Identificação de espécies de Leishmania isoladas de casos humanos em Mato Grosso do Sul por meio da reação em cadeia da polimerase

Identification of Leishmania species isolated in human cases in Mato Grosso do Sul, by means of the polymerase chain reaction

Manoel Sebastião da Costa Lima Junior Renato Andreotti Maria Elizabeth Moraes Cavalheiros Dorval Elisa Teruya Oshiro Alessandra Gutierrez de Oliveira Maria de Fatima Cepa Matos Sobre os autores

Resumos

As leishmanioses são zoonoses endêmicas em Mato Grosso do Sul e têm por agentes etiológicos nessa região Leishmania (Leishmania) chagasi, Leishmania (Leishmania) amazonensis e Leishmania (Viannia) braziliensis. Como método para identificação de espécies de Leishmania, a reação em cadeia da polimerase é uma ferramenta com elevada especificidade e sensibilidade. Analisaram-se 39 isolados de Leishmania criopreservados, obtidos por meio de aspirado medular e/ou biópsia de lesão, conforme a suspeita clínica. Os isolados foram submetidos à extração de DNA e à reação em cadeia da polimerase com os iniciadores: RV1/RV2 para Leishmania (Leishmania) chagasi, a1/a2 para a identificação de Leishmania (Leishmania) amazonensis e b1/b2 para Leishmania (Viannia) braziliensis. Leishmania (Leishmania) chagasi foi a única espécie identificada em 37 casos de leishmaniose visceral. Leishmania (Leishmania) amazonensis foi identificada em dois isolados de pacientes com diagnóstico de leishmaniose tegumentar. Os resultados obtidos confirmam a possibilidade do uso dos três pares de iniciadores como uma ferramenta na caracterização de isolados de Leishmania.

Leishmania; Leishmaniose visceral; Leishmaniose tegumentar; Reação em cadeia da polimerase; Mato Grosso do Sul


Leishmaniases are endemic zoonoses in the State of Mato Grosso do Sul. Their etiological agents in this region of Brazil are Leishmania (Leishmania) chagasi, Leishmania (Leishmania) amazonensis and Leishmania (Viannia) braziliensis. The polymerase chain reaction (PCR) is a tool with high specificity and sensitivity for identifying Leishmania species. This study examined 39 cryopreserved isolates of Leishmania that had been collected by bone marrow aspiration and/or lesion biopsy, depending on the clinical suspicion. The isolates were subjected to DNA extraction and PCR using the following primers: RV1/RV2 for identifying Leishmania (Leishmania) chagasi, a1/a2 for Leishmania (Leishmania) amazonensis and b1/b2 for Leishmania (Viannia) braziliensis.Leishmania (Leishmania) chagasi was the only species identified in the 37 cases of visceral leishmaniasis.Leishmania (Leishmania) amazonensis was identified in two isolates from patients with a diagnosis of cutaneous leishmaniasis. The results obtained confirm that it is possible to use these three pairs of primers as a tool for characterizing Leishmania isolates.

Leishmania; Visceral leishmaniasis; Cutaneous leishmaniasis; Polymerase chain reaction; Mato Grosso do Sul


ARTIGO ARTICLE

Identificação de espécies de Leishmania isoladas de casos humanos em Mato Grosso do Sul por meio da reação em cadeia da polimerase

Identification of Leishmania species isolated in human cases in Mato Grosso do Sul, by means of the polymerase chain reaction

Manoel Sebastião da Costa Lima JuniorI; Renato AndreottiII; Maria Elizabeth Moraes Cavalheiros DorvalIII; Elisa Teruya OshiroIII; Alessandra Gutierrez de OliveiraIII; Maria de Fatima Cepa MatosIV

IPrograma de Pós-Graduação em Doenças Infecciosas e Parasitárias, Faculdade de Medicina, Universidade Federal do Mato Grosso do Sul, Campo Grande, MS

IIEmbrapa Gado de Corte, Programa de Pós-Graduação em Doenças Infecciosas e Parasitárias da Universidade Federal de Mato Grosso do Sul, Campo Grande, MS

IIIDepartamento de Patologia, Centro de Ciências Biológicas e da Saúde da Universidade Federal de Mato Grosso do Sul, Campo Grande, MS

IVDepartamento de Famácia-Bioquímica, Centro de Ciências Biológicas e da Saúde da Universidade Federal de Mato Grosso do Sul, Campo Grande, MS

