Dietary supplementation with Ocimum gratissimum essential oil improves the intestinal bacterial populations of Piaractus mesopotamicus

Óleo essencial de Ocimum gratissimum melhora a microbiota intestinal do Piaractus mesopotamicus

Abstract

The aim of this study was to evaluate the effects of the dietary supplementation Ocimum gratissimum essential oil (EO) on pacu (Piaractus mesopotamicus) intestinal microbiota and morphometry. In this study, juveniles of P. mesopotamicus were fed with diets supplemented with 0.5 and 1% of Ocimum gratissimum EO for 30 days. At the end of this period, the intestinal microbiota of the pacus was relatively quantified through qPCR, and the intestinal morphometry was evaluated using histometric methods. O. gratissimum EO feeding supplementation at 1% significantly altered the intestinal microbiota of juvenile pacus, resulting in higher relative quantification of bacteria from the genera Enterococcus and Bacillus when compared to 0.5% and control groups. O. gratissimum EO feeding supplementation presented no effects in intestinal morphometry. Our results suggest that the feeding supplementation of P. mesopotamicus with O. gratissimum at 1% concentration during 30 days modulates the intestinal bacterial populations but do not cause any changes in intestinal morphometry.

Keywords:
clove-basil essential oil; dietary additives; intestinal histomorphometry; intestinal microbioma; neotropical fish

Resumo

O objetivo deste estudo foi avaliar os efeitos da suplementação alimentar com óleo essencial de Ocimum gratissimum (EO) na microbiota intestinal do pacu (Piaractus mesopotamicus) e na morfometria intestinal do pacu. Neste estudo, juvenis de P. mesopotamicus foram alimentados com dietas suplementadas com 0,5 e 1% de EO de Ocimum gratissimum por 30 dias. Ao final deste período, a microbiota intestinal dos pacus foi quantificada relativamente por meio de qPCR, e a morfometria intestinal foi avaliada usando métodos histométricos. A alimentação com suplementação de 1% de EO de O. gratissimum alterou significativamente as populações bacterianas intestinais dos juvenis de pacu, resultando em uma maior quantificação relativa de bactérias dos gêneros Enterococcus e Bacillus quando comparado aos grupos de 0,5% e controle. A suplementação com EO de O. gratissimum não causou alterações na morfometria intestinal dos pacus. Nossos resultados sugerem que a alimentação de P. mesopotamicus com O. gratissimum na concentração de 1% durante 30 dias modula as populações bacterianas intestinais, mas não causa quaisquer alterações na morfometria intestinal.

Palavras-chave:
óleo essencial de manjericão-cravo; aditivos dietários; histomorphometria intestinal; microbioma intestinal; peixes Neotropicais

1. Introduction

Studies have shown the importance of intestinal microbiota modulation for the better productivity of fish (Nayak, 2010; Wang et al., 2018) and have reported the increased safety and beneficial effects of non-antibiotic dietary additives such as prebiotics (Ebrahimi et al., 2012; Munir et al., 2016), probiotics (Giri et al., 2013; Nguyen et al., 2017; Tan et al., 2019) and plant essential oils (EOs) (Zhang et al., 2020; Zheng et al., 2009) on growth improvement and animal health.

Plant EOs comprise a class of products extracted from plants widely used in the food, hygiene and pharmaceutical industries and have a wide variety of molecules with diverse chemical properties (Freitas Souza et al., 2019). Several studies have reported on the beneficial effects of plant EOs on aquaculture fish by acting as an immunostimulant, such as Cinnamomum verum and Zataria multiflora (Vaseeharan and Thaya 2014); preventing oxidative stress, such as Lippia alba (Saccol et al., 2013); and improving growth parameters, such as Origanum heracleoticum (Zheng et al., 2009). Moreover, some plant products, when administered through feeding, have presented bacterial selective effects and modulate the intestinal microbiota and intestinal morphology (Alagawany et al., 2020, Huyben et al., 2021, Zhang et al., 2020).

Ocimum gratissimum (also known as clove-basil) is a widely distributed herb in the tropical region and is commonly present in popular medicine as a treatment for different diseases in humans such as diarrhea, headache and pneumonia (Pessoa et al., 2002). Recently, our group investigated the effects of O. gratissimum EO on Pseudoplatystoma corruscans, an important species for neotropical aquaculture, and observed its excellent anesthetic performance (da Silva et al., 2020). However, other studies have shown that O. gratissimum can present other interesting effects for aquaculture such as antiparasitic and antibiotic effects (Bandeira Júnior et al., 2017; Lima Boijink et al., 2016), stress prevention (Boaventura et al., 2021), blood parameters improvements (Nahak and Kanta Sahu, 2014), faster wound healing (Abdel-Tawwab et al., 2019), higher survival after experimental infection (Brum et al., 2017; Monteiro et al., 2021) and better productive performance (Abdel-Tawwab et al., 2018).

