Effect of the initiation and duration of physical exercise on the deleterious effects induced by ionizing radiation on the brain

TEIXEIRA, LUCIANA P.M.; LAU, CLÁUDIO SÉRGIO C.; NOGUEIRA, EDUARDO M.; CASSIMIRO, GISELLE O.G.; BARRETO-VIANNA, ANDRÉ R.C.; SOUZA, ROBERTO SALOMÃO DE; MANTUANO, ANDREA; CIAMBARELLA, BIANCA T.; BORGES, MAURÍCIO MOACIR S.; FERREIRA, JHON BRANDON FÉLIX; SILVA, JEMIMA F.R. DA; MAGALHÃES, LUIS ALEXANDRE G.; FILGUEIRAS, CLÁUDIO C.; FERREIRA-MACHADO, SAMARA CRISTINA

doi:10.1590/0001-3765202520241165

Abstract

Radiotherapy can damage healthy brain tissue, leading to cognitive deficits. Physical exercise enhances neurogenesis and synaptic plasticity, improving cognitive functions like memory and learning. This study evaluated aerobic exercise’s effect on endothelial marker gene expression and memory in cranially irradiated mice. In total, 144 male Swiss mice were divided into sedentary control (SC), sedentary irradiated (SI), exercise control (EC), and irradiated exercise (EI) groups. The EI groups underwent treadmill training in three conditions: 3-months post-irradiation, 1-month pre-irradiation, and 1- month post-irradiation. Ninety days after irradiation, memory was tested using the open- field and object location memory tests. RT-qPCR analyzed hippocampal expression of VEGF-A, eNOS, and vWF. No differences were found in the open-field test, but sedentary irradiated mice showed impaired memory in the object location task. Treadmill training restored memory, especially in the 3-month post-irradiation group. Irradiation increased vWF expression, which physical exercise mitigated. Physical activity also increased VEGF-A and eNOS expression in irradiated mice. These findings suggest that post-irradiation exercise mitigates memory impairment and may influence vascular changes in the brain.

Key words
Brain; Hippocampus; VEGF-A; vWF; eNOS

INTRODUCTION

Radiotherapy is one of the main interventions for controlling primary tumors and brain metastases. Despite the technological advances and associated benefits, such as increased patient survival, one major drawback is that radiation not only targets neoplastic cells but also affects adjacent healthy tissue (Koka et al. 2022). The damage to healthy tissue caused by radiation can result in a range of side effects (Stone et al. 2003), including radiation-induced brain injuries that may compromise the patient’s quality of life post-treatment (Witzmann et al. 2021). Among these effects, memory loss and cognitive dysfunction have been reported in both patients and experimental studies, with these deficits linked to reduced neurogenesis, increased neuroinflammation, and capillary rarefaction in the hippocampal region and other brain areas (Warrington et al. 2013). Growing evidence indicates that microvascular lesions, endothelial dysfunction and reduced capillary density may contribute to the chronic nature of radiation-induced damage (Lumniczky et al. 2017). During the progression of damage, alterations expression of angiogenic factors such as vascular endothelial growth factor (VEGF-A) and von Willebrand factor (vWF), a critical protein in blood clotting, are observed (Shibuya 2011).

Conversely, numerous scientific studies have demonstrated that regular physical exercise is a vital component of a healthier lifestyle (Qiu et al. 2023). Exercise appears to slow the development and progression of several chronic diseases, by generating antioxidant and anti-inflammatory effects, and improving blood flow (Nieman & Wentz 2019). Specifically, aerobic exercise is known to reduce the production of free radicals and increase the expression of enzyme endothelial nitric oxide synthase (eNOS) (Marino et al. 2009, Sun et al. 2019). This enzyme plays a key role in producing nitric oxide, which can act as a vasodilator and anti-inflammatory mediator, enhancing endothelial function (Green et al. 2004, Fischetti et al. 2023).

Physical exercise plays a vital role in the overall well-being of cancer survivors, offering both the physical and psychological benefits (Spychka et al. 2020, Papalia et al. 2022). From a metabolic standpoint, the significance of physical exercise lies in its role in the bidirectional interaction between the peripheral and central nervous systems, which partly explains why certain exercise protocols present new opportunities for maintaining health and reducing the risk of neurodegenerative diseases (Spychka et al. 2020).

The Eastern Cooperative Oncology Group Performance Status (ECOG) scale, introduced in 1960, assesses performance on a scale from 0 (fully active) to 5 (dead). Developed over half a century ago, the scale’s reliance on subjective assessment has resulted in inconsistencies and significant variability in interpreting performance status (Kelly & Shahronkni 2016, Spychka et al. 2020). Beneficial effects of moderate physical exercise before, after, or during cancer treatment in patients with breast, prostate, or colorectal cancer have been documented in the literature, but when it comes to brain cancer, this evidence is overlooked. Current guidelines lack specific recommendations on the optimal timing for early rehabilitation interventions, and research on rehabilitation for brain tumor survivors is scarce, leaving a gap in care guidance for this population (Spychka et al. 2020).

This study hypothesizes that regular physical exercise can mitigate or prevent the late onset of cognitive deficits associated with brain irradiation. Radiation-induced late effects in the brain are linked to progressive endothelial dysfunction and tissue hypoperfusion, with regular physical exercise potentially acting as an agent to reduce or prevent cognitive deficits (Rübe et al. 2023). However, uncertainties remain regarding the efficacy of physical exercise as a therapeutic intervention, as it is not consistently employed in clinical practice for the treatment of cognitive decline. Given the growing emphasis on patient-centered care, further research is necessary to explore the functional status and the effects of oncology treatments, thereby informing exercise and rehabilitation strategies for brain tumor survivors.

In this work, different timings and durations of physical exercise were examined in relation to brain irradiation in mice, subsequently evaluating the expression of the VEGF-A, vWF, and eNOS genes, along with associated behavioral changes.

MATERIALS AND METHODS

Animals and ethics statement

A total of 144 male Swiss Webster (Mus musculus) mice, aged 70 to 90 days and weighing between 30 and 45 grams, were housed in the vivarium located in the Department of Radiological Sciences. The mice were maintained under controlled conditions, including a 12-hour light/dark cycle (lights on: 6:00), and regulated temperature. The animals were kept in appropriate cages containing sawdust, with drinking water and food provided ad libitum. This study was conducted in accordance with ethical guidelines and was approved by the Ethics Committee for the Care of Experimental Animals (CEUA) of the Roberto Alcantara Gomes Institute of Biology (protocol No. 029/2018).

Experimental design

Three experimental conditions were evaluated: exercise for 3 months after irradiation (90 days post); exercise for 1 month after irradiation (30 days post); exercise for 1 month before irradiation (30 days prior). For each condition, animals were divided into four groups with N = 12 for all: sedentary control (SC group); sedentary irradiated (SI group); exercise control (EC group) and exercise irradiated (EI group). Figure 1 illustrates the experimental design.

Figure 1
Experimental design of conditions (90 Days Post, 30 Days Post, and 30 Days prior) placed on a timeline in relation to the execution of experiments, behavioral tests, sample collection, and analyses.