Endereço para correspondência

RESUMO

As leishmanioses são zoonoses endêmicas em Mato Grosso do Sul e têm por agentes etiológicos nessa região Leishmania (Leishmania) chagasi, Leishmania (Leishmania) amazonensis e Leishmania (Viannia) braziliensis. Como método para identificação de espécies de Leishmania, a reação em cadeia da polimerase é uma ferramenta com elevada especificidade e sensibilidade. Analisaram-se 39 isolados de Leishmania criopreservados, obtidos por meio de aspirado medular e/ou biópsia de lesão, conforme a suspeita clínica. Os isolados foram submetidos à extração de DNA e à reação em cadeia da polimerase com os iniciadores: RV1/RV2 para Leishmania (Leishmania) chagasi, a1/a2 para a identificação de Leishmania (Leishmania) amazonensis e b1/b2 para Leishmania (Viannia) braziliensis. Leishmania (Leishmania) chagasi foi a única espécie identificada em 37 casos de leishmaniose visceral. Leishmania (Leishmania) amazonensis foi identificada em dois isolados de pacientes com diagnóstico de leishmaniose tegumentar. Os resultados obtidos confirmam a possibilidade do uso dos três pares de iniciadores como uma ferramenta na caracterização de isolados de Leishmania.

Palavras-chaves:Leishmania. Leishmaniose visceral. Leishmaniose tegumentar. Reação em cadeia da polimerase. Mato Grosso do Sul.

ABSTRACT

Leishmaniases are endemic zoonoses in the State of Mato Grosso do Sul. Their etiological agents in this region of Brazil are Leishmania (Leishmania) chagasi, Leishmania (Leishmania) amazonensis and Leishmania (Viannia) braziliensis. The polymerase chain reaction (PCR) is a tool with high specificity and sensitivity for identifying Leishmania species. This study examined 39 cryopreserved isolates of Leishmania that had been collected by bone marrow aspiration and/or lesion biopsy, depending on the clinical suspicion. The isolates were subjected to DNA extraction and PCR using the following primers: RV1/RV2 for identifying Leishmania (Leishmania) chagasi, a1/a2 for Leishmania (Leishmania) amazonensis and b1/b2 for Leishmania (Viannia) braziliensis.Leishmania (Leishmania) chagasi was the only species identified in the 37 cases of visceral leishmaniasis.Leishmania (Leishmania) amazonensis was identified in two isolates from patients with a diagnosis of cutaneous leishmaniasis. The results obtained confirm that it is possible to use these three pairs of primers as a tool for characterizing Leishmania isolates.

Key-words:Leishmania. Visceral leishmaniasis. Cutaneous leishmaniasis. Polymerase chain reaction. Mato Grosso do Sul.

As leishmanioses são zoonoses que se apresentam sob diferentes formas clínicas, a leishmaniose tegumentar cutânea, mucocutânea e cutânea difusa, e a leishmaniose visceral27 28.

A identificação das espécies de Leishmania que circulam em determinado foco de transmissão, particularmente em regiões onde as diferentes formas clínicas ocorrem simultaneamente, é muito importante para o conhecimento da epidemiologia das leishmanioses e planejamento de estratégias de controle2.

Tratando-se de leishmaniose visceral nas Américas, a única espécie considerada responsável pela doença é Leishmania (Leishmania) chagasi, embora já se tenha descrito Leishmania (Leishmania) amazonensis5 e Leishmania (Viannia) braziliensis48 como agentes de leishmaniose visceral, destacando-se, portanto, a importância da identificação do agente causal por métodos específicos e não por correlação sintomatológica à espécie usualmente conhecida.

A reação em cadeia da polimerase (PCR) é uma técnica altamente sensível e específica, e pode detectar o DNA ou RNA do parasita49 52, em diagnóstico humano47, canino20 44 e em flebotomíneos24 35 36, sendo também útil na caracterização de isolados humanos37.

O DNA de cinetoplasto (kDNA) de Leishmania tem sido utilizado como uma ferramenta de diagnóstico pela PCR, devido a capacidade de detectar pequenas quantidades de DNA do parasito em materiais biológicos, o que se deve à abundância de minicírculos2 4 7 12.

O alto grau de polimorfismo do kDNA juntamente com regiões conservadas10 12 14 17 favorecem a sua utilização para fins taxonômicos e genéticos2. Por essa razão, os iniciadores utilizados neste trabalho possuem como alvo sequências do minicírculo, possibilitando a distinção entre Leishmania (Leishmania) amazonensis e Leishmania (Viannia) braziliensis8 26.

Os iniciadores RV1 e RV2 têm sido utilizados com sucesso na identificação de Leishmania (Leishmania) chagasi em sangue e urina de humanos15 29 47, cães15 18 20, e em flebotomíneos de Mato Grosso do Sul46, enquanto a1/a2 e b1/b2 são os iniciadores que permitem, respectivamente, a identificação de Leishmania (Leishmania) amazonensis e Leishmania (Viannia) braziliensis em amostras provenientes de biópsia de lesão em humanos23 26 37.