Piaractus mesopotamicus (pacu) is an omnivorous fish that reproduces with a high prolificity (Valladão et al., 2018) and is a great experimental model for studies regarding neotropical fish species due to their close relation to other serrasalmidae species, a family that encloses almost one third of the Brazilian aquaculture production (FAO, 2022). Thus, the present study aimed to investigate if the dietary administration of O. gratissimum EO can positively affect the intestinal microbiota and intestinal morphology of P. mesopotamicus.

2. Material and Methods

2.1. Ethics

Research on animals was conducted under the approval of the Committee on Animal Use of the Estate University of Mato Grosso do Sul (n° 014/2013).

2.2. Fish and experimental conditions

The experiment was conducted at the city of Aquidauana, Mato Grosso do Sul, Brazil, 20° 28' 30” South and 55° 47' 11” West.

For this study, 144 P. mesopotamicus juveniles produced by induced reproduction were acclimated in polyethylene tanks (80 L) with continuous aeration in a flow-through system, with all the tanks receiving water from a dan located nearby the laboratory. Fish were fed a commercial feed (45% of crude protein) until apparent satiation and were reared until reaching a mean weight of 43 g (± 13 g) and mean total length of 13 cm (± 1.2 cm). Then, they were distributed in 12 80-L tanks of the same size and left to acclimate for two weeks under the same conditions.

During the experimental period, one-third of the water in each tank was exchanged daily by syphoning to remove feces. The parameters of water quality were measured daily and maintained at 6.2 ± 2 mg L^-1 of dissolved oxygen, a pH of 6.8 ± 0.52 and a temperature of 26.3 ± 1.36°C, all of which are considered adequate for P. mesopotamicus rearing.

2.3. Extraction and composition of O. gratissimum EO

The EO was obtained using the Clevenger apparatus by hydrodistillation, four 3 hours, of the extract of O. gratissimum leaves dried at room temperature. To analyze the EO composition it was used gas chromatography and mass spectrophotometry. Identification was made using the 6th edition of Wiley library, comparison with linear retention indices in the literature (Adams, 2007), interpolation of the retention times of the constituents with those from a series of n-alkanes (C7-C26) injected in the same column and conditions, and according to the equation of Van den Dool and Kratz (Vandendool and Kratz, 1963).

2.4. Experimental design

The tanks were randomly separated in three groups: one control and two treatments, with each group containing four tanks, and each tank containing 12 fish. The treatments consisted of two levels of inclusion of O. gratissimum EO: 0.5% and 1.0%, which were added to the commercial feed by aspersion. After the addition of EO, the feeds were left to dry and stored at -8°C until use. The control group was fed a commercial feed (32% of crude protein) without any addition of EO. The fish were fed until apparent satiation twice a day, and the remaining feed was removed after 15 min of administration, when necessary. The experiment was conducted for 30 days.

2.5. DNA extraction and relative quantification of intestinal bacteria through qPCR

After 30 days, two fish from each tank were euthanized using a eugenol solution (50 mg L^-1) and a 3-cm portion of the intestine was aseptically collected, measuring after 1 cm from the pyloric cecum. Then, the samples were conditioned in sterile Petri dishes and immersed in phosphate buffer saline (PBS, pH 7.4).

With a surgical blade, the intestine samples were longitudinally opened and placed in 15-mL polystyrene tubes containing 2 mL of PBS. The tubes were vigorously homogenized, the samples were discarded and the remaining solution was centrifuged at 16,000 G for 20 min for the obtention of bacterial pellets. This procedure was repeated to wash the pellets. After the washing, the supernatant was discarded, and the pellets were stored at -80°C for further DNA extraction.

The DNA extraction was performed using a KAOVI DNA extraction kit, according to the manufacturer’s protocol. Briefly, 100 mg of the pellet were dissolved in an extraction buffer and 20 μL of lysozyme lysis solution (50 mg mL^-1) was added to this solution. The tubes were homogenized and incubated at 37°C during 30 min. After this, 25 μL of proteinase-K (20 mg mL^-1) was added, and the solution was homogenized and incubated at 55°C for 30 min. The resultant solution was pipetted in a spin-filter column placed in a 2-mL polystyrene tube, and the column was washed by centrifugation. After this, the column was transferred to a new tube, and the DNA was eluted by the addition of 50 μL deionized water at 65°C. The DNA was quantified by spectrophotometry (NanoDrop), and its integrity was evaluated through electrophoresis in agaroses gel (0.8%). The obtained DNA was then stored at -80 °C for further use.