Irradiation procedure

The cranium of the SI and EI group mice in each experimental condition (90 days post, 30 days post and 30 days prior) were irradiated with X-ray using a 6 MV Varian linear accelerator (CLINAC) at the University Center for Cancer Control (CUCC/UERJ). Two mice at a time were anesthetized intraperitoneally (i.p.) with a mixture of ketamine (100 mg/kg) and xylazine (10 mg/kg), side by side, in the prone position, with the head included in the irradiation field of 3 x 7 cm2. The eyes were protected with a 2 mm thick lead plate. Given the nominal energy of the X-ray beam used (6 MV), the point where the maximum dose was absorbed, according to the Treatment Planning System (TPS), was at a depth of 1.5 cm. A bolus with 1.4 cm thick was used using gauze soaked in paraffin wrapped with plastic film to overcome the skin sparing effect and to obtain the maximum calculated dose of 10 Gy reached the region of interest (hippocampus). Therefore, during irradiation, the bolus was positioned on top of the cranium of the animals to ensure the incidence point of the dose of 1 mm below the skullcap. This region of the brain received a single dose of 10 Gy, with a dose rate of 320 cGy/min. For the correct use of the accelerator according to the calculated dose, these irradiations were performed every 2 Gy, with 5 repetitions in a row to reach the total dose of 10 Gy. This irradiation method and the dose were selected based on previous experimental studies as it (Fletcher-Sananikone et al. 2021, Whitelaw et al. 2021).

Aerobic Training Protocol

Before starting the exercise protocol, all groups, including the sedentary ones, underwent a 5 days adaptation period on the treadmill. During this period, they were acclimatized to a speed of 10 m/min for 10 minutes each day and subjected to identical conditions to avoid any bias resulting from the adaptation process. Following adaptation, the groups designated for physical exercise (EC and EI) performed a maximal exercise test (MET), beginning at a speed of 10 m/min. The speed increased by 3 m/min every three minutes until the animals signaled extreme fatigue or remained on the shock grid for more than five seconds. This test aimed to determine the appropriate average treadmill speed for each group, set at 60% of the maximum speed achieved during the MET, as described by Leardini-Tristão et al. (2017). No shocked-based stimuli or other interventions were employed at any time. A physical exercise protocol was implemented using an automated treadmill, which constituted a form of forced exercise. Exercise commenced 24 hours after the MET. The exercise groups (EC and EI) were exercised under three experimental conditions: 90 days post, 30 days post and 30 days prior. They were trained 5 days a week for 30 minutes per day at a speed of 17 m/min. Exercise sessions consistently occurred between 4 and 6 pm. Each exercise session for the entire group was visually monitored to prevent accidents. Animals in the SC and SI groups experienced identical daily conditions but without treadmill activity.

Behavioral tests

Behavioral tests were initiated 90 days post-irradiation, including the Open Field Test and the object location memory task. All tests were performed between 4 pm and 6 pm, at the end of the light phase.

Open Field Test

The open-field test was used to evaluate locomotor activity and anxiety (Abreu-Villaça et al. 2018). Each animal was individually placed in a corner of a square polypropylene box (40 cm x 40 cm x 40 cm) with black sides and a transparent base, divided into 16 squares of 10 cm each - 12 peripheral (Pe) and 4 central (C) squares. The animal’s exploratory behavior was recorded for 10 minutes using a camera placed above the apparatus.

Locomotor activity was assessed by counting the total number of crossings over all squares (C + Pe) on the base of the open-field arena, where each crossing required all four legs to be placed within a square. Anxiety-like behavior was evaluated by counting the number of crossings into the central squares of the arena. Between test sessions, the boxes were sanitized with a 40% alcohol solution to eliminate olfactory cues from previous evaluations.

Object location memory task

To assess cognitive deficits related to spatial memory, which is dependent on the hippocampal region, the object location memory task, was selected (Denninger et al. 2018). This test is based on the innate preference of the rodent to explore an object placed in the new position rather than in the familiar one. The test was conducted 24 hours after open field test across all groups in the different experimental conditions (90 days post, 30 days post and 30 days prior).

The test consisted of two 5-minute trials conducted in the same open-field arena separated by a 70 min delay. In the first trial, the animal was placed in the arena and encountered two identical objects placed at corners on the same side of the arena. Objects were placed 20 cm away from each other, and 4 cm from the walls. The objects were mounted with plastic pieces. In the second trial, one of the objects was moved to a new corner in the opposite side of the arena. After each trial, the objects and the test arena were cleansed with a 40% alcohol solution to remove olfactory cues.

Exploratory behavior was defined as sniffing or touching the object with the snout and/or forelimbs. The number of times each animal actively investigated the objects was recorded. To evaluate the preference for the object placed in the new position, a percentage preference score was calculated as 100% × [moved / (moved + familiar)], where “moved” represents exploration of the object that changed position and “familiar” represents exploration of the object in its original position. No minimum exploration time was used as an inclusion or exclusion criterion. This test is based on the principle that animals with intact memory will spend more time exploring the object that has changed position compared to the familiar object. A higher percentage of exploration of the novel object indicates better spatial memory and learning (Denninger et al. 2018).

Gene expression by RT-qPCR

Total RNA was extracted from the hippocampus of animals in the SC, SI, EC, and EI groups using Trizol Reagent (Invitrogen, NY, USA) following the manufacturer’s protocol. The extracted RNA was treated with DNAse I amplification grade (Invitrogen, NY, USA), and first-strand cDNA was synthesized using 4 µg of total RNA with the ImProm-II™ Reverse Transcription System (Promega, WI, USA) as per the manufacturer’s instructions. Oligonucleotide primers were designed based on cDNA sequences from the GenBank database (www.ncbi.nlm.nih.gov) using Primer Express software for Real-Time PCR version 3.0.1 (Applied Biosystems). Real-time quantitative PCR analyses were performed using an Applied Biosystems 7500 instrument (Applied Biosystems, CA, USA). PCR amplifications were conducted with Gotaq qPCR Master Mix (Promega, WI, USA). The cycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by 45 cycles of denaturation at 95°C for 20 sec, and primer annealing at 60°C for 60 sec. Amplification specificity was confirmed with melt curve analysis. Each sample was analyzed in triplicate. The mRNA levels of VEGF-A, eNOS, and vWF were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using the threshold cycle method (2-ΔΔCt). Negative controls included wells with deionized water instead of cDNA. The primer sequences used were as follows: GAPDH: forward: 5’ GTTGTCTCCTGCGACTTCA 3’, reverse: 5’ GGTGGTCCAGGGTTTCTTA 3’; VEGF-A: forward: 5’ ACTGGACCCTGGCTTTACTG 3’, reverse: 5’ TCTGCTCTCCTTCTGTCGTG 3’; eNOS: forward: 5’ ACAAATAGAGGCAATCTTCGTTCA 3’, reverse: 5’ CTATAGCCCGCATAGCGTATCA 3’; vWF: forward: 5’ CAGCATCTCTGTGGTCCTGA 3’, reverse: 5’ GGAGGCTGCTAGTGGTGAAG 3’.

Statistical analysis

Statistical analysis was performed using two statistical softwares GraphPad Prism version 8 software (GraphPad Software, Inc., USA) and software R (RStudio 2024.12.0 Build 467). The data were normally distributed according to the Shapiro-Wilk test (GraphPad) and Levene’s test (R) was used to assess the homogeneity of variances among groups. Data are presented as mean ± standard deviation (SD) for each group. Given the study design, a two-way ANOVA was conducted to analyze the effects of two independent factors: irradiation status (Control vs. Irradiated) and physical activity condition (Sedentary vs. Exercised). When significant interactions or main effects were detected, pairwise comparisons were conducted using Bonferroni’s multiple comparisons test. Statistical significance was set at p < 0.05, and F values with degrees of freedom were reported as F (DFn, DFd).

