Identification of Eimeria spp. on Commercial Broiler Chicken Farms in the Western Region of the State of Santa Catarina, Brazil, Using Next-Generation Sequencing

ABSTRACT

This study aimed to determine the prevalence of Eimeria spp., including the recently described Eimeria species Eimeria lata, Eimeria nagambie, and Eimeria zaria, on commercial broiler chicken farms (CBCFs) in the western region of the state of Santa Catarina, and to correlate their prevalence with the anticoccidial programs. Ninety-six fecal samples corresponding to 96 commercial broiler farms were examined by microscopic screening and genus-specific PCR (ITS-1 gene). All positive samples were subjected to genus-specific nested PCR (18S rRNA gene), followed by next-generation sequencing to identify the Eimeria species, and new Eimeria operational taxonomic units. Eimeria spp. were identified in 80.2% (77/96) of the samples. Next-generation sequencing revealed the following order of prevalence: Eimeria acervulina (70/77; 90.9%), Eimeria maxima (65/77; 84.4%), Eimeria mitis/mivati (17/77; 22.1%), and Eimeria praecox (37/77; 48.1%). Eimeria spp. were identified on 100% (62/62) and 44% (15/34) of the CBCFs employing treatment with salinomycin and nicarbazin, respectively. In conclusion, we observed a greater prevalence of Eimeria acervulina and Eimeria maxima; a lower prevalence of Eimeria mitis and Eimeria praecox; and the absence of Eimeria brunetti, Eimeria lata, Eimeria nagambie, Eimeria necatrix/tenella, and Eimeria zaria. There was lower positivity for Eimeria spp. on CBCFs employing treatment with nicarbazin.

Keywords:
Coccidiosis; Poultry; Molecular diagnosis; Next-generation sequencing

INTRODUCTION

Coccidiosis is a protozoan infection caused by Eimeria spp. that is one of the most economically important diseases in the poultry industry (Williams, 1999). Blake et al. (2020) analyzed data from Brazil, Egypt, Guatemala, India, Nigeria, New Zealand, and the United States and estimated that the annual global economic cost of coccidiosis in chickens was ~ £10.4 billion at 2016 prices.

Seven species of Eimeria infect domestic chickens: Eimeria acervulina, Eimeria brunetti, Eimeria mitis, Eimeria maxima, Eimeria necatrix, Eimeria praecox, and Eimeria tenella (Vrba et al., 2010; Vrba et al., 2011). Moreover, the following three species were proposed by Blake et al. (2021a): Eimeria lata, Eimeria nagambie, and Eimeria zaria, for the previously described cryptic operational taxonomic units (OTUs) x, y and z, respectively (Morris et al., 2007; Cantacessi et al., 2008).

Infections by Eimeria spp. result in a shortening of the intestinal villi, decreased nutrient absorption, increased intestinal permeability, and loss of fluids and electrolytes. Furthermore, infection by highly pathogenic species such as E. brunetti, E. necatrix and E. tenella results in severe lesions in the intestinal mucosa, with the presence of hemorrhage and increased mortality (Mesa-Pineda et al., 2021). Regarding the new species described by Blake et al. (2021a), the available information reveals no cross-protection against infection caused by them with the use of available commercial vaccines, and that infections by E. lata, E. nagambie, and E. zaria cause interference in productive parameters (Fornace et al., 2013; Blake et al., 2021a). In addition, infections caused by OUTs x and y have been associated with mortality in broiler breeder flocks (Morris et al., 2007).

Vaccines against eimeriosis are mainly used in long-lived birds. Although anticoccidial drugs are still predominant in coccidiosis prophylaxis in broiler chickens, there is a growing demand for drug-free production systems, which may eventually result in the replacement of the use of anticoccidial drugs with vaccination (Blake et al., 2021b). The immune response induced by natural Eimeria spp. infections is species-specific, meaning that there is no cross-protection after a challenge with a heterologous species (McDonald & Shirley, 2009). Therefore, to prevent eimeriosis through vaccination, it is essential to know the species of Eimeria present in the different regions and breeder types.

Despite the economic relevance of the commercial poultry industry in Brazil, there are few studies on the epidemiology of coccidiosis on broiler farms, particularly with the use of diagnostic techniques that detect and differentiate the species and potential new operational taxonomic units (OTUs) of Eimeria. The species previously identified on commercial broiler chicken farms (CBCFs) in Brazil (McDougald et al., 1987; Carvalho et al., 2011; Moraes et al., 2015; Balestrin et al., 2021; Santiani et al., 2023) have already been identified in studies carried out in other countries, with greater frequencies of E. acervulina, E. maxima, and E. tenella (Györke et al., 2013; Mesa et al., 2021; Andreopoulou et al., 2022; Cevallos-Gordon et al., 2023).

It is undeniable that there is a need to study the prevalence rates of the three newly proposed Eimeria species and new OTUs, and to obtain up-to-date information on the prevalence of the seven recognized Eimeria species in Brazilian CBCFs. Therefore, this study aimed to determine the prevalence of Eimeria spp., including the recently identified Eimeria species (E. lata, E. nagambie and E. zaria) and new Eimeria OTUs, in CBCFs in the western region of the state of Santa Catarina, Brazil, and to correlate their prevalence with the anticoccidial programs used in each CBCF.

MATERIALS AND METHODS

Fecal samples collection

This study was approved by the Ethics Committee on Animal Use (CEUA) of São Paulo State University (UNESP), School of Veterinary Medicine, in Araçatuba, SP, under Process FOA 0778-2021.

Fecal samples were collected from 96 CBCFs, which correspond to a physical poultry production unit composed of one or more flocks of broilers of the same species and age (Brasil, 2017), located in the municipalities of Abelardo Luz, Chapecó, Modelo, Pinhalzinho, São Lourenço do Oeste, Seara, Xanxerê, and Xaxim in the western region of the state of Santa Catarina, Brazil (Figure 1).

Broilers originated from flocks of varying sizes, with concrete floors and an average of 30,000 housed birds. The litter used in the flocks was mostly composed of wood shavings, and was reused three to eight times. Broiler houses were subjected to an average of 15 days of downtime between flocks after cleaning and disinfection. Salinomycin (warmer seasons) or nicarbazin (colder seasons) was used as an anticoccidial drug until 32 days of age. The chickens had never been vaccinated against coccidiosis.

