Accessibility / Report Error

Natural infection by Trypanosoma cruzi in triatomines and seropositivity for Chagas disease of dogs in rural areas of Rio Grande do Norte, Brazil

Abstract

INTRODUCTION:

Chagas disease is caused by the protozoa Trypanosoma cruzi. Its main reservoir is the domestic dog, especially in rural areas with favorable characteristics for vector establishment and proliferation. The aims of this study were to collect data, survey and map the fauna, and identify T. cruzi infection in triatomines, as well as to assess the presence of anti-T. cruzi antibodies in dogs in rural areas of the municipality of Mossoró, Brazil.

METHODS:

An active entomologic research was conducted to identify adult specimens through an external morphology dichotomous key. The analysis of natural infection by T. cruzi in the insects was performed by isolation in culture and polymerase chain reaction. The antibody testing for T. cruzi in dogs was performed by enzyme-linked immunosorbent assay and indirect immunofluorescence assay.

RESULTS:

A total of 68 triatomines were captured, predominantly the Triatoma brasiliensis brasiliensis (Neiva 1911) species. The vector mapping displayed areas with greater risk for parasite transmission. Of the examined triatomines (51 specimens), 41.2% (21/51) were positive on polymerase chain reaction, and all were negative on culture. In the serum testing, 11% (25/218) of dogs were seropositive, but no association was found between the serologic results and the presence and infection by T. cruzi in triatomines.

CONCLUSIONS:

This study demonstrated the movement of T. cruzi in the studied area, by the presence of vectors and naturally infected domestic reservoirs. The mapping of the studied rural area demonstrates the risk of disease transmission.

Keywords:
Chagas disease; Vector; Domestic reservoir; Diagnosis; Zoonosis

INTRODUCTION

Chagas disease (CD) is an anthropozoonosis caused by the protozoan Trypanosoma cruzi and is typically transmitted by triatomines, vectors of the Triatominae family (Hemiptera: Reduviidae), known as kissing bugs11. Chagas C. Tripanosomíase americana: forma aguda da moléstia. Mem Inst Oswaldo Cruz. 1916;8(2):37-60.

2. Souza AI, Paulino-Junior D, Sousa MG, Camacho AA. Aspectos clínico-laboratoriais da infecção natural por Trypanosoma cruzi em cães de Mato Grosso do Sul. Cienc Rural. 2008;38(5):1351-56.
-33. Dos Reis D, Monteiro WM, Bossolani GDP, Teston APM, Gomes ML, de Araújo SM, et al. Biological behaviour in mice of Trypanosoma cruzi isolates from Amazonas and Parana, Brazil. Exp parasitol. 2012;130(4):321-9..

In Brazil, the triatomine species responsible for CD transmission show wide spatial distribution and invasive potential, by adapting to homes and surrounding areas44. Argolo AM, Felix M, Pacheco R, Costa J. Doença de Chagas e seus principais vetores no Brasil. 1ª edição. Rio de Janeiro: Imperial Novo Milênio; 2008. 67p.. Vector presence can also be facilitated by constant alterations to the natural environment, caused by anthropic activities, leading to imbalances in ecosystems and modification of the behavior of insect vectors and wild animals that then enter homes for shelter and food55. Bustamante DM, De Urioste-Stone SM, Juárez JG, Pennington PMM. Ecological, social e biological risk factors for continued Trypanosoma cruzi transmission by Triatoma dimidiata in Guatemala. PLoS One. 2014;9(8):e104599.,66. Curtis-Robles R, Lewis BC, Hamer SA. High Trypanosoma cruzi infection prevalence associated with minimal cardiac pathology among wild carnivores in central Texas. Int J Parasitol Parasites Wildl. 2016;5(2):117-23..

Domestic animals, especially dogs, have an important epidemiological role, because they serve as a link between domestic and wild cycles of T. cruzi77. Tome RO, Gaio FC, Generoso D, Menozzi BD, Langoni H. Active surveillance of canine visceral leishmaniasis and american trypanossomiasis in rural dogs from non-endemic area. Rev Bras Parasitol Vet. 2011;20(1):64-6.,88. Gürtler RE, Cecere MC, Vázquez-Prokopec GM, Ceballos LA, Gurevitz JM, Del Pilar Fernández M, et al. Domestic animal hosts strongly influence human-feeding rates of the Chagas disease vector Triatoma infestans in Argentina. PLoS Negl Trop Dis. 2014;8(5):e2894.. Furthermore, they are an important disease sentinel, as their infection rates may reveal the potential of disease transmission to humans99. Mott KE, Mota EA, Sherlock I, Hoff R, Muniz TM, Oliveira TS, et al. Trypanosoma cruzi infection in dogs and cats and household seroactivity to T. cruzi in a rural community in northeast Brazil. Am J Trop Med Hyg. 1978;27(6):1123-7.

10. Garcia MN, O’Day S, Fisher-Hoch S, Gorchakov R, Patino R, Arroyo TP, et al. Uma interação entre saúde de vetores da doença de Chagas, hospedeiros de canídeos e residentes humanos ao longo da fronteira Texas-México. PLoS Negl Trop Dis . 2016;10(11):e0005074.

11. Gürtler RE, Cardinal MV. Reservoir host competence and the role of domestic and commensal hosts in the transmission of Trypanosoma cruzi. Acta Trop. 2015;151(1):32-50.
-1212. Umezawa ES, Souza AI, Pinedo-Cancino V, Marcondes M, Marcili A, Camargo LMA, et al. TESA-blot for the diagnosis of Chagas disease in dogs from co-endemic regions for Trypanosoma cruzi, Trypanosoma evansi and Leishmania chagasi. Acta Trop . 2009;111(1):15-20..

However, for a better comprehension of the epidemiology of CD, the whole cycle, including vectors, must be assessed. Therefore, identifying the vector species and infection type is crucial to understanding the biology and behavior and to evaluating the risk of disease transmission to humans and domestic animals44. Argolo AM, Felix M, Pacheco R, Costa J. Doença de Chagas e seus principais vetores no Brasil. 1ª edição. Rio de Janeiro: Imperial Novo Milênio; 2008. 67p.,1313. Herrera CP, Licon MH, Nation CS, Jameson SB, Wesson DM. Genotype diversity of Trypanosoma cruzi in small rodents and Triatoma sanguisuga from a rural area in New Orleans, Louisiana. Parasit Vectors. 2015;8:123. doi: 10.1186/s13071-015-0730-8.
https://doi.org/10.1186/s13071-015-0730-...
. An important tool used in epidemiological studies of vector-borne diseases is the mapping of the vector’s spatial distribution, allowing for the prediction of T. cruzi transmissibility between triatomine species from spatial data1414. Rengifo-Correa L, Stephens CR, Morrone JJ, Téllez-Rendón JL, González-Salazar C. Understanding transmissibility patterns of Chagas disease through complex vector-host networks. Parasitology. 2017;144(6):760-72..