RESULTS

General observation and body weight

The irradiation procedure was well tolerated and none of the animals exhibited any discomfort or physical signs of distress following brain irradiation. All animals exposed to irradiation and/or subjected to exercise survived throughout the experimental period, presenting normal motor activities, feeding behavior and water intake. Some irradiated animals showed mild local skin reactions and hair removal, but all irradiated mice showed no visible symptoms of radiation sickness, such as nauseas or ataxia. Additionally, all groups exhibited similar body weight gain compared to the corresponding control group. There were no statistically significant differences in body weight between the groups during the observation period (p > 0.05, data not shown) for each condition, suggesting that moderate exercise and radiation did not affect the growth of the mice.

Maximal exercise testing

Twenty-four hours before starting the aerobic exercise sessions, the EC and EI groups from experimental conditions underwent a maximal exercise test (MET) to determine the appropriate training speed, corresponding to 60% of their maximum speed reached during the aerobic exercise protocol. All groups of animals achieved a maximum average speed of 28 m/min. To regulate exercise intensity at a moderate level (60% of the MET), a speed of 17 m/min was established. No significant differences were observed in the maximum speed reached between the animals in the EC and EI groups for any of the experimental conditions analyzed (Table I, p > 0.05).

Thumbnail

Table I
Maximal speeds during maximal exercise testing (MET) and training speeds in animals submitted to exercise (EC and EI) in experimental conditions 90 Days Post, 30 Days Post and 30 Days Prior. The results are expressed as the mean ± SD for each group. MET: maximal exercise testing. 60% of MET = training speeds. EC: Exercise Control; EI: Exercise Irradiated; N: 8-11/group. The animals in the EC and EI groups of each condition were compared using the Student’s t-test.

Behavioral analysis

The open field test was employed to assess animal ambulation (measured by the number of squares crossed by the four limbs) and to evaluate anxiety-related behavior, as mice typically avoid open areas such as the center of the apparatus. The results of non-hippocampal behavioral tasks are presented in Figure 2. Locomotor activity, measured as the total number of squares, did not differ (p < 0.05) between groups across all experimental conditions (Figure 2a-c, p > 0.05). Similar findings were observed for the activity in the center of arena, commonly used as an indicator of anxiety (Prut & Belzung 2003), with no significant differences observed between groups of different conditions (Figure 2d-f, p > 0.05).

Figure 2
Locomotor activity of mice submitted to 3 months of treadmill training after irradiation (90 Days Post), to 1 month of treadmill training after irradiation (30 Days Post), or to 1 month of treadmill training before irradiation (30 Days Prior). In a, b and c are represented the total number of squares traversed (center + periphery). In d, e and f are represented the number of squares crossed in the center of arena. The results are expressed as the mean and SD for each group, N: 6-11/group.

In the object location memory task, the preference scores presented by SI group was lower than that SC group in all conditions (Figure 3, p < 0.05), indicating that sedentary mice which brains received 10 Gy irradiation presented a marked deficit in memory. The absence of differences between SC and EC in all experimental groups suggests that treadmill training did not affect the performance in object location memory task in normal mice (Figure 3, p > 0.05). However, physical exercise was found to mitigate behavioral deficits in irradiated mice, with the extent of cognitive repair varying across experimental conditions.

Figure 3
Preference scores in object location memory test of mice submitted to 3 months of treadmill training after irradiation (90 Days Post, a), to 1 month of treadmill training after irradiation (30 Days Post, b) or to 1 month of treadmill training before irradiation (30 Days Prior, c). The results are expressed as the mean and SD for each group, N: 6-11/group. Values of p < 0.05 were considered statistically significant. Bonferroni posthoc test: * p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

The 90 days post condition (Figure 3a), the most substantial level of cognitive recovery was observed. A two-way ANOVA revealed a statistically significant interaction between the factors irradiation and exercise [F (1, 34) = 58.69; p < 0.0001]. Both irradiation [F (1, 34) = 17.17; p = 0.0002] and exercise [F (1, 34) = 34.91; p < 0.0001] significantly influenced the observed variance. The EI and EC groups demonstrated a higher preference for the object in the altered position compared to the SI group (p < 0.05), with no significant differences between the SC, EC, and EI groups (p > 0.05).

For the 30 days post condition, a two-way ANOVA indicated a significant interaction between irradiation and exercise [F (1, 23) = 6.527; p = 0.0177]. Irradiation was the primary factor driving the observed variations [F (1, 23) = 15.92; p = 0.0006], while exercise did not show a statistically significant effect [F (1, 23) = 0.4586; p = 0.5050]. Although the EI group exhibited higher preference scores than the SI group, this difference was marginal and did not reach statistical significance (Figure 3b, p > 0.05).

In the 30 days prior condition, the two-way ANOVA did not reveal a significant interaction between irradiation and exercise [F (1, 33) = 3.822; p = 0.0591]. Irradiation remained the main factor responsible for the observed variance [F (1, 33) = 8.223; p = 0.0072], while exercise did not have a statistically significant impact [F (1, 33) = 1.662; p = 0.2063]. Similar to the 30 days post condition, the EI group showed slightly higher preference scores than the SI group, but this difference was not statistically significant (Figure 3c, p > 0.05).

Effects of radiation and/or exercise on vWF, VEGF-A and eNOS gene expression

Considering that memory loss reported by some patients undergoing radiotherapy appears to be associated with vascular narrowing and other factors, we investigated the gene expression of the angiogenic factors eNOS, vWF, and VEGF-A in mice subjected to 90 consecutive days of training immediately after irradiation. To assess the interaction between irradiation and exercise, a two-way ANOVA was performed for vWF and VEGF-A, while a t-test was used for the analysis of eNOS in irradiated groups.

As illustrated in Figure 4a (vWF), the two-way ANOVA revealed a significant interaction between the factors [F (1, 16) = 5.456; p = 0.0328], with both exercise [F (1, 16) = 5.456; p = 0.0328] and irradiation [F (1, 16) = 39.68; p < 0.0001] contributing to variance changes. However, irradiation was identified as the predominant factor influencing these changes. Multiple comparison analysis showed a significant increase in vWF gene transcription in the SI group (p < 0.05) compared to SC (p < = 0.0001), EC (p < 0.0001), and EI (p = 0.0269) groups. Notably, vWF expression levels in the EI group were similar to those in the EC and SC groups, indicating that treadmill training reduced vWF expression.

Figure 4
Effects of radiation and/or exercise on VEGF-A (a), vWF (b) and eNOS (c) gene expression in the hippocampus of mice submitted to 3 months of treadmill training after irradiation (90 Days Post). The results are expressed as the mean and SD, N= at least 5 animals per group. Two-way ANOVA followed by Bonferroni’s multiple comparisons test was used to assess changes among for a and b, or Student’s t-test for group c. Values are in relation to the SC group. The eNOS expression wasn’t detected for the SC and EC groups, so in this case EI value is in relation to the SI group. * p < 0.05; ***p < 0.001; ****p < 0.0001.

Regarding VEGF-A (Figure 4b), no significant interaction was found between irradiation and exercise [F (1, 23) = 1.766; p = 0.1969]. However, exercise alone significantly influenced the variance [F (1, 23) = 12.40; p = 0.0018], while irradiation did not [F (1, 23) = 0,007416, p = 0.9321]. A multiple comparisons test revealed a significant increase in VEGF-A expression in the EI group compared to the SI group (p = 0.0121, Figure 4b). This suggests that treadmill training enhanced VEGF-A expression in the EI group, potentially promoting new vessel formation and mitigating capillary rarefaction expected in irradiated tissue.