Figure 1
Locations of the municipalities in the western region of Santa Catarina state, Brazil, where chicken feces samples were collected from commercial broiler chicken farms.

Sample sizes were determined according to the procedures described for different cases by Sergeant (2018). The number of CBCFs to be surveyed was determined following the description present under “Sample size to estimate a proportion or apparent prevalence with specified precision” (Sergeant, 2018). Although Eimeria spp. infection is present in almost all commercial broiler flocks in several countries (Györke et al., 2013; Mesa et al., 2021; Andreopoulou et al., 2022; Cevallos-Gordon et al., 2023), including Brazil (Carvalho et al., 2011; Moraes et al., 2015), since there are no data on the prevalence of E. lata, E. nagambie and E. zaria, and there is only partial information on the prevalence of each of the other species of Eimeria in the region surveyed, the expected prevalence rate of Eimeria spp. was 50%, which is used when it is not possible to estimate the prevalence rate (Lwanga & Lemeshow, 1991). The other criteria used were the number of CBCFs registered by the Integrated Company for Agricultural Development of Santa Catarina in the western region of the state of Santa Catarina (4,857) (CIDASC, 2021), a margin of error of 10%, and a confidence level of 95%. Thus, a minimum number of 96 CBCFs was defined. Given that the distance between the flocks on each CBCF is approximately 10-15 m, that each CBCF contained an average of two flocks, and that the birds housed in the different flocks are of the same age and origin, and are subjected to the same nutritional and sanitary management, it is very likely that the species present in all the flocks of each CBCF are the same; for these reasons, fecal samples were collected from one flock per CBCF.

After defining the minimum number of CBCFs and flocks per CBCF, a calculation was performed to determine the number of samples per flock in order to detect the presence of Eimeria spp. using the procedures described under “sample size to demonstrate freedom using pooled testing” and “sample size for varying prevalence and pool size” (Sergeant, 2018). To perform this calculation, it is necessary to determine the expected prevalence rate, the sensitivity rate of the diagnostic test, and the confidence level. Even considering that the peak of Eimeria spp. oocyst shedding in flocks medicated with anticoccidials occurs between 21 and 35 days of age (Snyder et al., 2021), which is the period of sample collection in this study, it is not possible to accurately determine the expected prevalence rate of each Eimeria species in broiler flocks. For this reason, to increase the reliability of the sampling method, we used an expected prevalence rate of 10%, a diagnostic test sensitivity rate of 70% and a confidence level of 95%.

Samples were collected in 2020 and 2021 from 21-35 day-old-birds, by walking through the entire house in a W-shaped path. They were subsequently preserved in 2.5% potassium bichromate solution at 4 ºC for approximately one to two months after collection. Five fecal pools were collected in each CBCF, each containing fresh droppings from 10 chickens, including cecal droppings. Each fecal pool was processed separately and the sediments resulting from the purification process were pooled into a single sample. Thus, the purification and concentration of oocysts resulted in one sample per CBCF, totaling 96 samples, each corresponding to one CBCF.

Fecal samples processing

Fecal pools were homogenized with 0.1% deionized water/Tween 20%, strained through a metal sieve with a porosity of 600 μm, and centrifuged at 2,000 × g for 10 min, followed by purification and concentration of oocysts by centrifugal flotation in Sheather’s solution. The pooled sediment resulting from the processing of the five pools was divided into two aliquots: one of 150 mg, which was frozen at -20 ºC for genomic DNA extraction, and another, which was stored in 2.5% potassium bichromate at 4 ºC for microscopic examination. Due to logistical limitations, it was not possible to induce sporulation in the oocysts.

Microscopic screening for Eimeria spp. oocysts

The pooled sediments resulting from the purification process were subjected to the screening of Eimeria spp. oocysts by microscopy. Results of oocysts shedding were scored using a 20X objective as follows: 0+: negative; 1+: 1 to 20 oocysts per slide; 2+: 21 to 50 oocysts per slide; 3+: more than 1 oocyst per field; and 4+: more than 10 oocysts per field.

Genomic DNA extraction

For all samples, genomic DNA was extracted from 150 mg of the sediment resulting from the purification process using the GenElute™ Stool DNA Isolation Kit (Sigma Aldrich), according to the manufacturer’s protocol. DNA samples were stored at -20 ºC.

Screening for Eimeria spp. by genus-specific PCR

The samples determined to be negative by microscopy were screened for Eimeria spp. by genus-specific ITS-1 gene-targeted PCR using primers EF1 and ER1 (Lew et al., 2003) (Table 1), and Jumpstart™ Taq ReadyMix (Sigma Aldrich) in a SimpliAmp™ thermal cycler (Thermo Fisher Scientific), under the following conditions: initial denaturation of DNA at 94 °C for 2 minutes, followed by 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 55 °C for 30 seconds and extension at 72 °C for 1 minute, with a final extension cycle at 72 °C for 7 minutes. Genomic DNA from Eimeria spp. oocysts from the commercial Bio-Coccivet™ R (Bio-Rad) vaccine was used as a positive control. Ultrapure water was used as a negative control.

Table 1
Diagnostic protocols used to detect and identify Eimeria spp. in commercial broiler chicken farms.

Protocol	Primer	Primer sequence	Amplicon size (bp)	Eimeria species	Target gene	Reference
PCR	EF1	AAGTTGCGTAAATAGAGCCCTC	317-585	Eimeria spp.	ITS-1	Lew et al. (2003)
	ER1	AGACATCCATTGCTGAAAG
Nested PCR/NGS	18S-F-out	CGGGTAACGGGGAATTAGGG	538	Eimeria spp.	18S rRNA	Hauck et al. (2019)
	18S-R-out	TACGAATGCCCCCAACTGTC
	18S-F-in*	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGGAGGGCAAGTCTGGTG	260
	18S-R-in*	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGCTGCAGTATTCAGGGCRA

• *Sequences of the Illumina adapters are underlined.