The quantification of microbiota was performed through the qPCR technique. For this, five pair of primers previously described in the literature were used. The first pair of primers corresponds to the Bacteria domain, and the subsequent pairs correspond to the groups Enterobacteria, Enterococcus, Lactobacillus and Bacillus (Table 1).

Table 1
Primers used for relative quantification of intestinal bacteria of P. mesopotamicus fed with O. gratissimum EO.

Bacterial group	Oligonucletide name	Sequency	References
Bacteria domain	DOMBAC-F	5’ – CGGYCCAGACTCCTACGGG – 3’	Lee et al. (1996)
	DOMBAC-R	5’ – TTACCGCGGCTGCTGGCAC – 3’
Enterobacteraceae	FamENTER-F	5’ – ATTGACGTTACCCGCAGAAGAAGC – 3’	Lunedo et al. (2019)
	FamENTER-R	5’ – CTCTACGAGACTCAAGCTTGC – 3’
Lactobacillus	LACTOBAC-F	5’ – CACCGCTACACATGGAG – 3’	Lunedo et al. (2019)
	LACTOBAC-R	5’ – AGCAGTAGGGAATCTTCCA – 3’
Enterococcus	ENTEROC-F	5’ – CCCTTATTGTTAGTTGCCATATT – 3’	Lunedo et al. (2019)
	ENTEROC-R	5’ –ACTCGTTGTACTTCCCATTGT – 3’
Bacillus	BACIL-F	5’ – GCTGGTTAGAGCGCACGCCTGATA – 3’	Solichová et al. (2019)
	BACIL-R	5’ – CATCCACCGTGCGCCCTTTCTAAC – 3’

The qPCR analysis was performed in the Applied Biosystems Step One sequence detection system (Applied Biosystems USA) using the Platinum SYBR® Green qPCR SuperMix-UDG Kit (Invitrogen Life Technologies USA). The Ct values were obtained using the manufacturer’s software.

Data were normalized in relation to total bacteria detection, and the relative quantification was determined using the ΔΔCt method (Schmittgen and Livak, 2008). qPCR data were presented as relative fold change in relation to the control group.

2.6. Intestinal morphometry

Two fish from each tank (n = 8) were euthanized and a sample of intestine was collected as previously described. The intestinal samples were then fixed in formalin (10%) for 24 h and then stored in a 70% ethanol solution. The samples were dehydrated in solutions containing increasing ethanol concentrations, diaphanized in xylol, and embbebed in paraffin. Cross-sections of 5 µm were obtained by semi-serial cuts and stained with hematoxylin and eosin (H&E). Microphotographs were taken using a micro-camera accoupled to an optical microscope (1000x).

All measures were performed using MoticImages Plus 2.0 ML software. The following parameters were analyzed: villi height (considering the distance from the peak of the villi until the muscle layer, in µm), total villi height (villi height + serosa thickness, µm), villi width (transversal cut of villi, in µm), epithelium thickness (µm), muscle thickness (µm), villi area, and number of goblet cells (number of cells per µm²).

3. Statistics

Results were expressed as mean ± standard error. The statistical analyses were performed with the software R V3.0.3. All data were checked for homoscedasticity and normality with Levene's test and Cramer-Von Mises' test, respectively, and were transformed to fit normal distribution using log (x + 1.5). All data were submitted to one-way ANOVA and the resultant means were compared using Tukey's multiple range test (α<0.05).

4. Results

In this study, the EO was rich in 1,8-cineole (39.5%), eugenol (14.7%) and β-selinene (12.6%), showing that the chemotype of the O. gratissimum used here was a eugenol/1,8-cineole/sesquiterpenes type (Figure 1).

Figure 1
Concentration of each component of O. gratissimum determined by gas chromatography.

