Open-access Variability in the clinical distributions of Candida species and the emergence of azole-resistant non-Candida albicans species in public hospitals in the Midwest region of Brazil

Abstract

INTRODUCTION  Incidence and antifungal susceptibility of Candida spp. from two teaching public hospitals are described.

METHODS  The minimum inhibitory concentrations of fluconazole, voriconazole, itraconazole, and amphotericin B were determined using Clinical Laboratory Standard Institute broth microdilution and genomic differentiation using PCR.

RESULTS  Of 221 Candida isolates, 50.2% were obtained from intensive care unit patients; 71.5% were recovered from urine and 9.1% from bloodstream samples. Candida parapsilosis sensu stricto was the most common candidemia agent.

CONCLUSIONS  We observed variations in Candida species distribution in hospitals in the same geographic region and documented the emergence of non-C. albicans species resistant to azoles.

Keywords:
Candidiasis; Candidemia; Epidemiology

Candida spp. are microorganisms that can cause infections ranging from superficial to systemic infections and are considered the main agents of fungal infections in hospitalized patients. The consequences of invasive candidiasis are severe for both the patient and the institution owing to prolonged hospitalization and increased mortality1.

Although Candida albicans species are the most frequently isolated, the epidemiology of Candida infections is changing, with increased incidence of non-Candida albicans (NCA) species1,2,3.

The choice of treatment for candidiasis should be based on the Candida species and infection site. In addition, knowledge of the local antifungal susceptibility is of great importance to ensure better patient prognosis.

This study investigated the incidence of Candida isolates and their antifungal susceptibility. We performed a prospective study in two public teaching hospitals located in Mato Grosso do Sul State, Brazil, namely University Hospital Maria Aparecida Pedrossian (UH-MAP) and University Hospital of the Federal University of Grande Dourados (UH-FUGD), from March 2013 to March 2014.

This study included Candida spp. isolates obtained from different clinical specimens. If patients had more than one isolate of the same species, only the first sample was considered. Data regarding patient age, sex, and hospital units were obtained from the computerized system of each hospital.

The minimum inhibitory concentrations (MICs) of fluconazole, voriconazole, itraconazole, and amphotericin B were determined by using the Clinical Laboratory Standards Institute (CLSI) broth microdilution (BMD) method. For quality control and reproducibility of the tests, American Type Culture Collection (ATCC) strains (C. krusei ATCC 6258 and C. parapsilosis ATCC 22019) were included. The MICs were interpreted according to the proposed CLSI breakpoints4.

Genomic deoxyribonucleic acid (DNA) was extracted and purified using a commercial YeaStar DNA Extraction Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. For the first differentiation between species, multiplex polymerase chain reaction (PCRm) was performed as described by Li et al.5. The primers used were CL (Candida lusitaniae): GTTAGGCGTTGCTCCGAAAT; CP (Candida parapsilosis complex): GGCGGAGTATAAAGTAATGGATAG; CT (Candida tropicalis): AAGAATTTAACGTGGAAACTTA; CGU (Candida guillermondii): GTATTGGCATGGGTAGTACTG; CA (Candida albicans): TCAACTTGTCACACCAGATTATT3; CK (Candida krusei): GAT TTAGTACTACACTGCGTGA; CGL (Candida glabrata): CACGACTCGACACTTTCTAATT.

For differentiation between Candida albicans and Candida dubliniensis isolates, duplex PCR was performed as described by Ahmad et al.6. The primers used were CALF: TGGTAAGGCGGGATCGCTT + CALR: GGTCAAAGTTTGAAGATATAC; and CDUF: AAACTTGTCACGAGATTATTTTT + CDUR: AAAGTTTGAAGAATAAAATGGC for C. albicans and C. dubliniensis, respectively.

Differentiation of the C. parapsilosis complex was performed by PCR-restriction fragment length polymorphism (RFLP) as described by Tavanti et al.7. The primers used were S1F: GTTGATGCTGTTGGATTGT; S1R: CAATGCCAAATCTCCCAA.

The C. glabrata complex was differentiated by using PCRm in accordance with the study published by Romeo et al.8. The primers used were UNI-5.8 (universal reverse primer): ACCAGAGGGCGCAATGTG; GLA-F (Candida glabrata): CGGTTGGTGGGTGTTCTGC; NIV-F (Candida nivariensis): AGGGAGGAGTTTGTATCTTTCAAC; BRA-F (Candida bracarensis): GGGACGGTAAGTCTCCCG.

During the study period, 10,680 and 8,542 patients were hospitalized in UH-MAP and UH-FUGD, respectively. A total of 221 Candida species were evaluated. Of these, 164 were isolated from patients admitted to UH-MAP while 57 were isolated from those admitted to UH-FUGD. These represent rates of 15.35 and 6.67 per 1,000 admissions in UH-MAP and UH-FUGD, respectively. The incidence of candidemia in UH-MAP was 1.40 per 1,000 hospital admissions (20, 11.7%). In UH-FUGD, the incidence was 0.58 per 1,000 admissions [5 (8.6%)]. Of the patients admitted to UH-MAP and UH-FUGD, 1,035 (9.7%) and 84 (1%) were considered critically ill patients, respectively.