Genus-specific PCR amplicons were visualized on a 1.5% agarose gel stained with GelRed™ (Biotium).

Nested PCR and next-generation sequen-cing for Eimeria spp. identification

Samples that were positive for Eimeria spp. according to microscopy or genus-specific PCR were subjected to nested PCR using genus-specific primers (Table 1) for the amplification of a partial fragment of the 18S rRNA subunit gene (18S rRNA), followed by next-generation sequencing (Hauck et al., 2019; Terra et al., 2021). The amplified region, ± 260 bp, contains a polymorphic region corresponding to the V4 region of the 18S rRNA gene, which allows the identification of the Eimeria species and new Eimeria OTUs, with the exception of the differentiation between E. necatrix and E. tenella.

The protocols used for nested PCR and next-generation sequencing were the same as those used by Soares Júnior et al. (2023). PCR protocols were performed using Jumpstart™ Taq ReadyMix (Sigma Aldrich), under the following conditions: preparation of 25μL of a solution containing 12.5 μL of Jumpstart™ Taq ReadyMix (Sigma Aldrich), 400 nM (PCR) or 800 nM (nested PCR) of each primer, and 2.5 μL (PCR) or 1 μL (nested PCR) of target DNA. Samples were subjected to initial denaturation for 2 min at 94º C followed by 35 cycles of denaturation at 94º C for 30 s, annealing at 60º C for 30 s, and extension at 72º C for 30 s, followed by a final cycle at 72º C for 7 min, using a SimpliAmp™ thermal cycler (Thermo Fisher Scientific). Genomic DNA extracted from oocysts from the commercial vaccine Bio-Coccivet R (Biorad) and ultrapure water were used as positive and negative controls, respectively. Nested PCR amplicons were visualized by agarose gel electrophoresis, purified with a ProNex™ Size-Selective Purification System (Promega), and quantified using a Qubit™ digital fluorimeter (Thermo Fisher Scientific).

Samples were processed according to the Illumina 16S metagenomic protocol (Illumina, 2013), with 150 bp paired-end reads, using a MiSeq™ Reagent kit v2 (Illumina). Libraries were prepared using 1 µl of the nested PCR amplicon, regardless of the quantification result. Amplification reactions were performed using a volume of 50 µl containing 5 µl of Nextera XT™ index primer 1 (N7xx), 5 µl of Nextera XT™ index primer 2 (S5xx), 25 µl of Kapa™ Hot Start High Fidelity Ready Mix (Kapa Biosystems), and 14 µl of ultrapure water. Samples were denatured at 95º C for 3 min, followed by 8 cycles of denaturation at 95º C for 30 s, annealing at 55º C for 30 s, and extension at 72º C for 30 s, with a final extension cycle at 72°C for 5 min.

Libraries were purified with a ProNex™ Size-Selective Purification System (Promega), quantified using a Qubit™ digital fluorimeter (Thermo Fisher Scientific), and normalized to a final DNA concentration of 8 pM. PhiX control library was spiked at a concentration of 15%.

Library sequencing was carried out at the Laboratory of Epigenomics of the Faculdade de Medicina Veterinária, UNESP Campus Araçatuba, in a MiSeq™ sequencer (Illumina). Adapter sequences were trimmed according to Illumina FASTQ file generation pipelines included in the Illumina Experimental Manager software. Sequences were analyzed using MetaAmp Version 3.0 - OTU based amplicon analysis (Dong et al., 2017). Further analyses to detect chimeras were performed in OTUs originating from MetaAmp analyses using the chimera.uchime algorithm (Edgar et al., 2011) available on the Galaxy platform (The Galaxy Community, 2022).

Statistical analysis

Prevalence rates with 95% confidence intervals were calculated using Wilson (score) intervals (Sergeant, 2018).

Results of the anticoccidial drugs administered in relation to the positivity for Eimeria spp. and scores of fecal oocysts shedding were analyzed using Fisher’s exact test and the non-parametric Kruskal-Wallis test, respectively. The data were tabulated and processed using the Jamovi software (The Jamovi Project, 2023).

RESULTS AND DISCUSSION

Microscopic screening revealed that the prevalence of Eimeria spp. was 70.8% (68/96; CI: 61.1-79). Genus-specific PCR performed on negative samples according to microscopy resulted in 31% (9/28; CI: 17.9-50.7) positivity. According to the results of microscopic examination and genus-specific PCR, the prevalence of Eimeria spp. was 80.2% (77/96; CI: 71.1-87) (Table 2). Eimeria spp. prevalence rates above 90% have been reported in broiler chickens in the state of Santa Catarina by Moraes et al. (2015) (96%; 241/251) and Balestrin et al. (2021) (90.6%; 58/64). Moreover, McDougald et al. (1987) reported a prevalence rate of 98.9% (89/90) in broiler flocks from the Federal District, 13 Brazilian states, and Argentina.

Table 2
Detection of Eimeria spp. by microscopy or genus-specific PCR in commercial broiler chicken farms employing treatment with salinomycin or nicarbazin.

Municipality	Anticoccidial drug	Microscopy No. positive/No. sampled* (% positive)	Score of oocyst shedding** (No. samples)	Genera-specific PCR No. positive/No. sampled (% positive)	Total positive by microscopy and PCR No. positive/No. sampled (% positive)
Abelardo Luz	Salinomycin	7/7 (100)	1+ (2); 2+ (4); 3+ (1)	-	7/7 (100)
	Nicarbazin	8/8 (100)	1+ (8)	-	8/8 (100)
Chapecó	Salinomycin	18/18 (100)	1+ (2); 3+ (16)	-	18/18 (100)
Modelo	Nicarbazin	0/7 (0)	0+ (7)	2/7 (28.6)	2/7 (28.6)
Pinhalzinho	Nicarbazin	1/10 (10)	0+ (9); 1+ (1)	2/9 (25)	3/10 (30)
São Lourenço do Oeste	Nicarbazin	0/9 (0)	0+ (9)	2/9 (22.2)	2/9 (22.2)
Seara	Salinomycin	20/23 (87)	0+ (3); 1+ (8); 2+ (1); 3+ (8)	3/3 (100)	23/23 (100)
Xanxerê	Salinomycin	10/10 (100)	1+ (4); 3+ (6)	-	10/10 (100)
Xaxim	Salinomycin	4/4 (100)	1+ (2); 3+ (2)	-	4/4 (100)
Total	Salinomycin	59/62 (95.2)	0+ (3); 1+ (18); 2+ (5); 3+ (33)a	3/3 (100)	62/62 (100%)c
	Nicarbazin	9/34 (26.8)	0+ (25); 1+ (9)b	6/25 (24)	15/34 (44.1)d
	Salinomycin + Nicarbazin	68/96 (70.8)	0+ (28); 1+ (27); 2+ (5); 3+ (33)	9/28 (32.1)	77/96 (80.2)