Thus, this study aimed to gather data on animals in a rural area of Northeastern Brazil, as well as to map and investigate natural infection by T. cruzi in triatomines. The study also aimed to detect the presence of anti-T. cruzi antibodies in dogs in order to evaluate a possible association between infected dogs and the presence of triatomines infected by T. cruzi. and to determine environment-related factors.

METHODS

Study area and sample definition

The research was conducted in the rural area of Mossoró, located in the countryside of Rio Grande do Norte, Northeast region of Brazil. According to the State Department of Public Health, this area is considered endemic, because it presents a favorable environment for the vector’s survival, due to the proximity of forests and a city dump, as well as an accumulation of debris and organic matter from animal husbandry. A total of 11 rural areas with environmental indicators for the occurrence of triatomines and a history of vector capture between 2008 and 2012, according to the Municipal Health Surveillance Department, were used in this study.

Ethical considerations

All of the 392 residences in these areas were visited between March and July 2014, and informed consent forms were obtained from residents that agreed to participate.

The project was approved by the Ethics Committee on Animal Use of the Federal Rural University of the Semi-Arid (Universidade Federal Rural do Semi-Árido) (Ruling 62/2012 - Process 23091.002190/2012-75).

Active entomologic collection

The entomological collection consisted of a system of notification and collection by the residents of triatomines in their homes. Therefore, this method allowed for the monitoring of infestations by the local community.

Samples of different species of triatomines were presented to the residents to facilitate the recognition and capture of the insects, and they were given a polyethylene bottle containing holes in the lid to store the insects. After capture, the insects were sent to the Oswaldo Cruz Foundation Institute in Rio de Janeiro (FIOCRUZ-RJ), in a specific shipment for biological samples with a deadline of 24 hours, paid for by the institute. Upon receipt, the samples were immediately processed.

Vector identification

Properly packed triatomines were sent to the Laboratory of Leishmaniosis Transmitters of the Forensic Entomology Sector of the FIOCRUZ/RJ and identified by observing their external morphological characters, using the dichotomous key according to Lent & Wygodzinsky1515. Lent H, Wygodzinski PW. Revision of the Triatominae (Hemiptera, Reduviidae) and their significance as vectors of Chagas’ disease. Bull Am Mus Nat Hist. 1979;163(3):123-520..

Detection of natural infection by T. cruzi

In order to detect T. cruzi infection, the intestinal contents of the insects were obtained by abdominal compression and processed for parasite isolation culture and polymerase chain reaction (PCR) techniques in the Laboratory of Immunomodulation and Protozoology of FIOCRUZ/RJ.

For the isolation, the obtained contents were seeded in tubes containing biphasic Novy-MacNeal-Nicolle + Liver Infusion Tryptose culture medium, supplemented with 10% fetal bovine serum and penicillin (10,000U/mL). The tubes were kept in an incubator (FANEM, model 347) at 27°C, and the cultures were examined weekly for four months by light microscopy using an Axioplan 2 (Zeiss®) light microscope to verify positivity.

To detect T. cruzi deoxyribonucleic acid (DNA), phenol-chloroform extraction was used to obtain DNA1616. Sambrook J, Russel DW. Purification of PCR products in preparation for cloning. CSH Protoc. 2006;2006(1):pii:pdb.prot3825. doi: 10.1101/pdb.prot3825.
https://doi.org/10.1101/pdb.prot3825....
, which was then subjected to a PCR with specific primers for T. cruzi (5’ ASTCGGCTGATCGTTTTCGA 3’ and 5’ AATTCCTCCAAGCAGCGGATA 3’)1717. Rendell VR, Gilman RH, Valencia E, Galdos-Cardenas G, Verastegui M, Sanchez L, et al. Trypanosoma cruzi-infected pregnant women without vector exposure have higher parasitemia levels: implications for congenital transmission risk. PLoS One . 2015;10(3):e0119527.. The reaction was performed in a Step One Plus Real-Time PCR System, using a rapid protocol of 20 seconds at 95°C followed by 40 cycles of 3 seconds at 95°C and 30 seconds at 60°C. Ultrapure water was used as the negative control, and DNA obtained from axenic culture of the T. cruzi strain Y was used as the positive control. The amplified products were subjected to agarose gel electrophoresis at 1.5% and stained with GelRed™ (Biotium), using TBE 1x buffer as an electric conductor.

Anti-T. cruzi antibody evaluation in domestic dogs

Blood samples from 218 domestic dogs were collected and, after centrifugation, the serum samples were stored in tubes and packed at -20°C until the performance of the enzyme-linked immunosorbent assays (ELISA) and indirect immunofluorescence assays (IIF) at the Laboratory of Immunomodulation and Protozoology of FIOCRUZ/RJ.

For the anti-T. cruzi immunoglobulin G (IgG) antibody assay by IIF, immunofluorescent microscope slides with total T. cruzi antigen were produced in the Laboratory of Trypanosomatid Biology of FIOCRUZ/RJ. Previously tested positive canine serum and serum of dogs from non-endemic areas were used as positive and negative controls, respectively1818. Camargo ME. Fluorescent antibody test for serodiagnosis of American trypanosomiasis. Technical modification employing preserved forms of Trypanosoma cruzi in a slide test. Rev Inst Med Trop São Paulo. 1966;8(5):227-34.. An anti-dog IgG (FITC, Sigma™) was used as the conjugate. Serums with titration ≤1:20 were considered positive1919. Zicker F, Smith PG, Luquetti AO, Oliveira OS. Mass screening for Trypanosoma cruzi infections using the immunofluorescence, ELISA and haemagglutination tests on serum samples and on blood eluates from filter-paper. Bull World Health Organ. 1990;68(4):465-71..

A commercial kit produced by Bio-Manguinhos/FIOCRUZ and the anti-dog IgG conjugate (Peroxidase, Sigma™) were used for the ELISA. Samples were considered seropositive when they showed an optical density (OD) greater than the cut line (cut-off) obtained in each reaction.

As recommended by the World Health Organization for the diagnosis of human CD, samples were only considered positive when they reacted in both serological tests.

Data analysis

The data for the statistical analysis were obtained from the identification form of the dogs, the serology results of the dogs’ blood samples, and the presence of natural infection by T. cruzi in triatomine vectors.

