (Figure 2).

Figure 2
Nucleotide similarity of the hypervariable region of the Leishmania kinetoplast. Diagrams indicate similarity between the Brazilian sequences and some strains of Leishmania spp. The similarity percentages are indicated by colors according to the scale pattern indicated in each diagram.

According to the maximum likelihood phylogenetic tree of the kDNA minicircle, we observed that the samples from Sao Paulo presented a distribution in a smaller branch, divided into four slightly different profiles. They are more distant from other GenBank isolates from sandflies and Old-World dogs (Figure 3).

Figure 3
Maximum likelihood tree of the hypervariable region (447pb) of the Leishmania kinetoplast. The tree was inferred in Fasttree software program using GTR+ gamma correction and the model proportion of invariant locations selected by the jModeltest tool. Branch support was obtained by the approximate likelihood ratio test (aLRT) and is shown in a color scale. The sequences generated in this study are highlighted in gray.

DISCUSSION

Polymorphisms in trypanosomatids, more specifically in the genus Leishmania spp., have been reported in the Americas, mainly in Brazil. Some of the studies detected the presence of polymorphisms and genotypes that cause tegumentary leishmaniasis1313. Ferreira LT, Gomes AH, Pereira-Chioccola VL. Genotype characterization of Leishmania (Viannia) braziliensis isolated from human and canine biopsies with american cutaneous leishmaniasis. Rev Inst Med Trop Sao Paulo. 2015;57:257-62.. However, there are few works of genotyping and identification of polymorphisms of Leishmania species that cause visceral leishmaniasis. Most of these studies used culture isolates and, therefore, Leishmania in its promastigote morphology. Few studies used amastigotes obtained directly from the bone marrow, as was one of the focuses of our work44. Alvarenga JS, Ligeiro CM, Gontijo CM, Cortes S, Campino L, Vago AR, et al MN. KDNA genetic signatures obtained by LSSP-PCR analysis of Leishmania (Leishmania) infantum isolated from the New and the Old World. PLoS One. 2012;7:e43363.,88. Alonso DP, Costa DL, Mendonça IL, Costa CH, Ribolla PE. Heterogeneity of Leishmania infantum chagasi kinetoplast DNA in Teresina (Brazil). Am J Trop Med Hyg. 2010;82:819-21.,1111. Cortes S, Mauricio I, Almeida A, Cristovão JM, Pratlong F, Dedet JP, et al. Application of kDNA as a molecular marker to analyse Leishmania infantum diversity in Portugal. Parasitol Int. 2006;55:277-83.. Recent studies that have investigated polymorphisms showed a considerable degree of homogeneity between populations of L. infantum in humans, dogs, and sandflies, circulating both in the Old and New World55. Kuhls K, Keilonat L, Ochsenreither S, Schaar M, Schweynoch C, Presber W, et al. Isolated populations between and within the main endemic regions of visceral leishmaniasis. Microbes Infect. 2007;9:334-43.,1414. Batista LF, Segatto M, Guedes CE, Sousa RS, Rodrigues CA, Brazuna JC, et al. An assessment of the genetic diversity of Leishmania infantum isolates from infected dogs in Brazil. Am J Trop Med Hyg. 2012;86:799-806.

15. Segatto M, Ribeiro LS, Costa DL, Costa CH, Oliveira MR, Carvalho SF, et al. Genetic diversity of Leishmania infantum field populations from Brazil. Mem Inst Oswaldo Cruz. 2012;107:39-47.