A utilização destes iniciadores na identificação de espécies de Leishmania em isolados humanos criopreservados, por meio da reação em cadeia da polimerase constitui o objetivo deste trabalho.

MATERIAL E MÉTODOS

Isolados. Trata-se de um estudo com 39 isolados de Leishmania sp criopreservados no Laboratório de Parasitologia do Departamento de Patologia do Centro de Ciências Biológicas e da Saúde da Universidade Federal de Mato Grosso do Sul (UFMS), coletados no período de janeiro de 2007 a janeiro de 2008, à exceção de uma amostra do ano de 2003. Amostras de sangue medular ou de tecido da borda da lesão foram coletadas de pacientes com leishmaniose visceral e tegumentar, provenientes de diferentes instituições de saúde de Mato Grosso do Sul, e encaminhadas ao Laboratório de Parasitologia para diagnóstico, caracterizando-as como amostras de conveniência. Este trabalho foi aprovado pelo Comitê de Ética para Pesquisa em Seres Humanos (CEP) da Universidade Federal de Mato Grosso do Sul.

Cultura. As amostras foram cultivadas em meio Nicolle, Novy e McNeal (NNN) com fase líquida Schneider´s medium, pH 7.2 e 20% soro fetal bovino. Após o isolamento e crescimento, para a obtenção de massa parasitária, a mesma foi armazenada com glicerol em nitrogênio líquido.

Extração de DNA. As extrações de DNA a partir das formas promastigotas em cultura foram realizadas pelo método de fenol-clorofórmio1.

Reação em cadeia da polimerase. A reação foi padronizada com os DNAs controle fornecidos pelo Laboratório de Leishmanioses do Centro de Pesquisas René Rachou/Fiocruz (Belo Horizonte, Brasil): Leishmania (Leishmania) chagasi (MHOM/BR/74/PP/75), Leishmania (Viannia) braziliensis (MHOM/BR/75/M2903) e Leishmania (Leishmania) amazonensis (IPLA/ BR/67/PH8), levando-se em consideração o tamanho do produto esperado e as temperaturas de anelamento dos primers.

Para Leishmania (Leishmania) chagasi foram utilizados os iniciadores RV1- CTTTTCTGGTCCCGCGGGTAGG e RV2- CACCTGGCCTATTTTACACCA com produto esperado de 145pb20, para Leishmania (Leishmania) amazonensis os iniciadores a1- TGCGAGGATAAAGGGAAAGAA e a2- TGCCCTGACTTGCATGTCTA com produto esperado de 62pb26, e para Leishmania (Viannia) braziliensis, os iniciadores b1- GTGGGCGTATCTGCTGATGAC e b2 - CAAAAAGCGAGGGACTGCGGA com produto esperado de 103pb26.

Condições das PCR: a) RV1/RV2 com volume de 25µL: tampão 2X Phoneutria, dNTPs 0,2mM, MgCl2 0,3mM, iniciadores 0,16pmol, Taq polimerase Phoneutria 4U, DNA 0,5µL, água 19,4µL e termociclador BIOER modelo XP cycler. Os ciclos foram de 950C - 5min, 40 ciclos de: 940C - 30 seg, 700C- 1 min, 720C - 1 min e extensão final de 720C - 10 min. b) a1/a2 com volume de 25µL: tampão 2X Phoneutria (Belo Horizonte, MG), dNTPs0, 2 mM, MgCl2 0,3mM, iniciadores a1/a2 0,4pmol, Taq polimerase 4U Phoneutria, DNA 0,5µL, água 18,8µL e termociclador BIOER modelo XP cycler. Os ciclos foram de 950C - 5min, 35 ciclos de: 950C - 30 seg, 550C - 1 min e 30 seg, 720C - 1 min/ 30 seg e extensão final de 720C - 10 min. c) b1/b2 com volume de 25µL: tampão 2X Phoneutria, dNTPs 0,2mM, MgCl2 - 0,3mM, iniciadores a1/a2 1 pmol, Taq polimerase 4U Phoneutria, DNA 0,5µL, água 17,3µL e termociclador BIOER modelo XP cycler. Os ciclos foram de 950C - 5 min, 35 ciclos de: 950C - 30 seg, 700C - 1 min e 30 seg, 720C - 1 min/30 seg e extensão final de 720C - 10 min.

Eletroforese em gel de agarose. Realizou-se a eletroforese submarina horizontal em gel de agarose a 2% com tampão tris-EDTA-acetato (TAE) 1X pH 8,0 a 80v e 400mA (tris-acetato 0,04M, EDTA 0,001M42). Os géis foram corados com brometo de etídeo (0,5µg/mL) e visualizados em luz ultravioleta. Para a análise dos produtos da PCR a1/a2, o gel foi de 3% em tampão TBE (tris base, ácido bórico e EDTA).