To validate the serological tests, IIF test results were compared with those of a standard test. The analysis of agreement data was based on the sensitivity and specificity, using the statistical program GraphPad Prism version 6.01. The ELISA technique was used as the gold standard2020. Enriquez GF, Cardinal MV, Orozco MM, Lanati L, Schijman AG, Gurtler RE. Discrete typing units of Trypanosoma cruzi identified in rural dogs and cats in the humid Argentinean Chaco. Parasitol. 2013;140(3):303-8.,2121. Lauricella MA, Castañera MB, Gürtler RE, Segura EL. Immunodiagnosis of Trypanosoma cruzi (Chagas' disease) infection in naturally infected dogs. Mem Inst Oswaldo Cruz . 1998;93(4);501-7..

Data were entered into an electronic spreadsheet and transferred to the statistical programs SPSS 21.0 (Statistical Package for the Social Sciences) and STATA (Stata Corp., College Station, Estados Unidos) version 13.0, expressed in simple frequency and percentage, as well as prevalence ratio (PR) and confidence interval of 95%, obtained by Poisson regression. A significance level of 5% was considered.

Mapping of triatomine capture areas

The spatial distribution of the triatomines was established from geographic coordinates (latitude and longitude) of the capture sites, using a Global Positioning System (GPS) - Garmin e Trex® in the Universal Transverse Mercator (UTM) coordinate system, using the WGS-84 (or SIRGAS 2000). The free software Quantum GIS 2.8.3 was used to prepare a thematic map of the study area.

RESULTS

The study involved 279 residences, as described in Table 1, and insects were captured in 23 of them. A total of 68 triatomines were acquired, involving 54 from inside the residences and 14 from the peridomiciliary areas. In the residences in the study, 135 of them had one or more dogs, and blood samples were obtained from all 218 dogs present.

TABLE 1:
Trypanosoma cruzi evaluation, identification of triatomines, and anti-T. cruzi antibody results in dogs from rural localities in the City of Mossoró, Rio Grande do Norte.

The captured triatomines corresponded to 25 nymphs of undetermined stage, and 43 adults, identified as 69.7% (30/43) Triatoma brasiliensis brasiliensis (Neiva 1911), 23.2% (10/43) Triatoma pseudomaculata (Corrêa and Espínola 1964), 4.6% (2/43) Rhodnius nasutus (Stal 1895), and 2.3% (1/43) Panstrongylus lutzi (Neiva and Pinto 1923). The distribution of these species in the 11 rural localities is shown in Table 1. Of the 68 captured specimens, 51 (75%) were under suitable conditions to obtain intestinal contents for T. cruzi analysis by isolation culture and PCR, including 24 adult specimens of T. b. brasilensis, one of T. pseudomaculata, one of R. nasutus, and 25 nymphs. Attempts to isolate T. cruzi by culture were negative in all triatomines, but 41.1% (21/51) of the samples were positive on PCR.

The results of the serological testing for T. cruzi showed that 11% (25/218) of the dogs tested were seropositive for both tests (ELISA and IIF). The sensitivity of the test was 53.2%, and the specificity was 99.4%, with confidence intervals of 38.1 - 67.9 and 96.8 - 99.0, respectively.

There was no association between the serologic results of the dogs and the presence and infection by T. cruzi in triatomines. The same was observed for dog-related factors, such as gender, role, and the presence of shelter or other animals (Table 2).

TABLE 2:
Prevalence of the variables function, gender, presence of shelter, presence of other animals, and presence and infection by T. cruzi in triatomines with seropositive dogs for Chagas disease in rural areas.

Triatomines were present in eight of the eleven rural localities included in this study, as shown in Figure 1.

FIGURE 1:
Mapping of rural localities of Mossoró, Rio Grande do Norte with triatomine capture history between 2008 and 2012, highlighting localities with active entomologic capture of triatomines and infection by Trypanosoma cruzi.

DISCUSSION

The transmission of CD is undoubtedly influenced by socio-cultural, political, economic, environmental, and historical factors2222. Ventura-Garcia L, Roura M, Pell C, Posada E, Gascón J, Aldasoro E, et al. Socio-cultural aspects of Chagas disease: a systematic review of qualitative research. PLoS Negl Trop Dis . 2013;7(9):e-2410., because the occurrence of this disease reflects how the population occupies and explores the environment in which it lives2323. Grijalva MJ, Terán D, Dangles O. Dynamics of sylvatic Chagas disease vectors in coastal Ecuador is driven by changes in land cover. PLoS Negl Trop Dis . 2014;8(6):e-2960.. Studies have shown that information about the vectors of CD in endemic areas is lacking, leading to the inefficiency of intervention programs2424. Urioste-Stone SM, Pennington PM, Pellecer E, Aguilar TM, Samayoa G, Perdomo HD, et al. Development of a community-based intervention for the control of Chagas disease based on peridomestic animal management: an eco-bio-social perspective. Trans R Soc Trop Med Hyg. 2015;109(2):159-67.. Control programs of these areas should focus on educational measures adapted to the local context, elucidating the importance of the capture of the vectors and notification of the authorities to control the disease2525. Villela MM, Pimenta DN, Lamounier PA, Dias JCP. Avaliação de conhecimentos e práticas que adultos e crianças têm acerca da doença de Chagas e seus vetores em região endêmica de Minas Gerais, Brasil. Cad Saude Publica. 2009;25(8):1701-10..

The species found in this study are also distributed in other states of Brazil44. Argolo AM, Felix M, Pacheco R, Costa J. Doença de Chagas e seus principais vetores no Brasil. 1ª edição. Rio de Janeiro: Imperial Novo Milênio; 2008. 67p.,2626. Gurgel-Gonçalves R, Pereira FDCA, Lima IP, Cavalcante RR. Distribuição geográfica, infestação domiciliar e infecção natural de triatomíneos (Hemiptera: Reduviidae) no Estado do Piauí, Brasil, 2008. Rev Pan-Amaz Saude. 2010;1(4):57-64.; however, the Northeast Region of Brazil is considered the epicenter of dispersion of T. brasiliensis and T. pseudomaculata2727. Gurgel-Gonçalves R, Galvão C, Costa J, Peterson AT. Geographic distribution of Chagas disease vectors in Brazil based on ecological niche modeling. J Trop Med. 2012;2012(1):1-15. doi: 10.1155/2012/705326.
https://doi.org/10.1155/2012/705326....
. Geographical distribution of R. nasutus and P. lutz is restricted to certain regions of the Northeast region2828. Silva MBA, Barreto AVMS, Silva HAD, Galvão C, Rocha D, Jurberg J, et al. Synanthropic triatomines (Hemiptera, Reduviidae) in the state of Pernambuco, Brazil: Geographical distribution and natural Trypanosoma infection rates between 2006 and 2007. Rev Soc Bras Med Trop. 2012;45(1):60-5., and both species are considered secondary vectors for T. cruzi transmission. However, research in Colombia has shown the relevance of these species, demonstrating that 59.4% of the secondary vectors had humans as the main food source2929. Hernández C, Salazar C, Brochero H, Teherán A, Buitrago LS, Vera M, et al. Untangling the transmission dynamics of primary and secondary vectors of Trypanosoma cruzi in Colombia: parasite infection, feeding sources and discrete typing units. Parasit Vectors . 2016;9(1):2-12..