Additionally, the test-t reveals that EI group showed significantly higher eNOS levels compared to the SI group (p = 0.0030), with a roughly two-fold difference (Figure 4c), suggesting that physical training improved endothelial function in brain-irradiated mice. In the SC and EC groups, eNOS was undetectable due to the low level of expression (Figure 4c).

DISCUSSION

Radiotherapy continues to stand as a cornerstone in cancer treatment, benefiting approximately 50% of patients. Advances in precision have allowed for more targeted delivery of radiation doses, minimizing exposure to surrounding healthy tissue and reducing undesired side effects. However, there is still a critical need to improve the overall quality of life for patients undergoing radiotherapy (Makale et al. 2017, Spychka et al. 2020). Nonetheless, 50 to 90% of the survivors suffer from cognitive impairment. The cognitive dysfunction linked to radiation is not well comprehended and there are no effective measures for its prevention or long-term management (Rübe et al. 2023). Neurocognitive impairment caused by radiotherapy is a major side effect of cranial radiotherapy in both adult and pediatric cancer survivors. It affects areas such as academic performance, job prospects, and the capacity to live independently (Ph et al. 2012, Katsura et al. 2021).

The early signs of radiation-induced harm to the central nervous system damage can accumulate over time, leading permanent cognitive impairment (Greene-Scloesser et al. 2012, Rübe et al. 2023). Various events hinder neuronal function, the viability, and differentiation of progenitor cells, contributing to neurological dysfunction and cognitive decline (Attita et al. 2014, Greene-Scloesser et al. 2012, Zhang et al. 2021).

Numerous studies have demonstrated the benefits of physical exercise in maintaining overall healthy, slowing aging and preventing or mitigating neurodegenerative diseases such as Alzheimer’s and Parkinson’s. Additionally, exercise aids in stroke recovery and decreases the risk of brain cancer mortality (Runco et al. 2019, Xu et al. 2019, Tantillo et al. 2020, Valenzuela et al. 2020, Sandler et al. 2021, Zang et al. 2020). Its effect appears to be associated with the reduction of neuroinflammation, improvement of blood flow, angiogenesis, increased synaptic plasticity, among others (Gehring et al. 2020, Huang et al. 2022).

Throughout the study, we sought to determine the collection period for the suggested protocols, several questions arose regarding optimal duration and timing of exercise relative to radiation exposure to maximize cognitive and behavioral outcomes. The sedentary irradiated group served as a baseline to assess radiation-induced injuries through behavioral and molecular changes.

Previous studies have recommended a waiting period of one month after radiation exposure before initiating an exercise regimen (Naylor et al. 2008, Wong-Gooddrich et al. 2010, Ji et al. 2014, Zang et al. 2020). Therefore, considering that cellular changes may begin shortly after radiation, we considered the potential benefits of starting exercise earlier, approximately 72 hours post-irradiation, without the one-month delay.

In our study, animals that were both exercised and irradiated demonstrated performance levels in the MET and experimental protocols that were very similar to the control group. This suggests that radiation exposure does not cause significant motor impairment or discomfort, allowing for the safe initiation of exercise shortly after exposure.

The irradiated animals subjected to physical exercise (EI) under the conditions 30 days after and 30 days before did not present statistical differences in relation to the irradiated sedentary group (SI) in the object location memory task. This reinforces the importance of consistent physical exercise practice for maintaining of brain function, especially in a situation involving organic injury to brain tissues (Herold et al. 2019). Thus, molecular analyses were focused on the group that showed the most significant cognitive improvements, those in experimental condition 90 days post.

Microvascular injury is considered to play a critical role in radiation-induced brain disease, leading to both direct and indirect damage to parenchymal cells. The profound impact of irradiation on the vasculature is well-documented (Andrews et al. 2018). Numerous studies have highlighted radiation-induced vascular alterations, such as endothelial cell apoptosis, thickening of the vascular wall, vasodilation, heightened vascular permeability, capillary thrombosis, and disruption of endothelial tight junctions integrity. The microvascular rarefaction observed after irradiation should trigger mechanisms of vascular restoration to mitigate long-term brain damage (Huang et al. 2020). Angiogenesis is considered the primary mechanism for repairing and maintaining vascular integrity after vessel rupture. However, the parenchymal effects of radiation are further exacerbated by the significant loss of capillary density within the hippocampal region, resulting in impaired perfusion (Gorbunov & Kiang 2021, Wijerathne et al. 2021). Significant efforts have been made to understand the mechanisms underlying radiation-induced brain injury (RBI), but the exact processes remain unclear. It promotes neurogenesis and regulates vascular endothelium by stimulating endothelial cell proliferation and migration, which supports new vessel formation. VEGF-A also increases vascular permeability, aiding in molecule and immune cell passage across the blood-brain barrier (BBB). This contributes to neuroinflammation and edema. VEGF-A plays a role in the induction of edema and thrombosis during the acute phase of RBI and, in the early late phase, participates in vascular repair, thrombus dissolution, and other reparative processes. Some studies show that targeting VEGF-A could alleviate symptoms. However, the inhibition of VEGF-A function may impair normal angiogenesis (Ma et al. 2019).

The EI group showed increased VEGF-A expression, suggesting that physical exercise induced VEGF-A upregulation in irradiated nervous tissue. This aligns with several studies demonstrating that exercise elevates VEGF-A levels in neurodegenerative diseases (Pahlavani 2023). Exercise-induced increases in microvessel density have been demonstrated, with angiogenesis peaking after 3 weeks of physical activity (Geiseler & Morland 2018, Muñoz et al. 2018, Pahlavani 2023).

Our result is consistent with a study that demonstrated increased VEGF-A levels and prevention of progressive memory decline in mice subjected to voluntary running for 5 months after irradiation (Wong-Goodrich et al. 2010). Conversely, other studies have noted increased VEGF-A levels in irradiated brains compared to controls, a discrepancy that may be attributed to differences in species, strains, radiation dosage, or post-irradiation analysis timing (Kim et al. 2004, Lee et al. 2012).

Regarding eNOS, significant expression was observed only in the SI and EI groups. According to Leardini-Tristão et al. (2017), regular physical exercise increases vascular shear stress enhancing NO bioavailability through upregulation of eNOS. This upregulation promotes vasodilation and improving endothelial function. The observed increase in eNOS in the EI group suggests improved circulatory conditions, indicating that eNOS may play a key role in cerebral protection following radiation injury when combined with physical exercise. On the other hand, the results also demonstrate that irradiation may directly impact eNOS expression, as the only groups with detectable levels were the irradiated ones, and only a potential effect of exercise is observed. According to Nagane et al. (2018), ionizing radiation increases eNOS activity through the phosphorylation of the Ser1179 residue, a critical site for its activation. This effect occurs as early as 3 hours after irradiation. Additionally, radiation induces the dephosphorylation of the Thr497 residue, which normally inhibits eNOS, thereby reinforcing its activation. The ataxia telangiectasia mutated (ATM) kinase protein, activated in response to DNA breaks, also contributes to this eNOS phosphorylation, suggesting that eNOS activation by radiation is linked to the cellular response to DNA damage (Nagane et al. 2018).

Additionally, the assessment of vWF is directly related to platelet adhesion (Alavi et al. 2023). This effect is partially due to increased vWF production, which enhances platelet adhesion and contributes to vessel occlusion (Thomas et al. 2023). The formation of thrombi in the body, particularly in the brain, increases the risk of ischemic diseases and strokes (Goncharov et al. 2024). In our study, we did not evaluate the mechanism by which radiation triggers increased vWF release in sedentary irradiated animals. However, studies show that vWF is synthesized and released by the injured vascular endothelium (Xu et al. 2024). It appears that moderate physical exercise may modulate this expression, as supported by our data. This regulation could potentially help patients undergoing radiotherapy avoid side effects and illnesses related to thrombus and clot formation. Further research is needed to explore how vWF interacts with other coagulation molecules to better understand the regulatory effects of physical exercise.