RESULTADOS

Os resultados da amplificação dos DNAs das cepas referência para as três espécies de Leishmania com os iniciadores RV1/RV2, a1/a2 e b1/b2 estão apresentados nas Figuras 1, 2 e 3, respectivamente, junto a alguns isolados do presente estudo.




Foram avaliados pela PCR 39 isolados humanos, sendo que 37 foram positivos para Leishmania (Leishmania) chagasi e dois para Leishmania Leishmania) amazonensis (Tabela 1). Não se identificou Leishmania (Viannia) braziliensis nas amostras analisadas.

DISCUSSÃO

A leishmaniose visceral em Mato Grosso do Sul encontra-se em franco processo de expansão, ocorrendo em 48 de seus 78 municípios, com crescente aumento no número de casos, e a confirmação de 1.519 casos, durante o período de 2000 a setembro de 2008. Destes, 258 ocorreram no ano de 2007, mantendo-se a morbidade como importante motivo de preocupação para a saúde pública45.

A leishmaniose tegumentar é endêmica no estado, com registro de casos desde 1975, atingindo o homem quando este entra em contato com o foco natural da parasitose, demonstrando, até o momento, um padrão de transmissão de caráter ocupacional13 30.

Embora a presença de Leishmania (Leishmania) chagasi, Leishmania (Leishmania) amazonensis e Leishmania (Viannia) braziliensis já tenha sido constatada na população humana13 31 33, canina9 43 e em flebotomíneos32 43 46 do estado ainda são escassos os estudos sobre a identificação especifica dos agentes de leishmanioses em suas áreas de ocorrência.

No presente estudo, 37 isolados regionais eram de pacientes portadores de leishmaniose visceral e foram positivos para os iniciadores RV1/RV2 na reação em cadeia da polimerase, o que permitiu, mais uma vez, a identificação de Leishmania (Leishmania) chagasi como agente etiológico da parasitose, corroborando ainda, as citações da literatura quanto à utilização desses iniciadores na caracterização específica de Leishmania15 20.

Estes mesmos iniciadores também foram úteis para a detecção dessa espécie de parasito em flebotomíneos capturados na área urbana de Campo Grande46, município considerado de transmissão intensa, responsável por 55% dos casos confirmados no ano de 200745, e detentor do maior (29) número de amostras no presente trabalho.

Leishmania (Leishmania) amazonensis foi identificada em um paciente com a forma cutânea de leishmaniose tegumentar, com local de infecção em um município do interior do estado. Essa espécie já foi encontrada em outros casos humanos da parasitose13, além de já ter sido observada em felino50, cães43, e flebotomíneos43 46, demonstrando que sua circulação e distribuição geográfica, podem ser mais amplas do que se supõe, considerando que os casos são procedentes de diferentes regiões do Estado.

O outro caso trata-se de paciente procedente do Estado do Amazonas, com a forma cutânea da parasitose, que teve como local de diagnóstico Campo Grande. Essa espécie de parasita é frequentemente relatada na região da Amazônia legal, juntamente com Leishmania (Viannia) guyanensis21 41.

Assim, com os três pares de iniciadores, foi possível a identificação de duas espécies de Leishmania, tendo em vista a detecção de Leishmania (Leishmania) chagasi por meio de RV1/RV2, o encontro de dois isolados positivos para Leishmania (Leishmania) amazonensis quando da utilização de a1/a2, e a ausência de Leishmania (Viannia) braziliensis com b1/b2.

A ausência dessa espécie de parasito pode ter ocorrido pelo reduzido número de amostras analisadas, uma vez que, na maioria das vezes, o diagnóstico da leishmaniose tegumentar é realizado no município de origem do paciente, onde a infra-estrutura laboratorial não possibilita o isolamento do parasito para posterior identificação especifica do agente etiológico.

No caso da leishmaniose visceral, embora o número de amostras analisadas (37), possa parecer reduzido, vem contribuir no processo de diagnóstico da parasitose, tendo em vista que com sua recente introdução no estado, e as dificuldades ainda existentes no diagnóstico clínico e laboratorial, o Laboratório de Parasitologia, além de ser referência para a confirmação dos casos, vem realizando o isolamento e a criopreservação das amostras, possibilitando a ampliação dos estudos clínicos e epidemiológicos sobre essa parasitose no estado.

É importante ressaltar que outras técnicas, além da PCR, podem ser utilizadas para a identificação de espécies de Leishmania, tais como, eletroforese de enzimas16, considerada padrão ouro11, anticorpos monoclonais25 40, métodos moleculares como PCR multiplex19 38 39, PCR-RFLP (PCR-polimorfismo no comprimento de fragmentos de restrição)6 22 e RAPD (polimorfismo de DNA amplificado ao acaso)3 34.