The increased incidence of fungal infections observed in recent years has been associated with the increased use of invasive devices, transplantation, and extensive surgeries, among other medical procedures1,9. In our study, the difference in incidence rates observed between the two hospitals may be related to the higher number of critically ill patients admitted to UH-MAP compared to UH-FUGD.

The age of the patients with candidiasis ranged from 1 day to 98 years, with those ≥60 years most often affected by Candida infection. Most of the patients were women [122 (56%)] and were hospitalized in intensive care units (ICUs) [111 (50.2%)]. Elderly patients, as observed in our study, are at high risk of fungal infections due to the reduced immunity and increased incidence of chronic diseases associated with advancing age10. In addition, ICU admission is considered a risk factor for fungal infections because of the severity of cases and the frequent use of invasive devices1,9. Table 1 shows the patient demographic characteristics, species distribution, and clinical specimens from which Candida isolates were obtained in the two hospitals.

TABLE 1:
Demographic characteristics, species distribution and clinical specimens of Candida isolation according to the hospitals.

Of the 221 Candida isolates, 78 (35.3%) were C. albicans and 143 (64.7%) were NCA, including 58 (35.4%) C. albicans and 106 (64.6%) NCA species from UH-MAP and 20 (35.1%) C. albicans and 37 (64.9%) NCA from UH-FUGD.

Candida spp. were isolated from 11 different clinical specimens (Table 1), mainly urine [158 (71%)], blood samples [20 (9.1%)], and tracheal aspirate [20 (9.1%)].

Despite being tertiary and teaching hospitals located in the same region, the two hospitals showed differences in the incidence of Candida infection-causing species (Table 1).

In UH-MAP, the main agent of candiduria was C. albicans [47 (39.5%)], whereas in UH-FUGD, it was C. tropicalis [15 (38.5%)]. The presence of Candida spp. in the urine may indicate infection or colonization of the urinary tract. In hospitalized patients, the detection of Candida as a colonizing agent has clinical relevance because, in immunocompromised patients, it may be a risk factor for candidemia11.

Unlike previous studies that reported C. albicans as the main species of candidemia in Latina American medical centers3,12, our study showed that NCA species were most commonly isolated from blood cultures [19 (95%)].

Candida parapsilosis sensu stricto was the main cause of candidemia in UH-MAP [6 (40%)]. In UH-FUGD, no difference was observed in the number of species isolated from blood culture. In a recent review3C. parapsilosis sensu stricto was identified as the main NCA species causing candidemia in 25 of 40 studies. In six studies, this species was more prevalent than C. albicans, similar to the observation in the present study. Candida parapsilosis complex is an important agent of candidemia due to their ability to form biofilms and adhere to plastic surfaces such as central venous catheters that are frequently used in critically ill patients13.

Previous studies2,12,14,15 indicate that Candida isolates of various species were susceptible to amphotericin B. In contrast, 132 (57.6%) Candida spp. isolates had decreased susceptibility to azole drugs. Of these, 40 (17.5%) and 11 (17.5%) isolates were considered susceptible dose-dependent (SDD) and resistant to fluconazole, respectively. Regarding itraconazole, 53 (23.1%) isolates were considered SDD while 13 (5.7%) were resistant; finally, 12 (5.2%) and 3 (1.3%) isolates were SDD and resistant to voriconazole, respectively. The results of in vitro assessment of the susceptibility to antifungal drugs according to Candida species are shown in Table 2.

TABLE 2:
Susceptibility to antifungals of Candida species according to hospitals.

Compared with the scarce data from previous studies conducted in the Midwest region of Brazil12,14,15, our results show an increase in the percentage of isolates resistant to antifungal azoles.

A previous study suggested that prolonged fluconazole treatment may induce fluconazole resistant mutations and, consequently, treatment failure2.

In this study, we verified that Candida spp. is important agents of infection in hospitalized patients. Despite affecting all age groups, the most affected were adults and elderly patients admitted to the ICU.

We showed differences in the distributions of Candida species causing candiduria and candidemia in tertiary teaching hospitals within the same region. We also documented the emergence of azole drug resistance, mainly in NCA species.

Ethical considerations

Descriptive statistics were used to characterize the variables. The study was approved by the Research Ethics Committee of the Federal University of Mato Grosso do Sul, under the registration number CAAE: 30746214.3.0000.0021

Acknowledgments

The authors express their gratitude to the Laboratório de Micologia of Hospital Universitário Maria Aparecida Pedrossian and to the Laboratório de Microbiologia team of Hospital Universitário da Grande Dourados for the cedence of Candida strains.