Studies have demonstrated that T. brasiliensis is the most important T. cruzi vector in Northeastern Brazil, with a high rate of infection3030. Coutinho CFS, Souza-Santos R, Teixeira NFD, Georg I, Gomes TF, Boia MN, et al. An entomoepidemiological investigation of Chagas disease in the state of Ceará, Northeast Region of Brazil. Cad Saude Publica . 2014;30(4):785-93.,3131. Valença-Barbosa C, Lima MM, Sarquis O, Bezerra CM, Abad-Franch F. Modeling disease vector occurrence when detection is imperfect II: Drivers of site-occupancy by synanthropic Triatoma brasiliensis in the Brazilian Northeast. PLoS Negl Trop Dis . 2014;8(5):e2861.. This fact is attributed to the adaptability of this species to the hot and dry climate conditions of the Northeast region, where it only rains a few months out of the year3232. Waleckx E, Gourbière S, Dumonteil E. Intrusive versus domiciliated triatomines and the challenge of adapting vector control practices against Chagas disease. Mem Inst Oswaldo Cruz . 2015;110(3):324-38.. This species of triatomine has high adaptability to a human habitat, corroborating the present study, which noted household and peridomiciliary presence of the same species. T. brasiliensis is classified as a domestic species due to the household presence of adults, nymphs, eggs, and molt3232. Waleckx E, Gourbière S, Dumonteil E. Intrusive versus domiciliated triatomines and the challenge of adapting vector control practices against Chagas disease. Mem Inst Oswaldo Cruz . 2015;110(3):324-38.. This adaptability to the home area can also restrict its access to domestic and synanthropic animals as a food source3333. Waleckx E, Camara-Mejia J, Ramirez-Sierra MJ, Cruz-Chan V, Rosado-Vallado M, Vazquez-Narvaez S, et al. An innovative ecohealth intervention for Chagas disease vector control in Yucatan, Mexico. Trans R Soc Trop Med Hyg . 2015;109(2):143-9.. Therefore, T. cruzi infection in these vectors may be crucial for the establishment of infection in humans and domestic animals.

Triatoma pseudomaculata is also important for the epidemiological surveillance of CD, since it’s the most frequent species after T. brasiliensis2727. Gurgel-Gonçalves R, Galvão C, Costa J, Peterson AT. Geographic distribution of Chagas disease vectors in Brazil based on ecological niche modeling. J Trop Med. 2012;2012(1):1-15. doi: 10.1155/2012/705326.
https://doi.org/10.1155/2012/705326....
,3434. Mendes-Pereira J, Almeida PS, Sousa AV, Moraes de Paula A, Machado RB, Gurgel-Gonçalves R. Climatic factors influencing triatomine occurrence in Central-West Brazil. Mem Inst Oswaldo Cruz . 2013;108(3):335-41.. This species often shelters itself in locations of the residence that receive more sunlight, such as the rooftop3030. Coutinho CFS, Souza-Santos R, Teixeira NFD, Georg I, Gomes TF, Boia MN, et al. An entomoepidemiological investigation of Chagas disease in the state of Ceará, Northeast Region of Brazil. Cad Saude Publica . 2014;30(4):785-93., and is well suited to the high temperatures observed in the study area3535. Vinhaes MC, de Oliveira SV, Reis PO, de Lacerda Sousa AC, Silva RA, Obara MT, et al. Assessing the vulnerability of Brazilian municipalities to the vectorial transmission of Trypanosoma cruzi using multi-criteria decision analysis. Acta Trop . 2014;137(1):105-10..

Regarding the testing for the presence of T. cruzi in triatomines, the negative results in the culture isolation may be associated with absence of viable parasites in inoculated samples, which is linked to the handling difficulty and death of the insects3636. Bezerra RC, Amato Neto V. Trypanosoma cruzi, hemocultura: uma abordagem prática. Rev Bras Clin Med. 2010;8(3):205-7., the contamination of the culture medium inhibiting the growth of the parasite, and the possibility that some strains of T. cruzi have a poor growth in culture3737. Castro AM, Luquetti AO, Rassi A, Rassi GG, Chiari E, Galvão LM. Blood culture and polymerase chain reaction for the diagnosis of the chronic phase of human infection with Trypanosoma cruzi. Parasitol Res. 2002;88(10):894-900.. However, infection of triatomines was confirmed by the detection of T. cruzi DNA by PCR in 41.17% of the samples. Therefore, we do not recommend the use of the isolation technique in culture to investigate the presence of T. cruzi in samples from the intestinal tract of insects.

The variation in the rate of infection by T. cruzi in this study may be associated with the dominant vector in each region, since each triatomine genera has a preference to certain natural or artificial ecotypes3030. Coutinho CFS, Souza-Santos R, Teixeira NFD, Georg I, Gomes TF, Boia MN, et al. An entomoepidemiological investigation of Chagas disease in the state of Ceará, Northeast Region of Brazil. Cad Saude Publica . 2014;30(4):785-93.,3838. Peterson JK, Bartsch SM, Lee BY, Dobson AP. Broad patterns in domestic vector-borne Trypanosoma cruzi transmission dynamics: synanthropic animals and vector control. Parasit Vectors . 2015;8(1):537., which may make them more susceptible to infection. For example, Coutinho et al.3030. Coutinho CFS, Souza-Santos R, Teixeira NFD, Georg I, Gomes TF, Boia MN, et al. An entomoepidemiological investigation of Chagas disease in the state of Ceará, Northeast Region of Brazil. Cad Saude Publica . 2014;30(4):785-93. observed that there is greater natural infection by T. cruzi in triatomines housed in wood piles, because these sites function as burrows of small animals, such as rodents and marsupials, that are wild reservoirs of T. cruzi. These animals then have a high capacity to infect the vectors3838. Peterson JK, Bartsch SM, Lee BY, Dobson AP. Broad patterns in domestic vector-borne Trypanosoma cruzi transmission dynamics: synanthropic animals and vector control. Parasit Vectors . 2015;8(1):537., while dogs, cats, and humans show much less infectivity to triatomines3939. Enriquez GF, Bua J, Orozco MM, Wirth S, Schijman G, Gürtler RE, et al. High levels of Trypanosoma cruzi DNA determined by qPCR and infectiousness to Triatoma infestans support dogs and cats are major sources of parasites for domestic transmission. Infect Genet Evol. 2014;25(1):36-43..