Enquanto o método de eletroforese de enzimas requer o cultivo e isolamento do parasita, a técnica de anticorpos monoclonais é limitada pela possibilidade de reações cruzadas. Já os testes moleculares baseados na PCR e variantes, exigem laboratórios equipados, reagentes de alto custo como enzimas de restrição no caso de PCR-RFLP, e a RAPD apresenta pouca reprodutibilidade. Por outro lado, a PCR padrão apresenta elevada sensibilidade, especificidade e reprodutibilidade2 52.

A escolha, neste trabalho, de três alvos de amplificação em separado, ao contrário da PCR multiplex, foi conseqüência da experiência anterior com os iniciadores RV1/RV2 por meio da PCR padrão, cuja utilização possibilitou a identificação de Leishmania (Leishmania) chagasi, em flebotomíneos na região46. A padronização de um teste multiplex com os três pares de iniciadores testados poderá ser realizada em estudos posteriores.

Desta forma, a maior contribuição do trabalho é a descrição de Leishmania (Leishmania) chagasi, como o agente detectado nos casos de leishmaniose visceral, em Mato Grosso do Sul, além de possibilitar a implantação da PCR para no futuro permitir a identificação molecular das espécies que ocorrem em diferentes hospedeiros de Leishmania no estado, abrindo ainda a perspectiva de utilização desta técnica no diagnóstico individual das leishmanioses, possibilitando adequada conduta clínica e terapêutica dos pacientes.

AGRADECIMENTOS

À Fundect/MS pelo apoio financeiro e concessão de bolsa de pesquisa, à Embrapa Gado de Corte pelo apoio laboratorial, e ao Centro de Pesquisas René Rachou/Fiocruz (Belo Horizonte, Brasil), pela doação das cepas referência.

  • Endereço para correspondência:
    Dra. Maria de Fátima Cepa Matos
    Deptº de Farmácia-Bioquímica/CCBS/UFMS Caixa Postal 549
    79070-900 Campo Grande, MS
    Tel: 55 67 3345-7358
    e-mail:
  • Recebido para publicação em 17/12/2008

    Aceito em 03/04/2009

    Apoio financeiro: Fundect/MS.