• *Each sample is composed of a pool of samples from a commercial broiler chicken farm.
• **Oocyst shedding results were scored using a 20X objective as follows: 0+ (negative); 1+: 1-20 oocysts per slide; 2+: 21-50 oocysts per slide; 3+: more than one oocyst in per field.
• Different letters in the same column indicate a statistically significant difference (p<0.001) using the Kruskal-Wallis test ^(ab) and the Fisher’s exact test ^(cd).

It is not possible to determine the reasons for the lower positivity rate found in this study compared to previous studies conducted in Brazil (McDougald et al., 1987; Moraes et al., 2015; Balestrin et al., 2021). However, there was a statistically significant difference (p<0.001) in the prevalence of Eimeria spp. between CBCFs employing treatment with nicarbazin (15/34; 44.1%) and salinomycin (62/62; 100%), respectively. Moreover, flocks employing treatment with nicarbazin showed decreased shedding of Eimeria oocysts (Table 2). Even if these data suggest that the administration of nicarbazin is the cause of the lower oocyst shedding and lower prevalence rates, they should be interpreted with caution, as lower oocyst shedding does not necessarily imply better control of coccidiosis. Other variables such as feed conversion, weight gain, lesion score, and mortality rate should be analyzed to determine the efficacy of coccidiosis control methods (Kraieski et al., 2022). There is no information on which anticoccidials were used in the broiler flocks studied by Balestrin et al. (2021). Broilers from flocks surveyed by Moraes et al. (2015) were treated with ionophore anticoccidials. The shedding of Eimeria oocysts is related not only to the anticoccidial program, but also to several other factors, including the development of immunity against the different species of Eimeria and to several environmental and management factors (Chapman, 1999; Attree et al., 2021). The use of nicarbazin in the surveyed NCFCs is restricted to the colder months of the year, when a lower prevalence of coccidiosis is expected due to the lower rate of oocyst sporulation at lower temperatures (Graat et al., 1994). However, there are contradictory results regarding the prevalence of coccidiosis in different climatic seasons in different countries (Razmi & Kalideri, 2000; Awais et al., 2012; Ahad et al., 2014; Rashid et al., 2019), including Brazil (Gazoni et al., 2024). Furthermore, even though the CBCFs in this study belong to the same integrating company, there are variations in the management techniques and climatic conditions where each CBCF is located.

The prevalence rates and species-specific identification results obtained by next-generation sequencing are shown in Table 3. All sequences had 100% genetic similarity with Eimeria spp. sequences published in GenBank and previously identified in Brazil (Soares Júnior et al., 2023). In order of prevalence, the following species were identified: E. acervulina (70/77; 90.9%), E. maxima (65/77; 84.4%), E. praecox (37/77; 48.1%), and E. mitis/mivati (17/77; 22.1%). All the samples were negative for E. brunetti, E. lata, E. nagambie, E. necatrix/tenella, and E. zaria. Monoinfections and multiple infections with different species of Eimeria were identified on 10/77 (12.9%) and 67/77 (87%) of the CBCFs, respectively (Table 4).

Table 3
Identification of Eimeria spp. on commercial broiler chicken farms using nested PCR targeting the 18S rRNA gene and next-generation sequencing (Hauck et al., 2019).

Eimeria species (No. positive/No. sampled; % positive)	Genetic similarity to sequences published in the GenBank database
	Eimeria species (number of sequences amplified by NGS)	Accession numbers	Geographic origin	%
E. acervulina (70/77; 90.9)	E. acervulina (145,901)	OR226405	Brazil	100 100
		FJ236372	United States
E. maxima (65/77; 84.4)	E. maxima (131,970)	OR226412	Brazil	100
		FJ236357	United States	100
E. mitis (17/77; 22.1)	E. mitis (3,069)	OR226409	Brazil	100
		FR775303	Czech Republic	99.55
E. mivati (17/77; 22.1)	E mivati (8,129)	OR226406	Brazil	100
		FJ236375	United States	100
E. praecox (37/77; 48.1)	E. praecox (28,158)	OR226407	Brazil	100
		FJ236375	Canada	100

The prevalence rates of each Eimeria species in this study differ from those of other studies carried out in broiler flocks in the state of Santa Catarina. However, as expected, they reported higher prevalence rates for the most relevant species known to infect commercial broiler chickens: E. acervulina, E. maxima, and E. tenella (Mesa-Pineda et al., 2021). Moraes et al. (2015) identified the following species: E. maxima (160/251; 63.7%), E. acervulina (159/251; 63.3%), E. tenella (137/251; 54.6%), E. mitis (97/251; 38.6%), E. praecox (63/251; 25.1%), E. necatrix (61/251; 24.3%), and E. brunetti (33/251; 13.1%). Balestrin et al. (2021) identified E. acervulina (57/64; 89.1%), E. maxima (45/64; 70.3%), E. tenella (30/64; 46.9%), E. brunetti (3/64; 4.7%), and E. mitis (2/64; 3.1%). The most recent study identified E. tenella (7/32; 3.1%), E. maxima (6/32; 18.8%) and E. acervulina (1/32; 3.1%) (Santiani et al., 2023). The main difference among the three studies performed in the state of Santa Catarina and our results is that they identified the following Eimeria species that were absent in the samples from this study: E. brunetti (Moraes et al., 2015; Balestrin et al., 2021), E. necatrix (Moraes et al., 2015) and E. tenella (Moraes et al., 2015; Balestrin et al., 2021; Santiani et al., 2023). Moreover, E. praecox had a prevalence of 48.2% (37/77) in this study, and was absent in the samples surveyed by Balestrin et al. (2021).