16. Silva TA, Gomes LI, Oliveira E, Coura-Vital W, Silva LA, Pais FS, et al. Genetic homogeneity among Leishmania (Leishmania) infantum isolates from dog and human samples in Belo Horizonte Metropolitan Area (BHMA), Minas Gerais, Brazil. Parasit Vectors. 2015;8:226.
-1717. Nunes RV, Quaresma PF, Rugani JM, Teixeira-Neto RG, Vahia LS, Silva ES. Molecular characterization of Leishmania infantum isolates in municipalities of the state of Minas Gerais, Brazil. Trans R Soc Trop Med Hyg. 2018;112:43-5.. These findings also contrast with different screening targets, such as hsp70, maxicircle, and microsatellite panel that distinguished distinct profiles and dispersal routes. However, they showed aneuploidy and low variability among isolates77. Cupolillo E., Cavalcanti AS, Ferreira GE, Boité MC, Morgado FN, Porrozzi R. Occurrence of multiple genotype infection caused by Leishmania infantum in naturally infected dogs. PLoS Negl Trop Dis. 2020;14:e0007986.,99. Pasquali AK, Baggio RA, Boeger WA, Gonzalez-Britez N, Guedes DC, Chaves EC, et al. Dispersion of Leishmania (Leishmania) infantum in central-southern Brazil: Evidence from an integrative approach. PLoS Negl Trop Dis. 2019;13:e0007639.,1818. Solana JC, Chicharro C, García E, Aguado B, Moreno J, Requena JM. Assembly of a large collection of maxicircle sequences and their usefulness for Leishmania taxonomy and strain typing. Genes (Basel). 2022;13:1070.,1919. Patino LH, Castillo-Castaneda A, Munoz M, Muskus C, Rivero-Rodriguez M, Pérez-Doria A, et al. Revisiting the heterogeneous global genomic population structure of Leishmania infantum. Microb Genom. 2021;7:000640.. Few studies presented some distinction and characterization of these populations present in L. infantum; however, they were based on culture isolates55. Kuhls K, Keilonat L, Ochsenreither S, Schaar M, Schweynoch C, Presber W, et al. Isolated populations between and within the main endemic regions of visceral leishmaniasis. Microbes Infect. 2007;9:334-43.,77. Cupolillo E., Cavalcanti AS, Ferreira GE, Boité MC, Morgado FN, Porrozzi R. Occurrence of multiple genotype infection caused by Leishmania infantum in naturally infected dogs. PLoS Negl Trop Dis. 2020;14:e0007986.,1010. Kaufer A, Stark D, Ellis J. A review of the systematics, species identification and diagnostics of the Trypanosomatidae using the maxicircle kinetoplast DNA: from past to present. Int J Parasitol. 2020;50:449-60.,1212. El Hamouchi A, Ejghal R, Hida M, Lemrani M. Intraspecific genetic variability in a population of Moroccan Leishmania infantum revealed by PCR-RFLP of kDNA minicircles. Acta Trop. 2017;169:142-9.. Isolates obtained from culture of Leishmania are considered an inconvenient bias for the interpretation of results, according to Tomás-Pérez et al.2020. Tomás-Pérez M, Hide M, Riera C, Montoya L, Bañuls AL, Ribera E, et al. Multilocus microsatellite typing of Leishmania infantum isolates in monitored Leishmania/HIV coinfected patients. Parasit Vectors. 2015;8:386.. On the other hand, Cupollilo et al.77. Cupolillo E., Cavalcanti AS, Ferreira GE, Boité MC, Morgado FN, Porrozzi R. Occurrence of multiple genotype infection caused by Leishmania infantum in naturally infected dogs. PLoS Negl Trop Dis. 2020;14:e0007986. showed similarity in paired samples from tissue and culture by using MLMT by microsatellites. Our study detected homogeneity among the strains of L. infantum obtained from the bone marrow. When our sequences were grouped and compared with different strains from the GenBank, a uniform distribution was observed and most of them presented a very high level of similarity between them (Figure 2 and 33. Motoie G, Ferreira GE, Cupolillo E, Canavez F, Pereira-Chioccola VL. Spatial distribution and population genetics of Leishmania infantum genotypes in São Paulo State, Brazil, employing multilocus microsatellite typing directly in dog infected tissues. Infect Genet Evol. 2013;18:48-59.). Therefore, it was not possible to consider a great genetic population diversity of L. infantum in Sao Paulo State using our methodology. To investigate the presence of polymorphisms in L. infantum, we investigated some studies that chose kDNA as a target by PCR, i.e., the Leishmania DNA sequence that appears in the greatest number of times and repeatedly88. Alonso DP, Costa DL, Mendonça IL, Costa CH, Ribolla PE. Heterogeneity of Leishmania infantum chagasi kinetoplast DNA in Teresina (Brazil). Am J Trop Med Hyg. 2010;82:819-21.,1111. Cortes S, Mauricio I, Almeida A, Cristovão JM, Pratlong F, Dedet JP, et al. Application of kDNA as a molecular marker to analyse Leishmania infantum diversity in Portugal. Parasitol Int. 2006;55:277-83.,1212. El Hamouchi A, Ejghal R, Hida M, Lemrani M. Intraspecific genetic variability in a population of Moroccan Leishmania infantum revealed by PCR-RFLP of kDNA minicircles. Acta Trop. 2017;169:142-9.,1616. Silva TA, Gomes LI, Oliveira E, Coura-Vital W, Silva LA, Pais FS, et al. Genetic homogeneity among Leishmania (Leishmania) infantum isolates from dog and human samples in Belo Horizonte Metropolitan Area (BHMA), Minas Gerais, Brazil. Parasit Vectors. 2015;8:226..