After 30 days of the experiment, relative quantification by qPCR showed that the dietary supplementation with EO interfered in P. mesopotamicus’ intestinal bacteria profile (Figure 2). Compared to the control group, 1% of the EO supplementation significantly increased the relative quantity of bacteria from the genera Enterococcus (P = 0.0478) and Bacillus (P = 0.0116). Fish fed with diet supplemented with 1% of EO also presented more intestinal Lactobacillus (P = 0.0098) when compared to 0.5% group, but both groups were statistically similar to control. Compared to the control group, fish fed with diet supplemented with 0.5% presented no difference for the Enterobacteriaceae family and from the genera Enterococcus, Bacillus and Lactobacillus. However, in relation to the group fed with diet supplemented with 1%, the 0.5% group presented significantly lower quantities of Enterococcus, Bacillus and Lactococcus bacteria.

Figure 2
Relative quantification of bacterial groups in P. mesopotamicus intestine after O. gratissimum EO feeding. Different letters indicate significant differences according to Tukey’s test (α = 5%). Fc: fold change.

Regarding intestinal morphometry (Table 2), fish fed with diet supplemented with 0.5% EO showed lower villi thickness (P = 0.0097), muscle layer thickness (P = 0.0019) and villi area (P = 0.0038) when compared to fish fed 1% of EO. However, the only significant difference presented by 0.5% EO group when compared to control was the decrease of muscle layer thickness. Fish fed with diet supplemented with 1% of EO showed no differences when compared to the control regarding total villi height, villi height and muscle layer thickness (Figure 3).

Table 2
Intestinal histological morphometry of P. mesopotamicus fed with O. gratissimum EO for 30 days.

Parameter	Control	0.5%	1%	P-value
Total Villi Height (µm)	250 ± 27	128 ± 30	230 ± 18	0.1410
Villi Height (µm)	238 ± 26	120 ± 28	219 ±18	0.1230
Villi Thickness (µm)	73 ± 8 ab	59 ± 9 b	84 ± 4 a	0.0097
Muscle Layer Thickness (µm)	35 ± 2 a	21 ± 5 b	35 ± 3 a	0.0019
Villi Area (µm2)	16554 ± 2620 ab	5463 ± 1732 b	19629 ± 1540 a	0.0038
Goblet cells (cells)	2.6 ± 0.9	3.0 ± 0.5	0.6 ± 0.7	0.2020

• Different letters indicate significant differences according to Tukey’s test (α = 5%).

Figure 3
Representative microphotographs of P. mesopotamicus fed with control diet (A), 0.5% (B) and 1% (C) of O. gratissimum EO.

No natural deaths were observed during the whole the experimental period.

5. Discussion

Several studies have reported the effects of O. gratissimum on teleost species (Abdel-Tawwab et al., 2018, 2019; Boaventura et al., 2021; Brum et al., 2017; Monteiro et al., 2021; Nahak and Kanta Sahu, 2014), but this is the first that evaluated the effects of O. gratissimum EO on P. mesopotamicus, an important neotropical fish species.

The determination of EO composition after the extraction process is of significant importance in order to determine the main active compounds presented by the EO, the chemotype of the plant cultivar used for its manufacturing and its potential uses. In this study, composition analysis showed higher concentrations of 1,8-cineole, eugenol and β-selinene when compared with the other compounds, placing the O. gratissimum specimens in the eugenol/1,8-cineole/sesquiterpenes chemotype. Here, eugenol was the most abundant substance found in the O. gratissimum EO, which corroborates the findings of Bandeira Júnior et al. (2017) and Monteiro et al. (2021). Commonly found in clove EO, eugenol is well known for its anesthetic action (Barbas et al., 2021; Tarkhani et al., 2017a, b), but some studies also examined its antiparasitic (Lima Boijink et al., 2015) and antibacterial effects (Sutili et al., 2014) 1,8-cineole, also known as eucalyptol, has also been reported on as an anesthetic for fish. However, when administered through feeding, 1,8-cineole was reported on as a way to prevent oxidative stress in Oncorhynchus mykiss (Taheri Mirghaed et al., 2018) and Cyprinus carpio (Taheri Mirghaed et al., 2019). β-selinene is commonly reported in O. gratissimum composition (Bandeira Júnior et al., 2017; Monteiro et al., 2021); however, no studies investigated its action in fish using the purified form.

Evaluation of the intestinal microbiota is considered an important tool for assessing the host’s physiological, immunological and nutritional status. In this study, 1% O. gratissimum EO dietary supplementation for 30 days affected the intestinal microbiota of P. mesopotamicus by increasing bacteria of the genus Enterococcus, Bacillus and Lactobacillus. Lactic acid bacteria such as Enterococcus sp. and Lactobacillus sp. as well as bacteria from the genus Bacillus have an important role in the maintenance of homeostasis in mucous environments by producing antimicrobial substances that act against pathogens or competing for cell-surface and mucin-binding sites (Kuebutornye et al., 2020, Liu et al., 2013). Additionally, these bacteria can contribute to improved fish nutrition and growth through the production of enzymes and the production of essential amino acids and vitamins, such as vitamin B, which is vital for the energy metabolism of fish (Nayak, 2021).