Since the broiler flocks studied by Moraes et al. (2015), Balestrin et al. (2021) and Santiani et al. (2023) were not vaccinated against coccidiosis and originated from the same Brazilian state, the reasons for the differences in the prevalence rates of each Eimeria species compared to our results are not clear, although they may reflect variables related to diagnostic and sampling techniques, climatic conditions, facilities, management techniques, and anticoccidial programs.

All samples from our study were negative for E. lata, E. nagambie, and E. zaria. On commercial and alternative chicken farms, E. lata has already been detected in Australia (Morris et al., 2007; Godwin & Morgan, 2015), Ghana, Tanzania, Zambia, (Fornace et al., 2013), Nigeria (Jatau et al., 2016), the United States (Hauck et al., 2019), and Venezuela (Clark et al., 2016); E. nagambie has been described in Australia (Godwin & Morgan, 2015), Nigeria (Jatau et al., 2016), India (Hinsu et al., 2018), the United States (Hauck et al., 2019), and Romania (Coroian et al., 2024); and E. zaria has been identified in Australia (Morris et al., 2007; Godwin & Morgan, 2015), Ghana, Tanzania, Zambia (Fornace et al., 2013), India (Hinsu et al., 2018), Nigeria (Jatau et al., 2016), Venezuela (Clark et al., 2016), the United States (Hauck et al., 2019), and Romania (Coroian et al., 2024). In Brazil, there has been no identification of E. lata, and the only reports of E. nagambie and E. zaria in domestic chickens are from alternative chicken farms in the state of São Paulo (Soares Júnior et al., 2023).

In addition to the absence of the three new species proposed by Blake et al. (2021a), we did not find the 18S rRNA gene sequence of Eimeria sp. identified in 34.5% (29/84) of the samples from alternative domestic chicken farms in the state of São Paulo (Soares Júnior et al., 2023), which has 100% genetic similarity with the Eimeria sp. rhA-2020 sequence (MN073280) described in broiler chickens in the United States (Hauck et al., 2019).

Different aspects may have led to the absence of new species (Blake et al., 2021a) and new OTUs (Hauck et al., 2019) in the samples from commercial broiler chickens examined in this study vis-à-vis the results of birds from commercial and alternative farms in other countries and from birds from alternative farms in Brazil. It is not possible to ascertain whether this absence is due to the influence of the anticoccidial programs or to variables related to the facilities, management, environment, bird genetics, geographical location, or trade routes (Venkatas & Adeleke, 2019).

There is information regarding the occurrence of seven species of Eimeria in industrial domestic chicken farms in Brazil: E. acervulina, E. brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, and E. tenella (McDougald et al., 1987; Terra et al., 2001; Santos et al.; 2003; Meireles et al., 2004; Luchese et al., 2007; Carvalho et al., 2011; Moraes et al., 2015; Balestrin et al., 2021; Santiani et al., 2023). However, in these studies, the presence of the three species recently classified by Blake et al. (2021a) or the new Eimeria OTUS was not evaluated. Eimeria species can be identified by analyzing the morphology and morphometry of the oocysts, and macroscopic lesions (Long & Joyner, 1984; Castañón et al., 2007). However, these characteristics are subjective and can result in misdiagnosis, mainly because most infections are related to multiple species and, more recently, to three new species of Eimeria (Haug et al., 2008; Frölich et al., 2013; Blake et al., 2021a).

In this study, next-generation sequencing revealed the absence of the three new species proposed by Blake et al. (2021a) and new OTUs in samples from the western region of the state of Santa Catarina. However, considering that E. nagambie, E. zaria, and a new OTU have already been identified in Brazil on alternative chicken farms (Soares Júnior et al., 2023), additional studies should be carried out on CBCFs in Brazil aiming to screen for new species and OTUs of Eimeria.

Table 4
Identification of single or multiple infections by Eimeria spp. on commercial broiler chicken farms.

Eimeria species	No. broiler farms/No. sampled (% positive)
E. acervulina	6/77 (7.8)
E. maxima	3/77 (3.9)
E. praecox	1/77 (1.3)
E. acervulina + E. maxima	21/77 (27.3)
E. acervulina + E. praecox	5/77 (6.5)
E. maxima + E. praecox	3/77 (3.9)
E. acervulina + E. maxima + E. mitis/mivati	10/77 (12.9)
E. acervulina + E. maxima + E. praecox	21/77 (27.3)
E. acervulina + E. maxima + E. mitis/mivati + E. praecox	7/77 (9.1)
Total	77/77 (100%)

CONCLUSIONS

A higher prevalence of E. acervulina and E. maxima was observed in CBCFs in the western region of the state of Santa Catarina, as well as a lower prevalence of E. mitis and E. praecox, and the absence of E. brunetti, E. lata, E. nagambie, E. necatrix, E. tenella, and E. zaria. The commercial broiler chicken farms employing treatment with nicarbazin had lower prevalence rates and less shedding of Eimeria spp. oocysts.

ACKNOWLEDGMENTS

The authors thank the Coordination for the Improvement of Higher Education Personnel (CAPES), under Finance Code 001, for a Master of Science Scholarship granted to Beretta BMS. We also gratefully acknowledge the São Paulo Research Foundation (FAPESP) for the financial support (process no. 2021/10400-2) and for the undergraduate research scholarship granted to Itoyama BF (process no. 2021/09488-2). Finally, we thank Vaxxinova Biovet Brazil for its kind donation of the Bio-Coccivet R vaccine.