The reduction in vWF expression observed in the EI group is consistent with the two-way ANOVA results and suggests potential endothelial modulation in response to irradiation. This decrease may indicate impaired endothelial function, possibly associated with a compensatory mechanism involving the regulation of other vascular factors (Zang et al. 2020, Zhang et al. 2020). In this context, eNOS expression showed an increase compared to the SI group, suggesting a possible adaptive adjustment in endothelial homeostasis. However, irradiation appears to be the primary factor driving these changes, while exercise alone was not sufficient to induce a significant response in EC expression, except in presence of tissue damage (EI group). These findings reinforce the influence of radiation on endothelial dysfunction and suggest that, despite the potential modulatory role of physical activity, its effect may be limited without additional stimuli.

This study suggests that regular, moderate physical exercise performed immediately after radiation exposure can significantly attenuate radiation-induced cognitive deficits. The observed upregulation of VEGF-A and eNOS, together with modulation of vWF expression, highlights potential neuroprotective and vasculoprotective effects of exercise in counteracting radiation-induced damage. These findings highlight the critical role of exercise as a nonpharmacological intervention that not only supports cognitive function but also improves endothelial health in irradiated tissues.

Acknowledgements

The authors are thankful to the staff of the Centro Universitário do Controle do Câncer (CUCC) for the irradiation of the animals. This work was supported by grants from Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ; 260003/001214/2020) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq; 403664/2023-3).