According to the consulted literature, no studies have evaluated the effects of O. gratissimum EO on fish intestinal bacterial profile. While feeding Sciaenops ocellatus with the EO of a close relative to O. gratissimum, O. Americanum, Sutili et al., (2016) observed higher concentrations of linalool (33.54%) and lower concentrations of 1,8-Cineole (12.89%) when compared to our EO, and according to DGGE analysis of the microbial DNA, no changes in the fish intestinal bacterial community were noted after the experimental period. These findings suggest that the high concentration of 1,8-cineole observed in the present study may be the major cause of the changes in the intestinal bacterial profile. EOs of other plants have also been described as modulators of intestinal bacterial profile, such as Cymbopogon citratus and Pelargonium graveolens (Al-Sagheer et al., 2018) and Origanum sp. (Zhang et al., 2020).

In this study, O. gratissimum EO affected the intestinal morphology differently depending on the concentration. The most prominent effects were observed in fish fed 1% of EO, as they presented a higher villi thickness and area than the other groups. This may be attributed to the increase in lactic acid bacteria observed in this group when compared to 0.5% group. Lactic acid bacteria are known to produce short-chain fatty acids, which can improve the proliferation of enterocytes and increase the villi extension and nutrient absorption area (Abdel-Latif et al., 2020).

Despite those differences between treatments regarding intestinal morphology, none of them presented any significant difference when compared with the control group. According to the consulted literature, it is relatively common to observe no differences in the intestinal morphology after the supplementation of diets with plant derivatives such (Hernández et al., 2015; Valladão et al., 2017) which may come from interspecific characteristics, supplementation dose and period of feeding. However, morphometrical improvements due to dietary supplementation with O. gratissimum leaf extract have been reported in Clarias gariepinus (Abdel-Tawwab et al., 2018), and in other fish species using plant EOs either obtained in a laboratory or using commercial blends (Huyben et al., 2021, Zeng et al., 2015).

6. Conclusions

In conclusion, in this study, it was observed that the feeding of P. mesopotamicus with diet supplemented with O. gratissimum EO at a concentration of 1% for 30 days result in beneficial modulation of intestinal microbiota and an increase in intestinal nutrient absorption area. More studies should be conducted to determine the optimal period of EO feeding.

Acknowledgements

The authors express their gratitude to the Coordination for the Improvement of Higher Education Personnel (CAPES) for providing a scholarship to Fúlvia Cristina Oliveira, and to the National Council for Scientific and Technological Development (CNPq), process number 310058/2020-1, for their financial support to Carlos Eurico Fernandes.