REFERENCES

• Ahad S, Habib K, Malik T. Seasonal impact on the prevalence of coccidian infection in broiler chicks across poultry farms in the Kashmir valley. Journal of Parasitic Diseases 2014;39(4):736-40. https://doi.org/10.1007/s12639-014-0434-6
  » https://doi.org/10.1007/s12639-014-0434-6
• Andreopoulou M, Chaligiannis I, Sotiraki S, et al. Prevalence and molecular detection of Eimeria species in different types of poultry in Greece and associated risk factors. Parasitology Research 2022;121:2051-63. https://doi.org/10.1007/s00436-022-07525-4
  » https://doi.org/10.1007/s00436-022-07525-4
• Attree E, Sanchez-Arsuaga G, Jones M, et al. Controlling the causative agents of coccidiosis in domestic chickens;an eye on the past and considerations for the future. CABI Agricultural and Bioscience 2021;2(1):37. https://doi.org/10.1186/s43170-021-00056-5
  » https://doi.org/10.1186/s43170-021-00056-5
• Awais MM, Akhtar, M, Iqbal Z, et al. Seasonal prevalence of coccidiosis in industrial broiler chickens in Faisalabad, Punjab, Pakistan. Tropical Animal Health and Production 2012;44(2):323-8. https://doi.org/10.1007/s11250-011-0024-x
  » https://doi.org/10.1007/s11250-011-0024-x
• Balestrin PWG, Balestrin E, Santiani F, et al. Prevalence of Eimeria sp. in broiler poultry houses with positive and negative pressure ventilation systems in Southern Brazil. Avian Diseases 2021;65(3):469-3. https://doi.org/10.1637/aviandiseases-D-21-00044
  » https://doi.org/10.1637/aviandiseases-D-21-00044
• Blake D, Knox J, Dehaeck B, et al. Re-calculating the cost of coccidiosis in chickens. Veterinary Research (Faisalabad) 2020;51(1):115. https://doi.org/10.1186/s13567-020-00837-2
  » https://doi.org/10.1186/s13567-020-00837-2
• Blake DP, Marugan-Hernandez V, Tomley FM. Spotlight on avian pathology:Eimeria and the disease coccidiosis. Avian Pathology 2021b;50(3):209-13. https://doi.org/10.1080/03079457.2021.1912288
  » https://doi.org/10.1080/03079457.2021.1912288
• Blake DP, Vrba V, Xia D, et al. Genetic and biological characterisation of three cryptic Eimeria operational taxonomic units that infect chickens (Gallus gallus domesticus). International Journal for Parasitology 2021a;51(8):621-34. https://doi.org/10.1016/j.ijpara.2020.12.004
  » https://doi.org/10.1016/j.ijpara.2020.12.004
• Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Procedimentos para registro, fiscalização e controle de estabelecimentos avícolas de reprodução, comerciais e de ensino ou pesquisa. Brasília (DF): Ministério da Saúde, Pecuária e Abastecimento; 2007. Available from: https://www.gov.br/agricultura/pt-br/assuntos/sanidade-animal-e-vegetal/saude-animal/programas-de-saude-animal/pnsa/imagens/copy3_of_INSTRUONORMATIVAN56DE4DEDEZEMBRODE2007.pdf
• Cantacessi, C., Riddell, S., Morris, et al. Genetic characterization of three unique operational taxonomic units of Eimeria from chickens in Australia based on nuclear spacer ribosomal DNA. Veterinary Parasitology 2008;152(3-4):226-34. https://doi.org/10.1016/j.vetpar.2007.12.028
  » https://doi.org/10.1016/j.vetpar.2007.12.028
• Carvalho FS, Wenceslau AA, Teixeira M, et al. Albuquerque GR. Diagnosis of Eimeria species using traditional and molecular methods in field studies. Veterinary Parasitology 2011;176(2-3): 95-100. https://doi.org/10.1016/j.vetpar.2010.11.015
  » https://doi.org/10.1016/j.vetpar.2010.11.015
• Castañón CAB, Fraga JS, Fernandez S, et al. Biological shape characterization for automatic image recognition and diagnosis of protozoan parasites of the genus Eimeria. Pattern Recognition 2007;40(7):1899-10. https://doi.org/10.1016/j.patcog.2006.12.006
  » https://doi.org/10.1016/j.patcog.2006.12.006
• Cevallos-Gordon A, Molina CA, Radman, N, et al. Prevalence and risk factors of Eimeria spp. in broiler chickens from Pichincha and Santo Domingo de Los Tsáchilas, Ecuador. Pathogens 2024;13(1):48. https://doi.org/10.3390/pathogens13010048
  » https://doi.org/10.3390/pathogens13010048
• Chapman HD. Anticoccidial drugs and their effects upon the development of immunity to Eimeria infections in poultry. Avian Pathology 1999;28(6):521-35. https://doi.org/10.1080/03079459994317
  » https://doi.org/10.1080/03079459994317
• CIDASC - Companhia Integrada de Desenvolvimento Agrícola de Santa Catarina. Consulta sobre o número de estabelecimentos avícolas de corte registrados na região oeste do estado de Santa Catarina. Florianópolis: CIDASC: 2021
• Clark EL, MacDonald SE, Thenmozhi V, et al. Cryptic Eimeria genotypes are common across the southern but not northern hemisphere. International Journal for Parasitology 2016;46:537-44. http://dx.doi.org/10.1016/j.ijpara.2016.05.006
  » http://dx.doi.org/10.1016/j.ijpara.2016.05.006
• Coroian M, Fábián-Ravasz TZ, Dobrin PR, et al. Occurrence of Eimeria spp. and intestinal helminths in free-range chickens from Northwest and Central Romania. Animals 2024;14:563. https://doi.org/10.3390/ani14040563
  » https://doi.org/10.3390/ani14040563
• Dong X, Kleiner M, Sharp CE, et al. Fast and simple analysis of MiSeq amplicon sequencing data with MetaAmp. Frontiers in Microbiology 2017;8:1461. http://dx.doi.org/10.3389/fmicb.2017.01461
  » http://dx.doi.org/10.3389/fmicb.2017.01461
• Edgar RC, Haas BJ, Clemente JC, et al. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011;27(16):2194-200. http://dx.doi.org/10.1093/bioinformatics/btr381
  » http://dx.doi.org/10.1093/bioinformatics/btr381