The present study utilized serologic tests for canine CD diagnosis because, although the primary infection with T. cruzi includes an initial phase with high parasitemia, this phase lasts a short time2121. Lauricella MA, Castañera MB, Gürtler RE, Segura EL. Immunodiagnosis of Trypanosoma cruzi (Chagas' disease) infection in naturally infected dogs. Mem Inst Oswaldo Cruz . 1998;93(4);501-7.,4040. Balan LU, Yerbes IM, Piña MAN, Balmes J, Pascual A, Hernández O, et al. Higher seroprevalence of Trypanosoma cruzi infection in dogs than in humans in an urban area of Campeche, Mexico. Vector Borne Zoonotic Dis. 2011;11(7):843-4., whereas T. cruzi antibodies persist at detectable levels for a long time3939. Enriquez GF, Bua J, Orozco MM, Wirth S, Schijman G, Gürtler RE, et al. High levels of Trypanosoma cruzi DNA determined by qPCR and infectiousness to Triatoma infestans support dogs and cats are major sources of parasites for domestic transmission. Infect Genet Evol. 2014;25(1):36-43.,4141. Gürtler R, Cecere M, Lauricella M, Cardinal M, Kitron U, Cohen J. Domestic dogs and cats as sources of Trypanosoma cruzi infection in rural northwestern Argentina. Parasitology . 2007;134(1):69-82.. Nevertheless, no serologic test is currently considered the gold standard for CD, so the use of both ELISA and IIF for the diagnosis allows the obtainment of a reliable serology result4242. Sessa PA, Pimentel RR, Ferreira AL, Falqueto A. Soroprevalência da doença de Chagas em crianças em idade escolar do estado do Espírito Santo, Brasil, em 1999-2000, 2002. Cad Saude Publica . 2002;18(6):1765-9.. The variation in the concordance between serologic tests may occur due to the incidence of reactivity between closely related trypanosomes, such as Trypanosoma rangeli and Leishmania spp.1212. Umezawa ES, Souza AI, Pinedo-Cancino V, Marcondes M, Marcili A, Camargo LMA, et al. TESA-blot for the diagnosis of Chagas disease in dogs from co-endemic regions for Trypanosoma cruzi, Trypanosoma evansi and Leishmania chagasi. Acta Trop . 2009;111(1):15-20.,4343. Matos HJ, Pinto AYN, Miranda AMM, Silva FLC, Ramos FLP. Reação cruzada nos testes sorológicos entre doença de Chagas e leishmaniose visceral em regiões endêmicas para ambas as doenças. Rev Pan-Amaz Saude . 2015;6(1):65-68..

The seropositivity of dogs in this study (11.5%) was lower than that found in areas with the presence of triatomine vectors known to be infected, such Colombia, where 71.6% of dogs were seropositive through ELISA and IIF techniques, and the State of Ceará, Brazil, where Bezerra et al. found 38% seropositivity using the same tests4444. Bezerra CM, Cavalcanti LP, Souza RD, Barbosa SE, Xavier SC, Jansen AM, et al. Domestic, peridomestic and wild hosts in the transmission of Trypanosoma cruzi in the Caatinga area colonised by Triatoma brasiliensis. Mem Inst Oswaldo Cruz . 2014;109(7):887-98.. However, similar results to this study were observed in Peru, where the seropositivity in dogs was 12.3% by ELISA and TESA-blot techniques, and the main vector for the parasite identified in the region was Triatoma infestans4545. Castillo-Neyra R, Chou Chu LC, Quispe-Machaca V, Ancca-Juarez J,Malaga Chavez FS, Bastos Mazuelos M, et al. The potential of canine sentinels for reemerging Trypanosoma cruzi transmission. Prev Vet Med. 2015;120(3-4):349-56.. In the State of Piauí, Brazil, the seropositivity obtained by ELISA and IIF was 7.7%, with the species T. brasiliensis reported as the main vector4646. Perez TD, Figueiredo FB, Velho Jr AA, Silva VL, Madeira MF, Brazil RP, et al. Prevalence of American trypanosomiasis and leishmaniases in domestic dogs in a rural area of the municipality of São João do Piauí, Piauí State, Brazil. Rev Inst Med Trop São Paulo . 2016;58(1):79., as in the present study. The difference in seropositivity between the studies may be associated with the abundance of certain vector species in each region, based on ideal climatic, environmental, and geographic conditions for the survival and reproduction of each species4747. Barbabosa-Pliego A, Gil PC, Hernández DO, Aparicio-Burgos JE, de Oca-Jiménez RM, Martínez-Castañeda JS, et al. Prevalence of Trypanosoma cruzi in dogs (Canis familiaris) and triatomines during 2008 in a sanitary region of the State of Mexico, Mexico. Vector Borne Zoonotic Dis . 2011;11(2):151-6.. Thus, the triatomine species, the T. cruzi prevalence, and the behavior of the dogs are factors that may influence the risk of infection in dogs4848. Jiménez-Coello M, Guzmán-Marin ES, Ortega-Pacheco A, Acosta-Viana KY. Serological survey of American Trypanosomiasis in dogs and their owners from an urban area of Mérida Yucatán, México. Transbound Emerg Dis. 2010;57(1-2):33-6..

In regards to seropositivity in dogs, the health status of the dogs, due to poor nutrition and immunosuppression, may be directly reflected in the antibody levels3939. Enriquez GF, Bua J, Orozco MM, Wirth S, Schijman G, Gürtler RE, et al. High levels of Trypanosoma cruzi DNA determined by qPCR and infectiousness to Triatoma infestans support dogs and cats are major sources of parasites for domestic transmission. Infect Genet Evol. 2014;25(1):36-43.,4040. Balan LU, Yerbes IM, Piña MAN, Balmes J, Pascual A, Hernández O, et al. Higher seroprevalence of Trypanosoma cruzi infection in dogs than in humans in an urban area of Campeche, Mexico. Vector Borne Zoonotic Dis. 2011;11(7):843-4.. Therefore, the differences between regions need to be considered when evaluating the transmission cycle of T. cruzi in home areas, since socioeconomic indexes and infection risks are directly related4949. Fung HL, Calzada J, Saldaña A, Santamaria AM, Pineda V, Gonzalez K, et al. Domestic dog health worsens with socio-economic deprivation of their home communities. Acta Trop . 2014;135(1):67-74..