References

ABREU-VILLAÇA Y, CARVALHO-GRAÇA AC, SKINNER G, LOTUFO BM, DUARTE-PINHEIRO VHS, RIBEIRO-CARVALHO A, MANHÃES AC & FILGUEIRAS CC. 2018. Hyperactivity and memory/learning deficits evoked by developmental exposure to nicotine and/or ethanol are mitigated by cAMP and cGMP signaling cascades activation. Neurotoxicology 66: 150-159.
ALAVI P, YOUSEF ABDUALLA R, BROWN D, MOJIRI A, NAGENDRAN J, LEWIS J, BOURQUE SL & JAHROUDI N. 2023. Aging Is Associated With Organ-Specific Alterations in the Level and Expression Pattern of von Willebrand Factor. Arterioscler Thromb Vasc Biol 43(11): 2183-2196.
ANDREWS RN, CAUDELL DL, METHENY-BARLOW LJ, PEIFFER AM, TOOZE JA, BOURLAND JD, HAMPSON RE & DEADWYLER AS. 2018. Fibronectin produced by cerebral endothelial and vascular smooth muscle cells contributes to perivascular extracellular matrix in late-delayed radiation-induced brain injury. Radiat Res 190(4): 361-373.
ATTITA A, PAGE BR, LESSER GJ & CHAN M. 2014. Treatment of radiation-induced cognitive decline. Curr Treat Options Oncol 15: 539-550.
DENNINGER JK, SMITH BM & KIRBY ED. 2018. Novel Object Recognition and Object Location Behavioral Testing in Mice on a Budget. J Vis Exp 20: 141.
FISCHETTI F, POLI L, TOMMASO MD, PAOLICELLI D, GRECO G & CATALDI S. 2023. The role of exercise parameters on small extracellular vesicles and microRNAs cargo in preventing neurodegenerative diseases. Front Physiol 14: 1241010.
FLETCHER-SANANIKONE E ET AL. 2021. Elimination of Radiation-induced senescence in the brain tumor microenvironment attenuates glioblastoma recurrence. Cancer Res 81(23): 5935-5947.
GEHRING K ET AL. 2020. A pilot randomized controlled trial of exercise to improve cognitive performance in patients with stable glioma: a proof of concept. Neuro Oncol 22(1): 103-115.
GEISELER SJ & MORLAND C. 2018. The Janus Face of VEGF in Stroke. Int J Mol Sci 19(5): 1362.
GONCHAROV NV ET AL. 2024. Immunological Profile and Markers of Endothelial Dysfunction in Elderly Patients with Cognitive Impairments. Int J Mol Sci 25(3): 1888.
GORBUNOV NV & KIANG JG. 2021. Brain Damage and Patterns of Neurovascular Disorder after Ionizing Irradiation. Complications in Radiotherapy and Radiation Combined Injury Radiat Res 196(1): 1-16.
GREEN DJ, MAIORANA A, O’DRISCOLL G & TAYLOR R. 2004. Effect of exercise training on endothelium-derived nitric oxide function in humans. J Physiol 561: 1-25.
GREENE-SCLOESSER D ET AL. 2012. Radiation-induced brain injury: A review. Font Oncol 2: 73.
HEROLD F, TÖRPEL A, SCHEGA L & MÜLLER NG. 2019. Functional and/or structural brain changes in response to resistance exercises and resistance training lead to cognitive improvements – a systematic review. Eur Rev Aging Phys Act 16: 10.
HUANG Q, WU M, WU X, ZANG Y & XIA Y. 2022. Muscle-to-tumor crosstalk: The effect of exercise-induced myokine on cancer progression. Biochim Biophys Acta Ver Cancer 1877(5): 188761.
HUANG X, LI M, ZHOU D, DENG Z, GUO J & HUANG H. 2020. Endothelial progenitor cell transplantation restores vascular injury in mice after whole-brain irradiation. Brain Res 1746: 147005.
JI JF, JI SJ, SUN R, ZHANG LY & TIAN Y. 2014. Forced running exercise attenuates hippocampal neurogenesis impairment and the neurocognitive deficits induced by whole- brain irradiation via the BDNF-mediated pathway. Biochem Biophys Res Commun 443(3): 646-651.
KATSURA M, SATO J, AKAHANE M, FURUTA T, MORI H & ABE O. 2021. Recognizing Radiation-induced Changes in the Central Nervous System: Where to Look and What to Look For. Radiographics 41(1): 224-248.
KELLY CM & SHAHROKNI A. 2016. Moving beyond Karnofsky and ECOG performance status assessments with new technologies. J Oncol 2016: 6186543. doi: 10.1155/2016/6186543.
KIM H ET AL. 2004. Upregulation of VEGF and FGF2 in Normal Rat Brain after Experimental Intraoperative Radiation Therapy. J Korean Med Sci 19(6): 879-886.
KOKA K, VERMA A, DWARAKANATH BS & PAPINENI RVL. 2022. Technological Advancements in External Beam Radiation Therapy (EBRT): An Indispensable Tool for Cancer Treatment. Cancer Manag Res 14: 1421-1429.
LEARDINI-TRISTÃO M, BORGES JP, FREITAS F, RANGEL R, DALIRY A, TIBIRIÇÁ E & ESTATO V. 2017. The impact of early aerobic exercise on brain microvascular alterations induced by cerebral hypoperfusion. Brain Res 1657: 43-51.
LEE WH, CHO HJ, SONNTAG WE & LEE YW. 2012. Whole Brain Radiation-Induced Cognitive Impairment: Pathophysiological Mechanisms and Therapeutic Targets. Biomol Ther 20(4): 357-370.
LUMNICZKY K, SZATMÁRI T & SÁFRÁNY G. 2017. Ionizing Radiation-induced imune and inflamatory reactions in the brain. Front Immunol 5(8): 517.
MA C, ZHOU J, XU X, WANG L, QIN S, HU C, NIE L & TU Y. 2019. The Construction of a Radiation-Induced Brain Injury Model and Preliminary Study on the Effect of Human Recombinant Endostatin in Treating Radiation-Induced Brain Injury. Med Sci Monit 25: 9392-9401.
MAKALE MT, MCDONALD CR, HATTANGADI-GLUTH JA & KESARI S. 2017. Mechanisms of radiotherapy-associated cognitive disability in patients with brain tumours. Nat Rev Neurol 13(1): 52-64.
MARINO S, SCIARTILLI A, VALERIO V, BALDASSARRE A & GALLINA S. 2009. The effect of physical exercise on endothelial function. Sports Med 39: 797-812.
MUÑOZ A, CORRÊA CL, LOPEZ-LOPEZ A, COSTA-BESADA MA, DIAZ-RUIZ C, LABANDEIRA-GARCIA JL & GERONTOL A. 2018. Physical Exercise Improves Aging-Related Changes in Angiotensin, IGF-1, SIRT1, SIRT3, and VEGF in the Substantia Nigra. Biol Sci Med Sci 73(12): 1594-1601.
NAGANE M, KUPPUSAMY ML, AN J, MAST J, GOGNA R, HIRONOBU Y, YAMAMORI T, INANAMI O & KUPPUSAMY P. 2018. Ataxia-Telangiectasia Mutated (ATM) Kinase Regulates eNOS Expression and Modulates Radiosensitivity in Endothelial Cells Exposed to Ionizing Radiation. Radiat Res 189(5): 519-528.
NAYLOR AS, BULL C, NILSSON MKL, ZHU C, BJÖRK-ERIKSSON T, ERIKSSON PS, BLOMGREN K & KUHN HG. 2008. Voluntary running rescues adult hippocampal neurogenesis after irradiation of the young mouse brain. Proc Natl Acad Sci 105(38): 14632.
NIEMAN D & WENTZ L. 2019. The compelling link between physical activity and the body’s defense system. J Sport Health Sci 8: 201-217.
PAHLAVANI HA. 2023. Exercise therapy to prevent and treat Alzheimer’s disease. Front Aging Neurosci 15: 1243869.
PAPALIA WL, NASCIMENTO AS, KRISHNA G, BROETTO N, FURIAN AF, OLIVEIRA MS, ROYES LFF & FIGHERA MR. 2022. Physical Exercise as a Modulator of Vascular Pathology and Thrombin Generation to Improve Outcomes After Traumatic Brain Injury. Neurobiol 59(2): 1124-1138.
PH W ET AL. 2012. Radiation induces acute alterations in neuronal function. Plos One 7: 37677.
PRUT L & BELZUNG C. 2003. The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: a review. Eur J Pharmacol 463(1-3): 3-33.
QIU Y, FERNÁNDEZ-GARCIA B, LEHMANN H L, LI G, KROEMER G, LÓPEZ-OTIN C & XIAO J. 2023. Exercise sustains the hallmarks of health. J Sport Health Sci 12(1): 8-35.
RÜBE CE, RAID S, PALM J & RÜBE C. 2023. Radiation-Induced brain injury: Age dependency of neurocognitive dysfunction following radiotherapy. Cancers 15: 2999.
RUNCO DV, YOON L, GROSS SA & WONG CK. 2019. Nutrition & Exercise Interventions in Pediatric Patients with Brain Tumors: A Narrative Review. J Natl Cancer Inst Monogr 54: 163-168.
SANDLER SX, MATSUYAMA M, JONES TJ, BASHFORD J, LANGBECKER D & HAYES SC. 2021. Physical activity and exercise in adults diagnosed with primary brain cancer: a systematic review. J Neurooncol 53(1): 1-14.
SHIBUYA M. 2011. Vascular Growth Factor (VEGF) and Its Receptor (VEGFR) Signaling in Angiogenesis. Genes Cancer 2: 1097-1105.
SPYCHKA RA, PURDY GM, EASAW JC, LITTLETON R, MURTHA AD, DRIGA A, CULOS-REED SN & MCNEELY ML. 2020. Feasibility of performance-based functional assessment in brain tumour survivors. Eur J Cancer Care 29(4): 13238.
STONE HB, COLEMAN CN, ANSCHER MS & MCBRIDE WH. 2003. Effect of radiadion on normal tissue: consequences and mecganisms. The Lan Onc 4: 529-536.
SUN L, ZHUANG LP & WU WF. 2019. Aerobic exercise repairs neurological function after cerebral ischaemia by regulating the nitric oxide. An Acad Bras Cienc 91: e20190068. https://doi.org/10.1590/0001-3765201920190068.
» https://doi.org/10.1590/0001-3765201920190068
TANTILLO E, COLISTRA A, BARONCELLI L, COSTA M, CALEO M & VANNINI E. 2020. Voluntary Physical Exercise Reduces Motor Dysfunction and Hampers Tumor Cell Proliferation in a Mouse Model of Glioma. Int J Environ Res Public Health 17(16): 5667.
THOMAS R ET AL. 2023. Plasma von Willebrand Factor Is Elevated Hyperacutely After Mild Traumatic Brain Injury. Neurotrauma Rep 4(1): 655-662.
VALENZUELA PL, CASTILLO-GARCIA A, MORALES JS, VILLA PD, HAMPEL H, EMANUELE E, LISTA S & LUCIA A. 2020. Exercise benefits on Alzheimer’s disease: State-of-the-science. Ageing Res Rev 62: 101-108.
XU J, HE J, ZHOU Y, WENG Z, LI M, WANG ZX & HE Y. 2024. Von Willebrand factor promotes radiation-induced intestinal injury (RIII) development and its cleavage enzyme rhADAMTS13 protects against RIII by reducing inflammation and oxidative stress. Free Radic Biol Med 210: 1-12.
XU X, FU Z & LE W. 2019. Exercise and Parkinson’s disease. Int Ver Neurobiol 147: 45-74.
WARRINGTON JP, ASHPOLE N, CSISZAR A, LEE YW, UNGYARI Z & SONNTAG WE. 2013. Whole Brain Radiation-Induced Vascular Cognitive Impairment: Mechanisms and Implications. J Vas Res 50(6): 445-457.
WHITELAW BS, TANNY S, JOHNSTON CJ, MAJEWSKA AK, O’BANION MK & MARPLES B. 2021. In Vivo Imaging of the Microglial Landscape After Whole Brain Radiation Therapy. Int J Radiat Oncol Phys 111(4): 1066-1071.
WIJERATHNE H, LANGSTON JC, YANG Q, SUN S, MIYAMOTO C, KILPATRICK LE & KIANI MF. 2021. Mechanisms of radiation-induced endothelium damage: Emerging models and Technologies. Radiother Oncol 158: 21-32.
WITZMANN K, RASKCHE F & TOOST EGC. 2021. MR Image Changes of Normal-Appearing Brain Tissue after Radiotherapy. Cancers 13: 1573.
WONG-GOODRICH SJE, PFAU ML, FLORES CT, FRASER JA, WILLIAMS CL & JONES LW. 2010. Voluntary running prevents progressive memory decline and increases adult hippocampal neurogenesis and growth factor expression after whole-brain irradiation. Cancer Res 70(22): 9329-9338.
ZANG J, LI J, ZHU Y, MIAO Z & TIAN Y. 2020. Forced running exercise mitigates radiation-induced cognitive deficits via regulated DNA hydroxymethylation. Epigenomics 12(5): 385-396.
ZHANG H ET AL. 2020. Implication of MicroRNA503 in Brain Endothelial Cell Function and Ischemic Stroke. Transl Stroke Res 11(5): 1148-1164.
ZHANG XX, TIAN Y, WANG ZT, MA YH, TAN L & YU JT. 2021. The Epidemiology of Alzheimer’s Disease Modifiable Risk Factors and Prevention. Prev Alzheimers Dis 8(3): 313-321.