    • 1
      Bañuls AL, Brisse S, Sidibe I, Noël S, Tibayrenc M. A phylogenetic analysis by multilocus enzyme electrophoresis and multiprimer random amplified polymorphic DNA fingerprinting of the Leishmania genome project Friedlin reference strain. Folia Parasitologica 46:10-14, 1999.
    • 2
      Bañuls A, Hide M, Prugnolle F. Leishmania and the Leishmaniases: A Parasite Genetic Update and Advances in Taxonomy, Epidemiology and Pathogenicity in Humans. Advances in Parasitology 64:1-109, 2007.
    • 3
      Baptista C, Schubach AO, Madeira MF, Leal CA, Pires MQ, Oliveira FS, Conceição-Silva F, Rosalino CM, Salgueiro MM, Pacheco RS. Leishmania (Viannia)braziliensis genotypes identified in lesions of patients with atypical or typical manifestations of tegumentary leishmaniasis: evaluation by two molecular markers. Experimental Parasitology 121:317-322, 2009.
    • 4
      Barker DC. Molecular approaches to DNA diagnosis. Parasitology 99:125-146, 1989.
    • 5
      Barral A, Pedral Sampaio D, Grimaldi Jr G, Momen H, McMahon-Pratt D, Jesus AR, Almeida R, Badaró R, Barral Neto M, Carvalho EM, Jonhson WD. Leishmaniasis in Bahia, Brazil; evidence that Leishmania amazonensis produces a wide spectrum of clinical disease. The American Journal of Tropical Medicine and Hygiene 44:536-546, 1991.
    • 6
      Botilde Y, Laurent T, Tintaya WQ, Chicharro C, Cañavate C, Cruz I, Kuhls K, Schönian G, Dujardin JC. Comparison of molecular markers for strain typing of Leishmania infantum infection. Genetics and Evolution 6:440-446, 2006.
    • 7
      Bracho CO, Quintana LP, Arenas SM, Parra MR. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis diagnosis: a validation study. Memórias do Instituto Oswaldo Cruz 102:549-554, 2007.
    • 8
      Brewster S, Barker DC. Analysis of minicircle classes in Leishmania (Viannia) species. Transactions of the Royal Society of Tropical Medicine and Hygiene 96: 55-63, 2002.
    • 9
      Cortada VM, Dorval ME, Souza Lima MA, Oshiro ET, Meneses CR, Abreu-Silva AL, Cupolilo E, Souza CS, Cardoso FO, Zaverucha do Valle T, Brazil RP, Calabrese KS, Gonçalves da Costa SC. Canine visceral leishmaniosis in Anastácio, Mato Grosso do Sul State Brazil. Veterinary Research 28:365-474, 2004.
    • 10
      Cortes S, Rolão N, Ramada J, Campino L. PCR as a rapid and sensitive tool in the diagnosis of human and canine leishmaniasis using Leishmania donovani specific kinetoplastid primers. Transactions of the Royal Society of Tropical Medicine and Hygiene 98:12-17, 2004.
    • 11
      Cupolillo E, Grimaldi Jr G, Momen H. A general classification of the New Word Leishmania using numerical zymotaxonomy. The American Journal of Tropical Medicine and Hygiene 50:296-311, 1994.
    • 12
      Degrave W, Fernandes O, Campebell D, Bozza M, Lopes U. Use of molecular probes and PCR for detection and typing of Leishmania a mini-review. Memórias do Instituto Oswaldo Cruz 89:463-469, 1994.
    • 13
      Dorval MEC, Oshiro ET, Cupolillo E, Castro ACC, Alves T. Ocorrência de leishmaniose tegumentar americana no Estado Mato Grosso do Sul associada à infecção por Leishmania (Leishmania) amazonensis Revista da Sociedade Brasileira de Medicina Tropical 39:43-46, 2006.
    • 14
      Fernandes O, Catanho MP, Segura I, Labrada LA, Derre R, Saraiva N, Degrave W. Minicircle variable region probes for characterization of Leishmania (Viannia) species. The Journal of Parasitology 85:563-568, 1999.
    • 15
      Ferroglio A, Romano A, Trisciuoglio AM, Poggib E, Ghiggic P, Sacchia A, Biglino D. Characterization of Leishmania infantum strains in blood samples from infected dogs and humans by PCR-RFLP. Transactions of the Royal Society of Tropical Medicine and Hygiene 100:636-641, 2006.
    • 16
      Figueira LP, Pinheiro FG, Nogueira RW, Nery LCR, Mota KC, Franco AMR. Dinâmica da Leishmaniose Tegumentar no assentamento Iporá-AM, BR: II - Caracterização isoenzimática de isolados humanos humanos de Leishmania spp. (Kinetoplastida: Trypanosomatidae). Revista da Sociedade Brasileira de Medicina Tropical 41:194, 2008.
    • 17
      Franco AM, Machado GM, Moreira CF, Grimaldi Jr G. Minicircle kDNA microheterogeneity in Endotrypanum indicate diversity within this genus. Memórias do Instituto Oswaldo Cruz 95:189-191, 2000.
    • 18
      Gomes AHS, Ferreira, IMR, Lima, MLSR, Cunha, EA, Garcia AS, Araújo MFL, Pereira-Chioccola VL. PCR identification of Leishmania in diagnosis and control of canine leishmaniasis. Veterinary Parasitology 144:234-241, 2007.
    • 19