No relation between the presence of seropositive dogs and that of infected triatomine vectors was observed in this study (Table 2). These factors cannot be discarded, however, since the domiciliation of triatomines and the circulation of T. cruzi between humans and domestic and wild animals are crucial to the establishment of infection. The availability of domestic hosts in households may directly affect the vector’s choice of food source, reducing human-vector contact rates and transmission of the parasite5050. Gürtler RE, Cardinal MV. Reservoir host competence and the role of domestic and commensal hosts in the transmission of Trypanosoma cruzi. Acta trop. 2015;15(1):32-50..

The mapping of vectors (Figure 1) allows the spatial observation of areas with T. cruzi infection and helps the local health services in the control and surveillance of these areas1414. Rengifo-Correa L, Stephens CR, Morrone JJ, Téllez-Rendón JL, González-Salazar C. Understanding transmissibility patterns of Chagas disease through complex vector-host networks. Parasitology. 2017;144(6):760-72.. Geoprocessing techniques have been widely used to understand epidemiological aspects of CD vectors, including characterization of the areas where the disease is present5151. Costa J, Dornak LL, Almeida CE, Peterson AT. Distributional potential of the Triatoma brasiliensis species complex at present and under scenarios of future climate conditions. Parasit Vectors . 2014;7(1):238.

52. Garza M, Arroyo TPF, Casillas EA, Sanchez-Cordero V, Rivaldi CL, Sarkar S. Projected future distributions of vectors of Trypanosoma cruzi in North America under climate change scenarios. PLoS Negl Trop Dis . 2014;8(5):e2818.
-5353. Medone P, Ceccarelli S, Parham PE, Figuera A, Rabinovich JE. The impact of climate change on the geographical distribution of two vectors of Chagas disease: Implications for the force of infection. Philos Trans R Soc Lond B Biol Sci. 2015;370(1665):pii: 20130560. and the relation between its distribution and reservoirs2929. Hernández C, Salazar C, Brochero H, Teherán A, Buitrago LS, Vera M, et al. Untangling the transmission dynamics of primary and secondary vectors of Trypanosoma cruzi in Colombia: parasite infection, feeding sources and discrete typing units. Parasit Vectors . 2016;9(1):2-12.,3434. Mendes-Pereira J, Almeida PS, Sousa AV, Moraes de Paula A, Machado RB, Gurgel-Gonçalves R. Climatic factors influencing triatomine occurrence in Central-West Brazil. Mem Inst Oswaldo Cruz . 2013;108(3):335-41.. This reinforces the importance of the data observed in this study.

The spatial arrangement of triatomines reaffirms the presence of CD vectors in the environment in some rural areas and confirms the presence of natural infection by T. cruzi in these insects, along with diagnosing seropositive dogs. Although no association between seropositive dogs and the presence and infection of triatomine vectors was found, a domestic cycle of the disease is still possible. These results emphasize the importance of epidemiologic monitoring and surveillance of CD, since the health of domestic animals, especially dogs, and their close relationship with humans reflect the health and the level of exposure of local residents to the vector.

Acknowledgments

The authors gratefully acknowledge the Department of Health Surveillance and Zoonoses Control Center Mossoró/RN, Allany Medeiros Fernandes, and Edinaidy Moura Rocha. We acknowledge the Federal University of Semi-Árido for the logistical support. We thank the Laboratory of Protozoology and Immunomodulation of the Oswaldo Cruz Foundation for the collaborative work. We also acknowledge the Higher Education Personnel Improvement Coordination for the support of this research.