However, differently from other authors88. Alonso DP, Costa DL, Mendonça IL, Costa CH, Ribolla PE. Heterogeneity of Leishmania infantum chagasi kinetoplast DNA in Teresina (Brazil). Am J Trop Med Hyg. 2010;82:819-21.,1111. Cortes S, Mauricio I, Almeida A, Cristovão JM, Pratlong F, Dedet JP, et al. Application of kDNA as a molecular marker to analyse Leishmania infantum diversity in Portugal. Parasitol Int. 2006;55:277-83.,1212. El Hamouchi A, Ejghal R, Hida M, Lemrani M. Intraspecific genetic variability in a population of Moroccan Leishmania infantum revealed by PCR-RFLP of kDNA minicircles. Acta Trop. 2017;169:142-9., we evaluated the genetic variability directly from the parasite DNA in the smears, rather than from culture isolates. The cited authors used PCR-RFLP to target the kDNA region and identify the predominant polymorphisms and genetic profiles of Leishmania spp. by performing a previous culture and concentration of parasites in the promastigote form. Our studies demonstrated genetic variability among samples, however, they did not confirm the presence of polymorphisms in the same kDNA target region. Moreover, other recent studies44. Alvarenga JS, Ligeiro CM, Gontijo CM, Cortes S, Campino L, Vago AR, et al MN. KDNA genetic signatures obtained by LSSP-PCR analysis of Leishmania (Leishmania) infantum isolated from the New and the Old World. PLoS One. 2012;7:e43363.,1515. Segatto M, Ribeiro LS, Costa DL, Costa CH, Oliveira MR, Carvalho SF, et al. Genetic diversity of Leishmania infantum field populations from Brazil. Mem Inst Oswaldo Cruz. 2012;107:39-47.,1616. Silva TA, Gomes LI, Oliveira E, Coura-Vital W, Silva LA, Pais FS, et al. Genetic homogeneity among Leishmania (Leishmania) infantum isolates from dog and human samples in Belo Horizonte Metropolitan Area (BHMA), Minas Gerais, Brazil. Parasit Vectors. 2015;8:226. found a high degree of homogeneity when compared to other molecular techniques and geographic region. Furthermore, the profiles obtained were grouped according to their geographic region44. Alvarenga JS, Ligeiro CM, Gontijo CM, Cortes S, Campino L, Vago AR, et al MN. KDNA genetic signatures obtained by LSSP-PCR analysis of Leishmania (Leishmania) infantum isolated from the New and the Old World. PLoS One. 2012;7:e43363.,1212. El Hamouchi A, Ejghal R, Hida M, Lemrani M. Intraspecific genetic variability in a population of Moroccan Leishmania infantum revealed by PCR-RFLP of kDNA minicircles. Acta Trop. 2017;169:142-9.. Using Sanger sequencing (kDNA region), four possible different clades were found with the samples distributed randomly. Nunes et al.1717. Nunes RV, Quaresma PF, Rugani JM, Teixeira-Neto RG, Vahia LS, Silva ES. Molecular characterization of Leishmania infantum isolates in municipalities of the state of Minas Gerais, Brazil. Trans R Soc Trop Med Hyg. 2018;112:43-5. also observed homogeneity analyzing 29 isolates of L. infantum from the bone marrow of naturally infected dogs by molecular characterization using hsp70, mpi, and ITS1. Solana et al.1818. Solana JC, Chicharro C, García E, Aguado B, Moreno J, Requena JM. Assembly of a large collection of maxicircle sequences and their usefulness for Leishmania taxonomy and strain typing. Genes (Basel). 2022;13:1070. showed that the maxicircle sequence can be used as a robust molecular marker for phylogenetic analysis and species typing within kinetoplastids, which also shows potential to discriminate intraspecific variability. Moreover, it is important to emphasize the difference between L. infantum strain from the New and Old World since the latter shows a variety of L. infantum zymodemas1111. Cortes S, Mauricio I, Almeida A, Cristovão JM, Pratlong F, Dedet JP, et al. Application of kDNA as a molecular marker to analyse Leishmania infantum diversity in Portugal. Parasitol Int. 2006;55:277-83.,1212. El Hamouchi A, Ejghal R, Hida M, Lemrani M. Intraspecific genetic variability in a population of Moroccan Leishmania infantum revealed by PCR-RFLP of kDNA minicircles. Acta Trop. 2017;169:142-9.. More modern techniques, such as NGS-based are necessary to better understand the genetic structure of L. infantum from the New World, as well as phenotypic assays to understand how this diversity can influence the disease outcome. However, it is noteworthy that our hypervariable sequence of minicircles methodology (MC1/MC2) was low cost, effective, practical, and quick in elucidating the results.