References

• ABDEL-LATIF, H.M.R., ABDEL-TAWWAB, M., DAWOOD, M.A.O., MENANTEAU-LEDOUBLE, S. and EL-MATBOULI, M., 2020. Benefits of dietary butyric acid, sodium butyrate, and their protected forms in aquafeeds: a review. Reviews in Fisheries Science & Aquaculture, vol. 28, no. 4, pp. 421-448. http://doi.org/10.1080/23308249.2020.1758899
  » http://doi.org/10.1080/23308249.2020.1758899
• ABDEL-TAWWAB, M., ADESHINA, I., EMIKPE, B.O., JENYO-ONI, A., AJANI, E.K. and TIAMIYU, L.O., 2019. Effect of dietary clove basil, Ocimum gratissimum, leaves extract on healing of artificially wounded African catfish, Clarias gariepinus (B.), juveniles. Journal of Applied Aquaculture, vol. 31, no. 4, pp. 289-300. http://doi.org/10.1080/10454438.2019.1574690
  » http://doi.org/10.1080/10454438.2019.1574690
• ABDEL-TAWWAB, M., ADESHINA, I., JENYO-ONI, A., AJANI, E.K. and EMIKPE, B.O., 2018. Growth, physiological, antioxidants, and immune response of African catfish, Clarias gariepinus (B.), to dietary clove basil, Ocimum gratissimum, leaf extract and its susceptibility to Listeria monocytogenes infection. Fish & Shellfish Immunology, vol. 78, pp. 346-354. http://doi.org/10.1016/j.fsi.2018.04.057 PMid:29704554.
  » http://doi.org/10.1016/j.fsi.2018.04.057
• ADAMS, R.P., 2007 [viewed 26 February 2024]. Identification of essential oil components by gas chromatography/mass spectrometry 4th ed. [online]. Carol Stream: Allured Publishing. Available from: https://books.google.com/books/about/Identification_of_Essential_Oil_Componen.html?hl=pl&id=9ut3PQAACAAJ
  » https://books.google.com/books/about/Identification_of_Essential_Oil_Componen.html?hl=pl&id=9ut3PQAACAAJ
• ALAGAWANY, M., FARAG, M.R., SALAH, A.S. and MAHMOUD, M.A., 2020. The role of oregano herb and its derivatives as immunomodulators in fish. Reviews in Aquaculture, vol. 12, no. 4, pp. 2481-2492. http://doi.org/10.1111/raq.12453
  » http://doi.org/10.1111/raq.12453
• AL-SAGHEER, A.A., MAHMOUD, H.K., REDA, F.M., MAHGOUB, S.A. and AYYAT, M.S., 2018. Supplementation of diets for Oreochromis niloticus with essential oil extracts from lemongrass (Cymbopogon citratus) and geranium (Pelargonium graveolens) and effects on growth, intestinal microbiota, antioxidant and immune activities. Aquaculture Nutrition, vol. 24, no. 3, pp. 1006-1014. http://doi.org/10.1111/anu.12637
  » http://doi.org/10.1111/anu.12637
• BANDEIRA JÚNIOR, G., PÊS, T.S., SACCOL, E.M.H., SUTILI, F.J., ROSSI, W.R., MURARI, A.L., HEINZMANN, B.M., PAVANATO, M.A., DE VARGAS, A.C., SILVA, L. L. and BALDISSEROTTO, B., 2017. Potential uses of Ocimum gratissimum and Hesperozygis ringens essential oils in aquaculture. Industrial Crops and Products, vol. 97, pp. 484-491. http://doi.org/10.1016/j.indcrop.2016.12.040
  » http://doi.org/10.1016/j.indcrop.2016.12.040
• BARBAS, L.A.L., TORRES, M.F., DA COSTA, B.M.P.A., FEITOSA, M.J.M., MALTEZ, L.C., AMADO, L.L., TODA, Y.P.S., BATISTA, P., CABRAL, D.A.C. and HAMOY, M., 2021. Eugenol induces body immobilization yet evoking an increased neuronal excitability in fish during short-term baths. Aquatic Toxicology, vol. 231, pp. 105734. http://doi.org/10.1016/j.aquatox.2020.105734 PMid:33385846.
  » http://doi.org/10.1016/j.aquatox.2020.105734
• BOAVENTURA, T.P., SOUZA, C.F., FERREIRA, A.L., FAVERO, G.C., BALDISSERA, M.D., HEINZMANN, B.M., BALDISSEROTTO, B. and LUZ, R.K., 2021. The use of Ocimum gratissimum L. essential oil during the transport of Lophiosilurus alexandri: water quality, hematology, blood biochemistry and oxidative stress. Aquaculture, vol. 531, pp. 735964. http://doi.org/10.1016/j.aquaculture.2020.735964
  » http://doi.org/10.1016/j.aquaculture.2020.735964
• BRUM, A., PEREIRA, S.A., OWATARI, M.S., CHAGAS, E.C., CHAVES, F.C.M., MOURIÑO, J.L.P. and MARTINS, M.L., 2017. Effect of dietary essential oils of clove basil and ginger on Nile tilapia (Oreochromis niloticus) following challenge with Streptococcus agalactiae. Aquaculture, vol. 468, pp. 235-243. http://doi.org/10.1016/j.aquaculture.2016.10.020