      Harris E, Kropp G, Belli A, Rodriguez B, Agabian N. Single-Step Multiplex PCR Assay for Characterization of New World Leishmania Complexes. Journal of Clinical Microbiology 36:1989-1995, 1998.
    • 20
      Lachaud L, Marchergui-hammami S, Chabbert E, Dereure J, Dedet JP, Bastien P. Comparison of six PCR methods using peripheral blood for detection of canine visceral Leishmaniasis. Journal of Clinical Microbiology 40:210-215, 2002.
    • 21
      Lainson R, Shaw JJ, Silveira FT, Souza AAA, Braga RR, Ishikawa EAY. The dermal leishmaniasis of Brazil, with special reference to the ecoepidemiology of the disease in Amazônia. Memórias do Instituto Oswaldo Cruz 89:435-443, 1994.
    • 22
      Luz ZM, Silva AR, Silva FO, Caligiorne RB, Oliveira E, Rabello A. Lesion aspirate culture for the diagnosis and isolation of Leishmania spp. from patients with cutaneous leishmaniasis. Memórias do Instituto Oswaldo Cruz 104:62-66, 2009.
    • 23
      Marco JD, Uezato H, Mimori T, Barroso PA, Korenaga M, Nonaka S, Basombrío MA, Taranto NJ, Hashiguchi Y. Are cytochrome b gene sequencing and polymorphism-specific polymerase chain reaction as reliable as multilocus enzyme electrophoresis for identifying Leishmania spp. from Argentina? The American Society of Tropical Medicine and Hygiene 75:256-260, 2006.
    • 24
      Michalsky EM, Fortes-Dias CI, Pimenta PFP, Secundino NFC, Dias E. Assessment of PCR in the detection of Leishmania spp in experimentally infected individual phlebotomine sandflies (Diptera: Psychodidae: Phlebotominae). Revista da Sociedade Brasileira de Medicina Tropical 5:255-259, 2002.
    • 25
      Mimori T, Grimaldi Jr G, Kreutze RD, Gomez EA, Mcmahon-Pratt D, Tesh RB, Hashiguchi Y. Identification, using isoenzyme electrophoresis and monoclonal antibodies, of Leishmania isolated from humans and wild animals of Ecuador. The American Journal of Tropical Medicine and Hygiene 40:154-158, 1989.
    • 26
      Mimori T, Sasaki J, Nakata M, Gomez EA, Uezato H, Nonaka S, Hashiguchi Y, Furuya M, Saya H. Rapid identification of Leishmania species from formalin-fixed biopsy samples by polymorphism-specific polymerase chain reaction. Gene 210: 179-186, 1998.
    • 27
      Ministério da Saúde. Manual de vigilância e controle da leishmaniose visceral. Departamento de Vigilância Epidemiológica. Secretaria de Vigilância em Saúde, Ministério da Saúde. Brasília, 2006.
    • 28
      Ministério da Saúde. Manual de vigilância e controle da leishmaniose tegumentar. Departamento de Vigilância Epidemiológica. Secretaria de Vigilância em Saúde, Ministério da Saúde. Brasília, 2007.
    • 29
      Motazedian M, Fakhar M, Motazedian MH, Hatam G, Mikaeili F. A urine-based polymerase chain reaction method for the diagnosis of visceral leishmaniasis in immunocompetent patients. Diagnostic Microbiology and Infectious Disease 60:151-154, 2008.
    • 30
      Nunes VLB. Condicionantes para a transmissão de leishmanioses em assentamento agrícola do INCRA e adjacências, Planalto da Bodoquena, Estado de Mato Grosso do Sul, Brasil, 1998, 1999. Doutorado [Tese de Doutorado em Saúde Pública]. Faculdade de Saúde Pública. Universidade de São Paulo. São Paulo, 2001.
    • 31
      Nunes VLB, Dorval MEC, Oshiro ET, Noguchi RC, Arão LB, Hans Filho G, Espíndola MA, Cristaldo G, Rocha HC, Serafine LN, Santos D. Estudo epidemiológico sobre Leishmaniose Tegumentar (LT) no município de Corguinho, Mato Grosso do Sul - estudos na população humana. Revista da Sociedade Brasileira de Medicina Tropical 28:185-193, 1995.
    • 32
      Nunes VLB, Galati EAB, Cardozo C, Rocca MEG, Andrade ARO, Santos MFC, Aquino RB, Rosa D. Estudo de flebotomíneos (Diptera, Psychodidae) em área urbana do município de Bonito, Mato Grosso do Sul, Brasil. Revista Brasileira de Entomologia 52:446-451, 2008.
    • 33
      Oliveira ALL, Paniago, AMM, Dorval MEC, Oshiro ET, Leal CR, Sanches M, Cunha RV, Bóia, MN. Foco emergente de leishmaniose visceral em Mato Grosso do Sul. Revista da Sociedade Brasileira de Medicina Tropical 39:446-450, 2006.
    • 34
      Oliveira JP, Fernandes F, Cruz AK, Trombela V, Monteiro E, Camargo AA, Barral A, Oliveira CI. Genetic diversity of Leishmania amazonensis strains isolated in northeastern Brazil as revealed by DNA sequencing, PCR-based analyses and molecular karyotyping. Kinetoplastid Biology and Disease 6: 5-8, 2007.
    • 35
      Paiva BR, Passos LN, Falqueto A, Malafronte RS, Andrade HF. Single step polymerase chain reaction (PCR) for the diagnosis of the Leishmania (Viannia) subgenus. Revista do Instituto de Medicina Tropical de São Paulo 46:335-338, 2004.
    • 36