CONCLUSION

In conclusion, we highlight that our samples presented low diversity when the markers we selected were used in direct samples (amastigotes) of bone marrow. However, our data are limited by the sample size, and heterogeneity of L. infantum in Sao Paulo State, Brazil, may exist. A more detailed analysis should be performed using more than one molecular target, a consistent number of viable biological samples, and multiple L. infantum isolates from different regions.

REFERENCES

  • 1
    Van Griensven J, Diro E. Visceral leishmaniasis. Infect Dis Clin North Am. 2012;26:309-22.
  • 2
    Cardim MF, Guirado MM, Dibo MR, Chiaravalloti-Neto F. Visceral leishmaniasis in the state of Sao Paulo, Brazil: spatial and space-time analysis. Rev Saude Publica. 2016;50:48.
  • 3
    Motoie G, Ferreira GE, Cupolillo E, Canavez F, Pereira-Chioccola VL. Spatial distribution and population genetics of Leishmania infantum genotypes in São Paulo State, Brazil, employing multilocus microsatellite typing directly in dog infected tissues. Infect Genet Evol. 2013;18:48-59.
  • 4
    Alvarenga JS, Ligeiro CM, Gontijo CM, Cortes S, Campino L, Vago AR, et al MN. KDNA genetic signatures obtained by LSSP-PCR analysis of Leishmania (Leishmania) infantum isolated from the New and the Old World. PLoS One. 2012;7:e43363.
  • 5
    Kuhls K, Keilonat L, Ochsenreither S, Schaar M, Schweynoch C, Presber W, et al. Isolated populations between and within the main endemic regions of visceral leishmaniasis. Microbes Infect. 2007;9:334-43.
  • 6
    Botilde Y, Laurent T, Tintaya WQ, Chicarro C, Canavate C, Cruz I, et al. Comparison of molecular markers for strain typing of Leishmania infantum. Infect Genet Evol. 2006;6:440-6.
  • 7
    Cupolillo E., Cavalcanti AS, Ferreira GE, Boité MC, Morgado FN, Porrozzi R. Occurrence of multiple genotype infection caused by Leishmania infantum in naturally infected dogs. PLoS Negl Trop Dis. 2020;14:e0007986.
  • 8
    Alonso DP, Costa DL, Mendonça IL, Costa CH, Ribolla PE. Heterogeneity of Leishmania infantum chagasi kinetoplast DNA in Teresina (Brazil). Am J Trop Med Hyg. 2010;82:819-21.
  • 9
    Pasquali AK, Baggio RA, Boeger WA, Gonzalez-Britez N, Guedes DC, Chaves EC, et al. Dispersion of Leishmania (Leishmania) infantum in central-southern Brazil: Evidence from an integrative approach. PLoS Negl Trop Dis. 2019;13:e0007639.
  • 10
    Kaufer A, Stark D, Ellis J. A review of the systematics, species identification and diagnostics of the Trypanosomatidae using the maxicircle kinetoplast DNA: from past to present. Int J Parasitol. 2020;50:449-60.
  • 11