REFERENCES

  • 1
    Chagas C. Tripanosomíase americana: forma aguda da moléstia. Mem Inst Oswaldo Cruz. 1916;8(2):37-60.
  • 2
    Souza AI, Paulino-Junior D, Sousa MG, Camacho AA. Aspectos clínico-laboratoriais da infecção natural por Trypanosoma cruzi em cães de Mato Grosso do Sul. Cienc Rural. 2008;38(5):1351-56.
  • 3
    Dos Reis D, Monteiro WM, Bossolani GDP, Teston APM, Gomes ML, de Araújo SM, et al. Biological behaviour in mice of Trypanosoma cruzi isolates from Amazonas and Parana, Brazil. Exp parasitol. 2012;130(4):321-9.
  • 4
    Argolo AM, Felix M, Pacheco R, Costa J. Doença de Chagas e seus principais vetores no Brasil. 1ª edição. Rio de Janeiro: Imperial Novo Milênio; 2008. 67p.
  • 5
    Bustamante DM, De Urioste-Stone SM, Juárez JG, Pennington PMM. Ecological, social e biological risk factors for continued Trypanosoma cruzi transmission by Triatoma dimidiata in Guatemala. PLoS One. 2014;9(8):e104599.
  • 6
    Curtis-Robles R, Lewis BC, Hamer SA. High Trypanosoma cruzi infection prevalence associated with minimal cardiac pathology among wild carnivores in central Texas. Int J Parasitol Parasites Wildl. 2016;5(2):117-23.
  • 7
    Tome RO, Gaio FC, Generoso D, Menozzi BD, Langoni H. Active surveillance of canine visceral leishmaniasis and american trypanossomiasis in rural dogs from non-endemic area. Rev Bras Parasitol Vet. 2011;20(1):64-6.
  • 8
    Gürtler RE, Cecere MC, Vázquez-Prokopec GM, Ceballos LA, Gurevitz JM, Del Pilar Fernández M, et al. Domestic animal hosts strongly influence human-feeding rates of the Chagas disease vector Triatoma infestans in Argentina. PLoS Negl Trop Dis. 2014;8(5):e2894.
  • 9
    Mott KE, Mota EA, Sherlock I, Hoff R, Muniz TM, Oliveira TS, et al. Trypanosoma cruzi infection in dogs and cats and household seroactivity to T. cruzi in a rural community in northeast Brazil. Am J Trop Med Hyg. 1978;27(6):1123-7.
  • 10
    Garcia MN, O’Day S, Fisher-Hoch S, Gorchakov R, Patino R, Arroyo TP, et al. Uma interação entre saúde de vetores da doença de Chagas, hospedeiros de canídeos e residentes humanos ao longo da fronteira Texas-México. PLoS Negl Trop Dis . 2016;10(11):e0005074.
  • 11
    Gürtler RE, Cardinal MV. Reservoir host competence and the role of domestic and commensal hosts in the transmission of Trypanosoma cruzi Acta Trop. 2015;151(1):32-50.
  • 12
    Umezawa ES, Souza AI, Pinedo-Cancino V, Marcondes M, Marcili A, Camargo LMA, et al. TESA-blot for the diagnosis of Chagas disease in dogs from co-endemic regions for Trypanosoma cruzi, Trypanosoma evansi and Leishmania chagasi Acta Trop . 2009;111(1):15-20.
  • 13
    Herrera CP, Licon MH, Nation CS, Jameson SB, Wesson DM. Genotype diversity of Trypanosoma cruzi in small rodents and Triatoma sanguisuga from a rural area in New Orleans, Louisiana. Parasit Vectors. 2015;8:123. doi: 10.1186/s13071-015-0730-8.
    » https://doi.org/10.1186/s13071-015-0730-8.
  • 14
    Rengifo-Correa L, Stephens CR, Morrone JJ, Téllez-Rendón JL, González-Salazar C. Understanding transmissibility patterns of Chagas disease through complex vector-host networks. Parasitology. 2017;144(6):760-72.
  • 15
    Lent H, Wygodzinski PW. Revision of the Triatominae (Hemiptera, Reduviidae) and their significance as vectors of Chagas’ disease. Bull Am Mus Nat Hist. 1979;163(3):123-520.
  • 16
    Sambrook J, Russel DW. Purification of PCR products in preparation for cloning. CSH Protoc. 2006;2006(1):pii:pdb.prot3825. doi: 10.1101/pdb.prot3825.
    » https://doi.org/10.1101/pdb.prot3825.
  • 17
    Rendell VR, Gilman RH, Valencia E, Galdos-Cardenas G, Verastegui M, Sanchez L, et al. Trypanosoma cruzi-infected pregnant women without vector exposure have higher parasitemia levels: implications for congenital transmission risk. PLoS One . 2015;10(3):e0119527.
  • 18
    Camargo ME. Fluorescent antibody test for serodiagnosis of American trypanosomiasis. Technical modification employing preserved forms of Trypanosoma cruzi in a slide test. Rev Inst Med Trop São Paulo. 1966;8(5):227-34.
  • 19
    Zicker F, Smith PG, Luquetti AO, Oliveira OS. Mass screening for Trypanosoma cruzi infections using the immunofluorescence, ELISA and haemagglutination tests on serum samples and on blood eluates from filter-paper. Bull World Health Organ. 1990;68(4):465-71.
  • 20
    Enriquez GF, Cardinal MV, Orozco MM, Lanati L, Schijman AG, Gurtler RE. Discrete typing units of Trypanosoma cruzi identified in rural dogs and cats in the humid Argentinean Chaco. Parasitol. 2013;140(3):303-8.
  • 21
    Lauricella MA, Castañera MB, Gürtler RE, Segura EL. Immunodiagnosis of Trypanosoma cruzi (Chagas' disease) infection in naturally infected dogs. Mem Inst Oswaldo Cruz . 1998;93(4);501-7.
  • 22
    Ventura-Garcia L, Roura M, Pell C, Posada E, Gascón J, Aldasoro E, et al. Socio-cultural aspects of Chagas disease: a systematic review of qualitative research. PLoS Negl Trop Dis . 2013;7(9):e-2410.
  • 23
    Grijalva MJ, Terán D, Dangles O. Dynamics of sylvatic Chagas disease vectors in coastal Ecuador is driven by changes in land cover. PLoS Negl Trop Dis . 2014;8(6):e-2960.
  • 24
    Urioste-Stone SM, Pennington PM, Pellecer E, Aguilar TM, Samayoa G, Perdomo HD, et al. Development of a community-based intervention for the control of Chagas disease based on peridomestic animal management: an eco-bio-social perspective. Trans R Soc Trop Med Hyg. 2015;109(2):159-67.
  • 25
    Villela MM, Pimenta DN, Lamounier PA, Dias JCP. Avaliação de conhecimentos e práticas que adultos e crianças têm acerca da doença de Chagas e seus vetores em região endêmica de Minas Gerais, Brasil. Cad Saude Publica. 2009;25(8):1701-10.
  • 26
    Gurgel-Gonçalves R, Pereira FDCA, Lima IP, Cavalcante RR. Distribuição geográfica, infestação domiciliar e infecção natural de triatomíneos (Hemiptera: Reduviidae) no Estado do Piauí, Brasil, 2008. Rev Pan-Amaz Saude. 2010;1(4):57-64.
  • 27
    Gurgel-Gonçalves R, Galvão C, Costa J, Peterson AT. Geographic distribution of Chagas disease vectors in Brazil based on ecological niche modeling. J Trop Med. 2012;2012(1):1-15. doi: 10.1155/2012/705326.
    » https://doi.org/10.1155/2012/705326.
  • 28
    Silva MBA, Barreto AVMS, Silva HAD, Galvão C, Rocha D, Jurberg J, et al. Synanthropic triatomines (Hemiptera, Reduviidae) in the state of Pernambuco, Brazil: Geographical distribution and natural Trypanosoma infection rates between 2006 and 2007. Rev Soc Bras Med Trop. 2012;45(1):60-5.