Publication Dates

Publication in this collection
19 Sept 2025
Date of issue
2025

History

Received
10 Oct 2024
Accepted
16 May 2025

This is an open-access article distributed under the terms of the Creative Commons Attribution License

[1] ABREU-VILLAÇA Y, CARVALHO-GRAÇA AC, SKINNER G, LOTUFO BM, DUARTE-PINHEIRO VHS, RIBEIRO-CARVALHO A, MANHÃES AC & FILGUEIRAS CC. 2018. Hyperactivity and memory/learning deficits evoked by developmental exposure to nicotine and/or ethanol are mitigated by cAMP and cGMP signaling cascades activation. Neurotoxicology 66: 150-159.

[2] ALAVI P, YOUSEF ABDUALLA R, BROWN D, MOJIRI A, NAGENDRAN J, LEWIS J, BOURQUE SL & JAHROUDI N. 2023. Aging Is Associated With Organ-Specific Alterations in the Level and Expression Pattern of von Willebrand Factor. Arterioscler Thromb Vasc Biol 43(11): 2183-2196.

[3] ANDREWS RN, CAUDELL DL, METHENY-BARLOW LJ, PEIFFER AM, TOOZE JA, BOURLAND JD, HAMPSON RE & DEADWYLER AS. 2018. Fibronectin produced by cerebral endothelial and vascular smooth muscle cells contributes to perivascular extracellular matrix in late-delayed radiation-induced brain injury. Radiat Res 190(4): 361-373.

[4] ATTITA A, PAGE BR, LESSER GJ & CHAN M. 2014. Treatment of radiation-induced cognitive decline. Curr Treat Options Oncol 15: 539-550.

[5] DENNINGER JK, SMITH BM & KIRBY ED. 2018. Novel Object Recognition and Object Location Behavioral Testing in Mice on a Budget. J Vis Exp 20: 141.

[6] FISCHETTI F, POLI L, TOMMASO MD, PAOLICELLI D, GRECO G & CATALDI S. 2023. The role of exercise parameters on small extracellular vesicles and microRNAs cargo in preventing neurodegenerative diseases. Front Physiol 14: 1241010.

[7] FLETCHER-SANANIKONE E ET AL. 2021. Elimination of Radiation-induced senescence in the brain tumor microenvironment attenuates glioblastoma recurrence. Cancer Res 81(23): 5935-5947.

[8] GEHRING K ET AL. 2020. A pilot randomized controlled trial of exercise to improve cognitive performance in patients with stable glioma: a proof of concept. Neuro Oncol 22(1): 103-115.

[9] GEISELER SJ & MORLAND C. 2018. The Janus Face of VEGF in Stroke. Int J Mol Sci 19(5): 1362.

[10] GONCHAROV NV ET AL. 2024. Immunological Profile and Markers of Endothelial Dysfunction in Elderly Patients with Cognitive Impairments. Int J Mol Sci 25(3): 1888.

[11] GORBUNOV NV & KIANG JG. 2021. Brain Damage and Patterns of Neurovascular Disorder after Ionizing Irradiation. Complications in Radiotherapy and Radiation Combined Injury Radiat Res 196(1): 1-16.

[12] GREEN DJ, MAIORANA A, O’DRISCOLL G & TAYLOR R. 2004. Effect of exercise training on endothelium-derived nitric oxide function in humans. J Physiol 561: 1-25.

[13] GREENE-SCLOESSER D ET AL. 2012. Radiation-induced brain injury: A review. Font Oncol 2: 73.

[14] HEROLD F, TÖRPEL A, SCHEGA L & MÜLLER NG. 2019. Functional and/or structural brain changes in response to resistance exercises and resistance training lead to cognitive improvements – a systematic review. Eur Rev Aging Phys Act 16: 10.

[15] HUANG Q, WU M, WU X, ZANG Y & XIA Y. 2022. Muscle-to-tumor crosstalk: The effect of exercise-induced myokine on cancer progression. Biochim Biophys Acta Ver Cancer 1877(5): 188761.

[16] HUANG X, LI M, ZHOU D, DENG Z, GUO J & HUANG H. 2020. Endothelial progenitor cell transplantation restores vascular injury in mice after whole-brain irradiation. Brain Res 1746: 147005.

[17] JI JF, JI SJ, SUN R, ZHANG LY & TIAN Y. 2014. Forced running exercise attenuates hippocampal neurogenesis impairment and the neurocognitive deficits induced by whole- brain irradiation via the BDNF-mediated pathway. Biochem Biophys Res Commun 443(3): 646-651.

[18] KATSURA M, SATO J, AKAHANE M, FURUTA T, MORI H & ABE O. 2021. Recognizing Radiation-induced Changes in the Central Nervous System: Where to Look and What to Look For. Radiographics 41(1): 224-248.

[19] KELLY CM & SHAHROKNI A. 2016. Moving beyond Karnofsky and ECOG performance status assessments with new technologies. J Oncol 2016: 6186543. doi: 10.1155/2016/6186543.

[20] KIM H ET AL. 2004. Upregulation of VEGF and FGF2 in Normal Rat Brain after Experimental Intraoperative Radiation Therapy. J Korean Med Sci 19(6): 879-886.

[21] KOKA K, VERMA A, DWARAKANATH BS & PAPINENI RVL. 2022. Technological Advancements in External Beam Radiation Therapy (EBRT): An Indispensable Tool for Cancer Treatment. Cancer Manag Res 14: 1421-1429.

[22] LEARDINI-TRISTÃO M, BORGES JP, FREITAS F, RANGEL R, DALIRY A, TIBIRIÇÁ E & ESTATO V. 2017. The impact of early aerobic exercise on brain microvascular alterations induced by cerebral hypoperfusion. Brain Res 1657: 43-51.

[23] LEE WH, CHO HJ, SONNTAG WE & LEE YW. 2012. Whole Brain Radiation-Induced Cognitive Impairment: Pathophysiological Mechanisms and Therapeutic Targets. Biomol Ther 20(4): 357-370.

[24] LUMNICZKY K, SZATMÁRI T & SÁFRÁNY G. 2017. Ionizing Radiation-induced imune and inflamatory reactions in the brain. Front Immunol 5(8): 517.

[25] MA C, ZHOU J, XU X, WANG L, QIN S, HU C, NIE L & TU Y. 2019. The Construction of a Radiation-Induced Brain Injury Model and Preliminary Study on the Effect of Human Recombinant Endostatin in Treating Radiation-Induced Brain Injury. Med Sci Monit 25: 9392-9401.

[26] MAKALE MT, MCDONALD CR, HATTANGADI-GLUTH JA & KESARI S. 2017. Mechanisms of radiotherapy-associated cognitive disability in patients with brain tumours. Nat Rev Neurol 13(1): 52-64.

[27] MARINO S, SCIARTILLI A, VALERIO V, BALDASSARRE A & GALLINA S. 2009. The effect of physical exercise on endothelial function. Sports Med 39: 797-812.

[28] MUÑOZ A, CORRÊA CL, LOPEZ-LOPEZ A, COSTA-BESADA MA, DIAZ-RUIZ C, LABANDEIRA-GARCIA JL & GERONTOL A. 2018. Physical Exercise Improves Aging-Related Changes in Angiotensin, IGF-1, SIRT1, SIRT3, and VEGF in the Substantia Nigra. Biol Sci Med Sci 73(12): 1594-1601.