• Fatoba AJ, Adeleke MA. Diagnosis and control of chicken coccidiosis:a recent update. Journal of Parasitic Diseases 2018;42:483-93. https://doi.org/10.1007/s12639-018-1048-1
  » https://doi.org/10.1007/s12639-018-1048-1
• Fornace KM, Clark EL, MacDonald SE, et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS One 2013;8(12):e84254. http://dx.doi.org/10.1371/journal.pone.0084254
  » http://dx.doi.org/10.1371/journal.pone.0084254
• Frölich S, Farhat J, Wallach M. Designing strategies for the control of coccidiosis in chickens on poultry farms using modern diagnostic tools. Reports in Parasitology 2013;3:1-10. http://dx.doi.org/10.2147/RIP.S32811
  » http://dx.doi.org/10.2147/RIP.S32811
• Galaxy Community. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2022 update. Nucleic Acids Research 2022;50(W1):W345-W351. http://dx.doi.org/10.1093/nar/gkac247
  » http://dx.doi.org/10.1093/nar/gkac247
• Gazoni FL, Galli GM, Boiago MM, et al. Correlation between intestinal health and coccidiosis prevalence in broilers during different seasons of the year in Brazil from 2012 to 2018. Food and Nutrition Sciences 2024;15(3):179-98. https://doi.org/10.4236/fns.2024.153011
  » https://doi.org/10.4236/fns.2024.153011
• Godwin RM, Morgan JA. A molecular survey of Eimeria in chickens across Australia. Veterinary Parasitology 2015;214(1-2):16-21. http://dx.doi.org/10.1016/j.vetpar.2015.09.030
  » http://dx.doi.org/10.1016/j.vetpar.2015.09.030
• Györke A, Pop L, Cozma V. Prevalence and distribution of Eimeria species in broiler chicken farms of different capacities. Parasite 2013;20:50. https://doi.org/10.1051%2Fparasite%2F2013052
  » https://doi.org/10.1051%2Fparasite%2F2013052
• Hauck R, Carrisosa M, McCrea BA, et al. Evaluation of next-generation amplicon sequencing to identify Eimeria spp. of chickens. Avian Diseases 2019;63(4):577-83. http://dx.doi.org/10.1637/aviandiseases-D-19-00104
  » http://dx.doi.org/10.1637/aviandiseases-D-19-00104
• Haug A, Gjevre A, Thebo P, et al. Coccidial infections in commercial broilers:epidemiological aspects and comparison of Eimeria species identification by morphometric and polymerase chain reaction techniques. Avian Pathology 2008;37(2):161-70. https://doi.org/10.1080/03079450801915130
  » https://doi.org/10.1080/03079450801915130
• Hinsu AT, Thakkar JR, Koringa PG, et al. Illumina next generation sequencing for the analysis of Eimeria populations in commercial broilers and indigenous chickens. Frontiers in Veterinary Science 2018;5:176. http://dx.doi.org/10.3389/fvets.2018.00176
  » http://dx.doi.org/10.3389/fvets.2018.00176
• Illumina. 16S metagenomic sequencing library preparation. 2013 [cited 2023 Jul 11]. Available from: https://support.illumina.com/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf
  » https://support.illumina.com/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf
• Jamovi project. Jamovi. Version 2.4.14 [computer software]. 2023. Availabel from: https://www.jamovi.org
  » https://www.jamovi.org
• Jatau ID, Lawal IA, Kwaga JKP, et al. Three operational taxonomic units of Eimeria are common in Nigerian chickens and may undermine effective molecular diagnosis of coccidiosis. BMC Veterinary Research 2016;12:86. http://dx.doi.org/10.1186/s12917-016-0713-9
  » http://dx.doi.org/10.1186/s12917-016-0713-9
• Kraieski AL, Salles GBC, Muniz EC, et al. Sensitivity of field isolates of Eimeria acervulina and E. maxima from three regions in Brazil to eight anticoccidial drugs. Poultry Science 2021;100(8):101233. https://doi.org/10.1016/j.psj.2021.101233
  » https://doi.org/10.1016/j.psj.2021.101233
• Lew AE, Anderson GR, Minchin CM, et al. Inter- and intra-strain variation and PCR detection of the internal transcribed spacer 1 (ITS-1) sequences of Australian isolates of Eimeria species from chickens. Veterinary Parasitology 2003;112(1-2):33-50. http://dx.doi.org/10.1016/S0304-4017(02)00393-X
  » http://dx.doi.org/10.1016/S0304-4017(02)00393-X
• Long PL, Joyner LP. Problems in the identification of species of Eimeria. Journal of Protozoology 1984;31(4):535-41. https://doi.org/10.1111/j.1550-7408.1984.tb05498.x
  » https://doi.org/10.1111/j.1550-7408.1984.tb05498.x
• Luchese FC, Perin M, Aita RS, et al. Prevalência de espécies de Eimeria em frangos de criação industrial e alternativa. Brazilian Journal of Veterinary Research and Animal Science 2007;44(2):81-6. http://dx.doi.org/10.11606/issn.1678-4456.bjvras.2007.26645
  » http://dx.doi.org/10.11606/issn.1678-4456.bjvras.2007.26645
• Lwanga SK, Lemeshow S. Sample size determination in health studies: a practical manual. World Health Organization; 1991. Available from: https://iris.who.int/handle/10665/40062
  » https://iris.who.int/handle/10665/40062
• McDonald V., Shirley MW. Past and future: vaccination against Eimeria. Parasitology 2009;136(12):1477-89. https://doi.org/10.1017/s0031182009006349
  » https://doi.org/10.1017/s0031182009006349
• McDougald LR, Da Silva JM., Solis J, et al. A survey of sensitivity to anticoccidial drugs in 60 isolates of coccidia from broiler chickens in Brazil and Argentina. Avian Diseases 1987;31(2):287-92.
• Meireles MV, Roberto LO, Riera RF. Identification of Eimeria mitis and Eimeria praecox in broiler feces using polymerase chain reaction. Brazilian Journal of Poultry Science 2004;6(4):249-52. http://dx.doi.org/10.1590/S1516-635X2004000400010
  » http://dx.doi.org/10.1590/S1516-635X2004000400010