  • 29
    Hernández C, Salazar C, Brochero H, Teherán A, Buitrago LS, Vera M, et al. Untangling the transmission dynamics of primary and secondary vectors of Trypanosoma cruzi in Colombia: parasite infection, feeding sources and discrete typing units. Parasit Vectors . 2016;9(1):2-12.
  • 30
    Coutinho CFS, Souza-Santos R, Teixeira NFD, Georg I, Gomes TF, Boia MN, et al. An entomoepidemiological investigation of Chagas disease in the state of Ceará, Northeast Region of Brazil. Cad Saude Publica . 2014;30(4):785-93.
  • 31
    Valença-Barbosa C, Lima MM, Sarquis O, Bezerra CM, Abad-Franch F. Modeling disease vector occurrence when detection is imperfect II: Drivers of site-occupancy by synanthropic Triatoma brasiliensis in the Brazilian Northeast. PLoS Negl Trop Dis . 2014;8(5):e2861.
  • 32
    Waleckx E, Gourbière S, Dumonteil E. Intrusive versus domiciliated triatomines and the challenge of adapting vector control practices against Chagas disease. Mem Inst Oswaldo Cruz . 2015;110(3):324-38.
  • 33
    Waleckx E, Camara-Mejia J, Ramirez-Sierra MJ, Cruz-Chan V, Rosado-Vallado M, Vazquez-Narvaez S, et al. An innovative ecohealth intervention for Chagas disease vector control in Yucatan, Mexico. Trans R Soc Trop Med Hyg . 2015;109(2):143-9.
  • 34
    Mendes-Pereira J, Almeida PS, Sousa AV, Moraes de Paula A, Machado RB, Gurgel-Gonçalves R. Climatic factors influencing triatomine occurrence in Central-West Brazil. Mem Inst Oswaldo Cruz . 2013;108(3):335-41.
  • 35
    Vinhaes MC, de Oliveira SV, Reis PO, de Lacerda Sousa AC, Silva RA, Obara MT, et al. Assessing the vulnerability of Brazilian municipalities to the vectorial transmission of Trypanosoma cruzi using multi-criteria decision analysis. Acta Trop . 2014;137(1):105-10.
  • 36
    Bezerra RC, Amato Neto V. Trypanosoma cruzi, hemocultura: uma abordagem prática. Rev Bras Clin Med. 2010;8(3):205-7.
  • 37
    Castro AM, Luquetti AO, Rassi A, Rassi GG, Chiari E, Galvão LM. Blood culture and polymerase chain reaction for the diagnosis of the chronic phase of human infection with Trypanosoma cruzi Parasitol Res. 2002;88(10):894-900.
  • 38
    Peterson JK, Bartsch SM, Lee BY, Dobson AP. Broad patterns in domestic vector-borne Trypanosoma cruzi transmission dynamics: synanthropic animals and vector control. Parasit Vectors . 2015;8(1):537.
  • 39
    Enriquez GF, Bua J, Orozco MM, Wirth S, Schijman G, Gürtler RE, et al. High levels of Trypanosoma cruzi DNA determined by qPCR and infectiousness to Triatoma infestans support dogs and cats are major sources of parasites for domestic transmission. Infect Genet Evol. 2014;25(1):36-43.
  • 40
    Balan LU, Yerbes IM, Piña MAN, Balmes J, Pascual A, Hernández O, et al. Higher seroprevalence of Trypanosoma cruzi infection in dogs than in humans in an urban area of Campeche, Mexico. Vector Borne Zoonotic Dis. 2011;11(7):843-4.
  • 41
    Gürtler R, Cecere M, Lauricella M, Cardinal M, Kitron U, Cohen J. Domestic dogs and cats as sources of Trypanosoma cruzi infection in rural northwestern Argentina. Parasitology . 2007;134(1):69-82.
  • 42
    Sessa PA, Pimentel RR, Ferreira AL, Falqueto A. Soroprevalência da doença de Chagas em crianças em idade escolar do estado do Espírito Santo, Brasil, em 1999-2000, 2002. Cad Saude Publica . 2002;18(6):1765-9.
  • 43
    Matos HJ, Pinto AYN, Miranda AMM, Silva FLC, Ramos FLP. Reação cruzada nos testes sorológicos entre doença de Chagas e leishmaniose visceral em regiões endêmicas para ambas as doenças. Rev Pan-Amaz Saude . 2015;6(1):65-68.
  • 44
    Bezerra CM, Cavalcanti LP, Souza RD, Barbosa SE, Xavier SC, Jansen AM, et al. Domestic, peridomestic and wild hosts in the transmission of Trypanosoma cruzi in the Caatinga area colonised by Triatoma brasiliensis Mem Inst Oswaldo Cruz . 2014;109(7):887-98.
  • 45
    Castillo-Neyra R, Chou Chu LC, Quispe-Machaca V, Ancca-Juarez J,Malaga Chavez FS, Bastos Mazuelos M, et al. The potential of canine sentinels for reemerging Trypanosoma cruzi transmission. Prev Vet Med. 2015;120(3-4):349-56.
  • 46
    Perez TD, Figueiredo FB, Velho Jr AA, Silva VL, Madeira MF, Brazil RP, et al. Prevalence of American trypanosomiasis and leishmaniases in domestic dogs in a rural area of the municipality of São João do Piauí, Piauí State, Brazil. Rev Inst Med Trop São Paulo . 2016;58(1):79.
  • 47
    Barbabosa-Pliego A, Gil PC, Hernández DO, Aparicio-Burgos JE, de Oca-Jiménez RM, Martínez-Castañeda JS, et al. Prevalence of Trypanosoma cruzi in dogs (Canis familiaris) and triatomines during 2008 in a sanitary region of the State of Mexico, Mexico. Vector Borne Zoonotic Dis . 2011;11(2):151-6.
  • 48
    Jiménez-Coello M, Guzmán-Marin ES, Ortega-Pacheco A, Acosta-Viana KY. Serological survey of American Trypanosomiasis in dogs and their owners from an urban area of Mérida Yucatán, México. Transbound Emerg Dis. 2010;57(1-2):33-6.
  • 49
    Fung HL, Calzada J, Saldaña A, Santamaria AM, Pineda V, Gonzalez K, et al. Domestic dog health worsens with socio-economic deprivation of their home communities. Acta Trop . 2014;135(1):67-74.
  • 50
    Gürtler RE, Cardinal MV. Reservoir host competence and the role of domestic and commensal hosts in the transmission of Trypanosoma cruzi Acta trop. 2015;15(1):32-50.
  • 51
    Costa J, Dornak LL, Almeida CE, Peterson AT. Distributional potential of the Triatoma brasiliensis species complex at present and under scenarios of future climate conditions. Parasit Vectors . 2014;7(1):238.
  • 52
    Garza M, Arroyo TPF, Casillas EA, Sanchez-Cordero V, Rivaldi CL, Sarkar S. Projected future distributions of vectors of Trypanosoma cruzi in North America under climate change scenarios. PLoS Negl Trop Dis . 2014;8(5):e2818.
  • 53
    Medone P, Ceccarelli S, Parham PE, Figuera A, Rabinovich JE. The impact of climate change on the geographical distribution of two vectors of Chagas disease: Implications for the force of infection. Philos Trans R Soc Lond B Biol Sci. 2015;370(1665):pii: 20130560.
  • Financial support: This work was supported by the Higher Education Personnel Improvement Coordination.

Publication Dates

  • Publication in this collection
    Mar-Apr 2018

History

  • Received
    20 July 2017
  • Accepted
    18 Apr 2018
Sociedade Brasileira de Medicina Tropical - SBMT Caixa Postal 118, 38001-970 Uberaba MG Brazil, Tel.: +55 34 3318-5255 / +55 34 3318-5636/ +55 34 3318-5287, http://rsbmt.org.br/ - Uberaba - MG - Brazil
E-mail: rsbmt@uftm.edu.br