[29] NAGANE M, KUPPUSAMY ML, AN J, MAST J, GOGNA R, HIRONOBU Y, YAMAMORI T, INANAMI O & KUPPUSAMY P. 2018. Ataxia-Telangiectasia Mutated (ATM) Kinase Regulates eNOS Expression and Modulates Radiosensitivity in Endothelial Cells Exposed to Ionizing Radiation. Radiat Res 189(5): 519-528.

[30] NAYLOR AS, BULL C, NILSSON MKL, ZHU C, BJÖRK-ERIKSSON T, ERIKSSON PS, BLOMGREN K & KUHN HG. 2008. Voluntary running rescues adult hippocampal neurogenesis after irradiation of the young mouse brain. Proc Natl Acad Sci 105(38): 14632.

[31] NIEMAN D & WENTZ L. 2019. The compelling link between physical activity and the body’s defense system. J Sport Health Sci 8: 201-217.

[32] PAHLAVANI HA. 2023. Exercise therapy to prevent and treat Alzheimer’s disease. Front Aging Neurosci 15: 1243869.

[33] PAPALIA WL, NASCIMENTO AS, KRISHNA G, BROETTO N, FURIAN AF, OLIVEIRA MS, ROYES LFF & FIGHERA MR. 2022. Physical Exercise as a Modulator of Vascular Pathology and Thrombin Generation to Improve Outcomes After Traumatic Brain Injury. Neurobiol 59(2): 1124-1138.

[34] PH W ET AL. 2012. Radiation induces acute alterations in neuronal function. Plos One 7: 37677.

[35] PRUT L & BELZUNG C. 2003. The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: a review. Eur J Pharmacol 463(1-3): 3-33.

[36] QIU Y, FERNÁNDEZ-GARCIA B, LEHMANN H L, LI G, KROEMER G, LÓPEZ-OTIN C & XIAO J. 2023. Exercise sustains the hallmarks of health. J Sport Health Sci 12(1): 8-35.

[37] RÜBE CE, RAID S, PALM J & RÜBE C. 2023. Radiation-Induced brain injury: Age dependency of neurocognitive dysfunction following radiotherapy. Cancers 15: 2999.

[38] RUNCO DV, YOON L, GROSS SA & WONG CK. 2019. Nutrition & Exercise Interventions in Pediatric Patients with Brain Tumors: A Narrative Review. J Natl Cancer Inst Monogr 54: 163-168.

[39] SANDLER SX, MATSUYAMA M, JONES TJ, BASHFORD J, LANGBECKER D & HAYES SC. 2021. Physical activity and exercise in adults diagnosed with primary brain cancer: a systematic review. J Neurooncol 53(1): 1-14.

[40] SHIBUYA M. 2011. Vascular Growth Factor (VEGF) and Its Receptor (VEGFR) Signaling in Angiogenesis. Genes Cancer 2: 1097-1105.

[41] SPYCHKA RA, PURDY GM, EASAW JC, LITTLETON R, MURTHA AD, DRIGA A, CULOS-REED SN & MCNEELY ML. 2020. Feasibility of performance-based functional assessment in brain tumour survivors. Eur J Cancer Care 29(4): 13238.

[42] STONE HB, COLEMAN CN, ANSCHER MS & MCBRIDE WH. 2003. Effect of radiadion on normal tissue: consequences and mecganisms. The Lan Onc 4: 529-536.

[43] SUN L, ZHUANG LP & WU WF. 2019. Aerobic exercise repairs neurological function after cerebral ischaemia by regulating the nitric oxide. An Acad Bras Cienc 91: e20190068. https://doi.org/10.1590/0001-3765201920190068.
» https://doi.org/10.1590/0001-3765201920190068

[44] TANTILLO E, COLISTRA A, BARONCELLI L, COSTA M, CALEO M & VANNINI E. 2020. Voluntary Physical Exercise Reduces Motor Dysfunction and Hampers Tumor Cell Proliferation in a Mouse Model of Glioma. Int J Environ Res Public Health 17(16): 5667.

[45] THOMAS R ET AL. 2023. Plasma von Willebrand Factor Is Elevated Hyperacutely After Mild Traumatic Brain Injury. Neurotrauma Rep 4(1): 655-662.

[46] VALENZUELA PL, CASTILLO-GARCIA A, MORALES JS, VILLA PD, HAMPEL H, EMANUELE E, LISTA S & LUCIA A. 2020. Exercise benefits on Alzheimer’s disease: State-of-the-science. Ageing Res Rev 62: 101-108.

[47] XU J, HE J, ZHOU Y, WENG Z, LI M, WANG ZX & HE Y. 2024. Von Willebrand factor promotes radiation-induced intestinal injury (RIII) development and its cleavage enzyme rhADAMTS13 protects against RIII by reducing inflammation and oxidative stress. Free Radic Biol Med 210: 1-12.

[48] XU X, FU Z & LE W. 2019. Exercise and Parkinson’s disease. Int Ver Neurobiol 147: 45-74.

[49] WARRINGTON JP, ASHPOLE N, CSISZAR A, LEE YW, UNGYARI Z & SONNTAG WE. 2013. Whole Brain Radiation-Induced Vascular Cognitive Impairment: Mechanisms and Implications. J Vas Res 50(6): 445-457.

[50] WHITELAW BS, TANNY S, JOHNSTON CJ, MAJEWSKA AK, O’BANION MK & MARPLES B. 2021. In Vivo Imaging of the Microglial Landscape After Whole Brain Radiation Therapy. Int J Radiat Oncol Phys 111(4): 1066-1071.

[51] WIJERATHNE H, LANGSTON JC, YANG Q, SUN S, MIYAMOTO C, KILPATRICK LE & KIANI MF. 2021. Mechanisms of radiation-induced endothelium damage: Emerging models and Technologies. Radiother Oncol 158: 21-32.

[52] WITZMANN K, RASKCHE F & TOOST EGC. 2021. MR Image Changes of Normal-Appearing Brain Tissue after Radiotherapy. Cancers 13: 1573.

[53] WONG-GOODRICH SJE, PFAU ML, FLORES CT, FRASER JA, WILLIAMS CL & JONES LW. 2010. Voluntary running prevents progressive memory decline and increases adult hippocampal neurogenesis and growth factor expression after whole-brain irradiation. Cancer Res 70(22): 9329-9338.

[54] ZANG J, LI J, ZHU Y, MIAO Z & TIAN Y. 2020. Forced running exercise mitigates radiation-induced cognitive deficits via regulated DNA hydroxymethylation. Epigenomics 12(5): 385-396.

[55] ZHANG H ET AL. 2020. Implication of MicroRNA503 in Brain Endothelial Cell Function and Ischemic Stroke. Transl Stroke Res 11(5): 1148-1164.

[56] ZHANG XX, TIAN Y, WANG ZT, MA YH, TAN L & YU JT. 2021. The Epidemiology of Alzheimer’s Disease Modifiable Risk Factors and Prevention. Prev Alzheimers Dis 8(3): 313-321.

Experimental conditions	EC (MET)	EC (60% of MET)	EI (MET)	EI (60% of MET)
90 Days Post	28 + 3.5	16.8	28 + 2.5	16.8
30 Days Post	28 + 2.8	16.8	28 + 3.7	16.8
30 Days Prior	28 + 3.4	16.8	28 + 3.4	16.8