    Cortes S, Mauricio I, Almeida A, Cristovão JM, Pratlong F, Dedet JP, et al. Application of kDNA as a molecular marker to analyse Leishmania infantum diversity in Portugal. Parasitol Int. 2006;55:277-83.
  • 12
    El Hamouchi A, Ejghal R, Hida M, Lemrani M. Intraspecific genetic variability in a population of Moroccan Leishmania infantum revealed by PCR-RFLP of kDNA minicircles. Acta Trop. 2017;169:142-9.
  • 13
    Ferreira LT, Gomes AH, Pereira-Chioccola VL. Genotype characterization of Leishmania (Viannia) braziliensis isolated from human and canine biopsies with american cutaneous leishmaniasis. Rev Inst Med Trop Sao Paulo. 2015;57:257-62.
  • 14
    Batista LF, Segatto M, Guedes CE, Sousa RS, Rodrigues CA, Brazuna JC, et al. An assessment of the genetic diversity of Leishmania infantum isolates from infected dogs in Brazil. Am J Trop Med Hyg. 2012;86:799-806.
  • 15
    Segatto M, Ribeiro LS, Costa DL, Costa CH, Oliveira MR, Carvalho SF, et al. Genetic diversity of Leishmania infantum field populations from Brazil. Mem Inst Oswaldo Cruz. 2012;107:39-47.
  • 16
    Silva TA, Gomes LI, Oliveira E, Coura-Vital W, Silva LA, Pais FS, et al. Genetic homogeneity among Leishmania (Leishmania) infantum isolates from dog and human samples in Belo Horizonte Metropolitan Area (BHMA), Minas Gerais, Brazil. Parasit Vectors. 2015;8:226.
  • 17
    Nunes RV, Quaresma PF, Rugani JM, Teixeira-Neto RG, Vahia LS, Silva ES. Molecular characterization of Leishmania infantum isolates in municipalities of the state of Minas Gerais, Brazil. Trans R Soc Trop Med Hyg. 2018;112:43-5.
  • 18
    Solana JC, Chicharro C, García E, Aguado B, Moreno J, Requena JM. Assembly of a large collection of maxicircle sequences and their usefulness for Leishmania taxonomy and strain typing. Genes (Basel). 2022;13:1070.
  • 19
    Patino LH, Castillo-Castaneda A, Munoz M, Muskus C, Rivero-Rodriguez M, Pérez-Doria A, et al. Revisiting the heterogeneous global genomic population structure of Leishmania infantum. Microb Genom. 2021;7:000640.
  • 20
    Tomás-Pérez M, Hide M, Riera C, Montoya L, Bañuls AL, Ribera E, et al. Multilocus microsatellite typing of Leishmania infantum isolates in monitored Leishmania/HIV coinfected patients. Parasit Vectors. 2015;8:386.
  • FUNDING: This work was supported by the Sao Paulo Research Foundation (grant Nº 2016/03165-9 and 2018/05758-2).

Publication Dates

  • Publication in this collection
    20 Oct 2023
  • Date of issue
    2023

History

  • Received
    14 Mar 2023
  • Accepted
    4 Sept 2023
Instituto de Medicina Tropical de São Paulo Av. Dr. Enéas de Carvalho Aguiar, 470, 05403-000 - São Paulo - SP - Brazil, Tel. +55 11 3061-7005 - São Paulo - SP - Brazil
E-mail: revimtsp@usp.br