      Paiva BR, Secundino NF, Pimenta PF, Galati EAB, Malafronte RS. Standardization of conditions for PCR detection of Leishmania spp. DNA in sandflies (Diptera, Psychodidae). Cadernos de Saúde Pública 23:87-94, 2007.
    • 37
      Pereira EF, Thomaz-Soccol V, Lima HC, Thomaz-Soccol A, Castro EA, Mulinari-Brenner F, Queiroz-Telles F, Luz E. Molecular diagnosis of leishmaniosis in the Parana´state of southern Brazil. Experimental Dermatology 17:1024-1030, 2008.
    • 38
      Pita-Pereira D, Alves CR, Souza MB, Brazil RP, Bertho AL, Figueiredo Barbosa AF, Britto CC. Identification of naturally infected Lutzomyia intermedia and Lutzomyia migonei with Leishmania(Viannia)braziliensis in Rio de Janeiro (Brazil) revealed by a PCR multiplex non-isotopic hybridisation assay Transactions of the Royal Society of Tropical Medicine and Hygiene 99:905-913, 2005.
    • 39
      Pita-Pereira D, Cardoso MA, Alves CR, Brazil RP, Britto C. Detection of natural infection in Lutzomyia cruzi and Lutzomyia forattinii (Diptera: Psychodidae: Phlebotominae) by Leishmania infantum chagasi in an endemic area of visceral leishmaniasis in Brazil using a PCR multiplex assay. Acta Tropica 107:66-69, 2008.
    • 40
      Rodríguez-Barraquer I, Góngora R, Prager M, Pacheco R, Montero LM, Navas A, Ferro C, Miranda MC, Saravia NG. Etiologic Agent of an Epidemic of Cutaneous Leishmaniasis in Tolima, Colombia. The American Society of Tropical Medicine and Hygiene 78:276-282, 2008.
    • 41
      Romero GAS, Guerra MVF, Paes MG, Macêdo VO. Comparison of cutaneous leishmaniasis due to Leishmania(Viannia) braziliensis and L. (V.) guyanensis in Brazil: clinical findings and diagnostic approach. Clinical Infectious Diseases 32:1304-1312, 2001.
    • 42
      Sambrook J, Fritsch WF, Maniats T. Molecular cloning: a laboratory manual New York, Cold Spring Harbour Laboratory, 1989.
    • 43
      Savani ESMM, Nunes VLB, Galati EAB, Castilho TM, Zampieri RA, Floeter-Winter LM. The finding of Lutzomyia almerioi and Lutzomyia longipalpis naturally infected by Leishmania spp. in a cutaneous and canine visceral leishmaniases focus in Serra da Bodoquena, Brazil. Veterinary Parasitology 160: 18-24, 2009.
    • 44
      Schallig HDFH, Oskam L. Molecular biological applications in the diagnosis and control of leishmaniasis and parasite identification. Tropical Medicine & International Health 7:641-651, 2002.
    • 45
      Secretaria de Estado de Saúde, Sistema Nacional de Agravos de Notificação (SINAN) Campo Grande, MS, 2009.
    • 46
      Silva EA, Andreotti R, Dias ES, Barros JCM, Brazuna JC. Detection of Leishmania DNA in phlebotomines captured in Campo Grande, Mato Grosso do Sul, Brazil. Experimental Parasitology 119:343-348, 2008.
    • 47
      Silva ES, Gontijo CMF, Pacheco RS, Brazil RP. Diagnosis of human visceral leishmaniasis by PCR using blood samples spotted on filter paper. Genetics and Molecular Research 2:251-257, 2004.
    • 48
      Silva ES, Pacheco RS, Gontijo CMF, Carvalho IR, Brazil RP. Visceral Leishmaniasias caused by Leishmania (Viannia) braziliensis in a patient infected with human immunodeficiency virus. Revista do Instituto de Medicina Tropical São Paulo 44:145-149, 2002.
    • 49
      Singh S, Sivakumar, R. Recent Advances in the Diagnosis of leishmaniasis. Journal of Postgraduate Medicine 49:55-60, 2003.
    • 50
      Souza AI, Barros EM, Ishikawa E, Ilha IM, Marin GR, Nunes VL. Feline leishmaniasis due to Leishmania (Leishmania) amazonensis in Mato Grosso do Sul State, Brazil. Veterinary Parasitology 128:41-45, 2005.
    • 51
      Volpini AC, Passos VMA, Oliveira GC, Romanha AJ. PCR-RFLP to identify Leishmania (Viannia) braziliensis and L. (Leishmania) amazonensis causing American cutaneous leishmaniasis. Acta Tropica 90:31-37, 2004.
    • 52
      Wilson SM. DNA-based methods in the detection of Leishmania parasites: field applications and practicalities. Annals of Tropical Medicine and Parasitology 89: 95-100, 1995.

    Endereço para correspondência: Dra. Maria de Fátima Cepa Matos Deptº de Farmácia-Bioquímica/CCBS/UFMS Caixa Postal 549 79070-900 Campo Grande, MS Tel: 55 67 3345-7358 e-mail: mfcmatos@nin.ufms.br

    Datas de Publicação

    • Publicação nesta coleção
      10 Ago 2009
    • Data do Fascículo
      Jun 2009

    Histórico

    • Aceito
      03 Abr 2009
    • Recebido
      17 Dez 2008
    Sociedade Brasileira de Medicina Tropical - SBMT Caixa Postal 118, 38001-970 Uberaba MG Brazil, Tel.: +55 34 3318-5255 / +55 34 3318-5636/ +55 34 3318-5287, http://rsbmt.org.br/ - Uberaba - MG - Brazil
    E-mail: rsbmt@uftm.edu.br