  » http://doi.org/10.1016/j.aquaculture.2016.10.020
• EBRAHIMI, G., OURAJI, H., KHALESI, M.K., SUDAGAR, M., BARARI, A., ZAREI DANGESARAKI, M. and JANI KHALILI, K.H., 2012. Effects of a prebiotic, Immunogen®, on feed utilization, body composition, immunity and resistance to Aeromonas hydrophila infection in the common carp Cyprinus carpio (Linnaeus) fingerlings. Journal of Animal Physiology and Animal Nutrition, vol. 96, no. 4, pp. 591-599. http://doi.org/10.1111/j.1439-0396.2011.01182.x PMid:21707781.
  » http://doi.org/10.1111/j.1439-0396.2011.01182.x
• FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS - FAO. 2022. The State of World Fisheries and Aquaculture 2022. The State of World Fisheries and Aquaculture 2022 Rome: FAO.
• FREITAS SOUZA, C., BALDISSERA, M.D., BALDISSEROTTO, B., HEINZMANN, B.M., MARTOS-SITCHA, J.A. and MANCERA, J.M., 2019. Essential oils as stress-reducing agents for fish aquaculture: A review. Frontiers in Physiology, vol. 10, pp. 785. http://doi.org/10.3389/fphys.2019.00785 PMid:31281264.
  » http://doi.org/10.3389/fphys.2019.00785
• GIRI, S.S., SUKUMARAN, V. and OVIYA, M., 2013. Potential probiotic Lactobacillus plantarum VSG3 improves the growth, immunity, and disease resistance of tropical freshwater fish, Labeo rohita. Fish & Shellfish Immunology, vol. 34, no. 2, pp. 660-666. http://doi.org/10.1016/j.fsi.2012.12.008 PMid:23274158.
  » http://doi.org/10.1016/j.fsi.2012.12.008
• HERNÁNDEZ, A., GARCÍA GARCÍA, B., CABALLERO, M.J. and HERNÁNDEZ, M.D., 2015. Preliminary insights into the incorporation of rosemary extract (Rosmarinus officinalis L.) in fish feed: influence on performance and physiology of gilthead seabream (Sparus aurata). Fish Physiology and Biochemistry, vol. 41, no. 4, pp. 1065-1074. http://doi.org/10.1007/s10695-015-0069-2 PMid:25968936.
  » http://doi.org/10.1007/s10695-015-0069-2
• HUYBEN, D., CHIASSON, M., LUMSDEN, J.S., PHAM, P.H. and CHOWDHURY, M.A.K., 2021. Dietary microencapsulated blend of organic acids and plant essential oils affects intestinal morphology and microbiome of rainbow trout (Oncorhynchus mykiss). Microorganisms, vol. 9, no. 10, pp. 2063-2063. http://doi.org/10.3390/microorganisms9102063 PMid:34683384.
  » http://doi.org/10.3390/microorganisms9102063
• KUEBUTORNYE, F.K.A., ABARIKE, E.D., LU, Y., HLORDZI, V., SAKYI, M.E., AFRIYIE, G., WANG, Z., LI, Y. and XIE, C.X., 2020. Mechanisms and the role of probiotic Bacillus in mitigating fish pathogens in aquaculture. Fish Physiology and Biochemistry, vol. 46, no. 3, pp. 819-841. http://doi.org/10.1007/s10695-019-00754-y PMid:31953625.
  » http://doi.org/10.1007/s10695-019-00754-y
• LEE, D.H., ZO, Y.G. and KIM, S.J., 1996. Nonradioactive method to study genetic profiles of natural bacterial communities by PCR-single-strand-conformation polymorphism. Applied and Environmental Microbiology, vol. 62, no. 9, pp. 3112-3120. http://doi.org/10.1128/aem.62.9.3112-3120.1996 PMid:8795197.
  » http://doi.org/10.1128/aem.62.9.3112-3120.1996
• LIMA BOIJINK, C., MIRANDA, W.S.C., CHAGAS, E.C., DAIRIKI, J.K. and INOUE, L.A.K.A., 2015. Anthelmintic activity of eugenol in tambaquis with monogenean gill infection. Aquaculture, vol. 438, pp. 138-140. http://doi.org/10.1016/j.aquaculture.2015.01.014
  » http://doi.org/10.1016/j.aquaculture.2015.01.014
• LIMA BOIJINK, C., QUEIROZ, C.A., CHAGAS, E.C., CHAVES, F.C.M. and INOUE, L.A.K.A., 2016. Anesthetic and anthelminthic effects of clove basil (Ocimum gratissimum) essential oil for tambaqui (Colossoma macropomum). Aquaculture, vol. 457, pp. 24-28. http://doi.org/10.1016/j.aquaculture.2016.02.010
  » http://doi.org/10.1016/j.aquaculture.2016.02.010