REFERENCES

  • 1 Doi AM, Pignatari ACC, Edmond MB, Marra AR, Camargo LFA, Siqueira RA, et al. Epidemiology and microbiologic characterization of nosocomial candidemia from a Brazilian national surveillance program. PLos One. 2016;11(1):e0146909.
  • 2 Peron IH, Reichert-Lima F, Busso-Lopes AF, Nagasako CK, Lyra L, Moretti ML, et al. Resistance Surveillance in Candida albicans: a five-year antifungal susceptibility evaluation in a Brazilian university hospital. PLoS One. 2016:11(7):e0158126.
  • 3 Matta DA, Souza ACR, Colombo AL. Revisiting species distribution and antifungal susceptibility of Candida bloodstream isolates from Latin American medical centers. J Fungi. 2017;3(24):1-14.
  • 4 Clinical and Laboratory Standards Institute (CLSI). Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Fourth Informational Supplement. M27-S4. Wayne, PA: CLSI; 2012. 32p.
  • 5 Li YL, Leaw JH, Chen H, Chang HC, Chang TC. Rapid identification of yeasts commonly found in positive blood cultures by amplification of the internal transcribed spacer regions 1 and 2. Eur J Clin Microbiol Infect Dis. 2003;22(11):693-6.
  • 6 Ahmad S, Khan Z, Mohammad A, Theyyathel A, Chandy R. Performance comparison of phenotypic and molecular methods for detection and differentiation of Candida albicans and Candida dubliniensis BMC Infect Dis. 2012;12:230.
  • 7 Tavanti A, Davison AD, Grow NAR, Maiden MCJ, Odds FC. Candida orthopsilosis and Candida metapsilosis spp. nov. to replace Candida parapsilosis groups II and III. J Clin Microbiol. 2005;43(1):284-92.
  • 8 Romeo O, Scordino F, Pernice I, Lo Passo C, Criseo G. A multiplex PCR protocol for rapid identification of Candida glabrata and its phylogenetically related species Candida nivariensis and Candida bracarensis J Microbiol Methods. 2009;79(1):117-20.
  • 9 Gong X, Luan T, Wu X, Li G, Qiu H, Kang Y, et al. Invasive candidiasis in intensive care units in China: risk factors and prognoses of Candida albicans and non-albicans Candida infections. Am J Infect Control. 2016;44(5):e59-63.
  • 10 Simpson RJ, Lowder TW, Spielmann G, Bigley AB, Lavoy EC, Kunz H. Exercise and the aging immune system. Ageing Res Rev. 2012;11(3):404-20.
  • 11 Magill SS, Swoboda SM, Johnson EA, Merz WG, Pelz RK, Lipsett PA, et al. The association between anatomic site of Candida colonization, invasive candidiasis, and mortality in critically ill surgical patients. Diagn Microbiol Infect Dis. 2006;5(4):293-301.
  • 12 Bonfietti LX, Szeszs MW, Chang MR, Martins MA, Pukinskas SRBS, Nunes MO, et al. Ten-year study of species distribution and antifungal susceptibilities of Candida bloodstream isolates at a Brazilian tertiary hospital. Mycopathologia. 2012;174(5-6):389-96.
  • 13 Traoré O, Spreingthorpe VS, Sattar SA. A quantitative study of the survival of two species of Candida on porous and non-porous environmental surfaces and hands. J Appl Microbiol. 2002;92(3):549-55.
  • 14 Xavier PCN, Chang MR, Paula CR, Matsumoto FE, Asensi MD, Matos MFC, et al. Molecular characterization of Candida spp. Isolates from patients with bloodstream infections. Rev Soc Bras Med Trop. 2013;46(6):786-7.
  • 15 Almeida AA, Mesquita CSS, Svidzinsk TIE, Oliveira KMP. Antifungal susceptibility and distribution of Candida spp. isolates from the University Hospital in the municipality of Dourados, State of Mato Grosso do Sul, Brazil. Rev Soc Bras Med Trop . 2013;46(3):335-9.
  • Financial support: This work was supported by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and Fundação de Apoio ao Desenvolvimento do Ensino, Ciência e Tecnologia do Estado de Mato Grosso do Sul (FUNDECT).

Publication Dates

  • Publication in this collection
    Nov-Dec 2017

History

  • Received
    21 Apr 2017
  • Accepted
    24 Aug 2017
location_on
Sociedade Brasileira de Medicina Tropical - SBMT Sociedade Brasileira de Medicina Tropical - SBMT, Núcleo de Medicina Tropical – UnB, Sala 43C – 70904-970, E-mails: rsbmt@uftm.edu.br | artes.rsbmt@gmail.com | sbmt@sbmt.org.br , WhatsApp: SBMT (61) 9.9192-6496, WhatsApp: RSBMT (34) 9.9996-5807 - Brasília - DF - Brazil
E-mail: rsbmt@uftm.edu.br
rss_feed Stay informed of issues for this journal through your RSS reader
Accessibility / Report Error