• Mesa C, Gómez-Osorio LM, López-Osorio S, et al. Survey of coccidia on commercial broiler farms in Colombia:frequency of Eimeria species, anticoccidial sensitivity, and histopathology. Poultry Science 2021;100(8):101239. https://doi.org/10.1016/j.psj.2021.101239
  » https://doi.org/10.1016/j.psj.2021.101239
• Mesa-Pineda C, Navarro-Ruíz L, López-Osorio S, et al. Chicken Coccidiosis:from the parasite life cycle to control of the disease. Frontiers in Veterinary Science 2021;(8):787653. https://doi.org/10.3389/fvets.2021.787653
  » https://doi.org/10.3389/fvets.2021.787653
• Moraes JC, França M, Sartor AA, et al. Prevalence of Eimeria spp. in broilers by multiplex PCR in the Southern Region of Brazil on two hundred and fifty farms. Avian Diseases 2015;59(2):277-81. http://dx.doi.org/10.1637/10989-112014-Reg
  » http://dx.doi.org/10.1637/10989-112014-Reg
• Morris GM, Woods WG, Richards DG, et al. Investigating a persistent coccidiosis problem on a commercial broiler-breeder farm utilising PCR-coupled capillary electrophoresis. Parasitology Research 2007;101(3):583-9. http://dx.doi.org/10.1007/s00436-007-0516-9
  » http://dx.doi.org/10.1007/s00436-007-0516-9
• Rashid M, Akbar H, Bakhsh A, et al. Assessing the prevalence and economic significance of coccidiosis individually and in combination with concurrent infections in Pakistani commercial poultry farms. Poultry Science 2019;98(3):1167-75. http://dx.doi.org/10.3382/ps/pey522
  » http://dx.doi.org/10.3382/ps/pey522
• Razmi GR, Kalideri, GA. Prevalence of subclinical coccidiosis in broiler-chicken farms in the municipality of Mashhad, Khorasan, Iran. Preventive Veterinary Medicine 2000;44(3-4):247-53. https://doi.org/10.1016/s0167-5877(00)00105-7
  » https://doi.org/10.1016/s0167-5877(00)00105-7
• Santiani F, Silva ROS, Oliveira Júnior CA, et al. Characterization of coccidiosis and evaluation of suggestive cases of subclinical necrotic enteritis in broilers. Pesquisa Veterinária Brasileira 2023;43:e07090. http://dx.doi.org/10.1590/1678-5150-PVB-7090
  » http://dx.doi.org/10.1590/1678-5150-PVB-7090
• Santos RFS, Kavavata GM, Almeida SM, et al. Ocorrência de Eimeria sp. em frangos de corte no estado de São Paulo. Ars Veterinaria 2003;19(3):230-4.
• Sergeant ESG. Epitools Epidemiological Calculators. Fremantle: Ausvet; 2018. Available from: http://epitools.ausvet.com.au.
• Snyder RP, Guerin MT, Hargis BM, et al. Monitoring coccidia in commercial broiler chicken flocks in Ontario:comparing oocyst cycling patterns in flocks using anticoccidial medications or live vaccination. Poultry Science 2021;100(1):110-8. https://doi.org/10.1016/j.psj.2020.09.072
  » https://doi.org/10.1016/j.psj.2020.09.072
• Soares Júnior JC, Itoyama BF, Beretta BMS, et al. Identification of Eimeria spp. in domestic chickens raised in alternative poultry production systems in the State of São Paulo, Brazil. Brazilian Journal of Veterinary Parasitology 2023;32(4):e011123. https://doi.org/10.1590/S1984-29612023075
  » https://doi.org/10.1590/S1984-29612023075
• Terra AT, Costa OS, Figueiredo PC, et al. Frequência de espécies do gênero Eimeria em frangos de corte abatidos industrialmente no município de Monte Alegre do Sul, Estado de São Paulo. Brazilian Journal of Veterinary Parasitology 2001;10(2):87-90, 2001.
• Terra MTB, Pacheco WJ, Harrison M, et al. A Survey of coccidia and nematodes in pastured poultry in the state of Georgia. Avian Diseases 2021;65:250-6. http://dx.doi.org/10.1637/aviandiseases-D-20-00120
  » http://dx.doi.org/10.1637/aviandiseases-D-20-00120
• Venkatas JL, Adeleke MA. Emerging threat of Eimeria operational taxonomic units (OTUs) on poultry production. Parasitology 2019;146(13):1615-9. http://dx.doi.org/10.1017/S0031182019001100
  » http://dx.doi.org/10.1017/S0031182019001100
• Vrba B., Blake DP, Poplstein M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Veterinary Parasitology 2010;174(3-4):183-90. https://doi.org/10.1016/j.vetpar.2010.09.006
  » https://doi.org/10.1016/j.vetpar.2010.09.006
• Vrba V, Poplstein M, Pakandl M. The discovery of the two types of small subunit ribosomal RNA gene in Eimeria mitis contests the existence of E. mivati as an independent species. Veterinary Parasitology 2011;183(1-2):47-53. http://dx.doi.org/10.1016/j.vetpar.2011.06.020
  » http://dx.doi.org/10.1016/j.vetpar.2011.06.020
• Williams RB. A compartmentalised model for the estimation of the cost of coccidiosis to the world's chicken production industry. International Journal for Parasitology 1999;29(8):1209-29. http://dx.doi.org/10.1016/S0020-7519(99)00086-7,
  » http://dx.doi.org/10.1016/S0020-7519(99)00086-7,

• Funding
  São Paulo Research Foundation (FAPESP): financial support (process no. 2021/10400-2) and an undergraduate research scholarship granted to Itoyama BF (process no. 2021/09488-2).
• Data availability statement
  Data from this manuscript will be available upon request.
• Disclaimer/Publisher’s Note
  The published papers’ statements, opinions, and data are those of the individual author(s) and contributor(s). The editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions, or products referred to in the content.
• This document has an erratum: https://doi.org/10.1590/1806-9061-2024-1936-ER

Data availability

Data from this manuscript will be available upon request.

Publication Dates

• Publication in this collection
  27 Sept 2024
• Date of issue
  2024

History

• Received
  08 Apr 2024
• Accepted
  19 July 2024
• Corrected
  03 Oct 2024