• LIU, W., REN, P., HE, S., XU, L., YANG, Y., GU, Z. and ZHOU, Z., 2013. Comparison of adhesive gut bacteria composition, immunity, and disease resistance in juvenile hybrid tilapia fed two different Lactobacillus strains. Fish & Shellfish Immunology, vol. 35, no. 1, pp. 54-62. http://doi.org/10.1016/j.fsi.2013.04.010 PMid:23608032.
  » http://doi.org/10.1016/j.fsi.2013.04.010
• LUNEDO, R., FURLAN, L.R., FERNANDEZ‐ALARCON, M.F., SQUASSONI, G.H., CAMPOS, D.M., PERONDI, D. and MACARI, M., 2019. Intestinal microbiota of broilers submitted to feeding restriction and its relationship to hepatic metabolism and fat mass: fast‐growing strain. Journal of Animal Physiology and Animal Nutrition, vol. 103, no. 4, pp. 1070-1080. http://doi.org/10.1111/jpn.13093 PMid:30934145.
  » http://doi.org/10.1111/jpn.13093
• MONTEIRO, P.C., BRAGA DE OLIVEIRA, M.I., BRANDÃO, F.R., SANTANA FARIAS, C.F., MAJOLO, C., CHAVES, F.C.M., BIZZO, H.R., DE ALMEIDA O’SULLIVAN, F.L., MARTINS, M.L. and CHAGAS, E.C., 2021. Short-term baths with essential oils of Lippia sidoides, Ocimum gratissimum and Zingiber officinale influence blood parameters and survival of tambaqui (Colossoma macropomum) after infection with Aeromonas hydrophila. Aquaculture Research, vol. 53, no. 1, pp. 265-275. http://doi.org/10.1111/are.15572
  » http://doi.org/10.1111/are.15572
• MUNIR, M.B., HASHIM, R., CHAI, Y.H., MARSH, T.L. and NOR, S.A.M., 2016. Dietary prebiotics and probiotics influence growth performance, nutrient digestibility and the expression of immune regulatory genes in snakehead (Channa striata) fingerlings. Aquaculture, vol. 460, pp. 59-68. http://doi.org/10.1016/j.aquaculture.2016.03.041
  » http://doi.org/10.1016/j.aquaculture.2016.03.041
• NAHAK, G. and KANTA SAHU, R., 2014. Immunomodulatory Effect of Ocimum gratissimum Linn. Leaf Extract on a Common Fish Clarias batrachus Linn. International Journal of Drug Delivery, vol. 6, no. 3, pp. 268-278.
• NAYAK, S.K., 2010. Role of gastrointestinal microbiota in fish. Aquaculture Research, vol. 41, no. 11, pp. 1553-1573. http://doi.org/10.1111/j.1365-2109.2010.02546.x
  » http://doi.org/10.1111/j.1365-2109.2010.02546.x
• NAYAK, S.K., 2021. Multifaceted applications of probiotic Bacillus species in aquaculture with special reference to Bacillus subtilis. Reviews in Aquaculture, vol. 13, no. 2, pp. 862-906. http://doi.org/10.1111/raq.12503
  » http://doi.org/10.1111/raq.12503
• NGUYEN, T.L., PARK, C. and KIM, D.-H., 2017. Improved growth rate and disease resistance in olive flounder, Paralichthys olivaceus, by probiotic Lactococcus lactis WFLU12 isolated from wild marine fish. Aquaculture, vol. 471, pp. 113-120. http://doi.org/10.1016/j.aquaculture.2017.01.008
  » http://doi.org/10.1016/j.aquaculture.2017.01.008
• PESSOA, L.M., MORAIS, S.M., BEVILAQUA, C.M.L. and LUCIANO, J.H.S., 2002. Anthelmintic activity of essential oil of Ocimum gratissimum Linn. and eugenol against Haemonchus contortus. Veterinary Parasitology, vol. 109, no. 1-2, pp. 59-63. http://doi.org/10.1016/S0304-4017(02)00253-4 PMid:12383625.
  » http://doi.org/10.1016/S0304-4017(02)00253-4
• SACCOL, E.M.H., UCZAY, J., PÊS, T.S., FINAMOR, I.A., OURIQUE, G.M., RIFFEL, A.P.K., SCHMIDT, D., CARON, B.O., HEINZMANN, B.M., LLESUY, S.F., LAZZARI, R., BALDISSEROTTO, B. and PAVANATO, M.A., 2013. Addition of Lippia alba (Mill) N. E. Brown essential oil to the diet of the silver catfish: an analysis of growth, metabolic and blood parameters and the antioxidant response. Aquaculture, vol. 417, pp. 244-254. http://doi.org/10.1016/j.aquaculture.2013.09.036
  » http://doi.org/10.1016/j.aquaculture.2013.09.036
• SCHMITTGEN, T.D. and LIVAK, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nature Protocols, vol. 3, no. 6, pp. 1101-1108. http://doi.org/10.1038/nprot.2008.73 PMid:18546601.
  » http://doi.org/10.1038/nprot.2008.73
• SILVA, L.A., MARTINS, M.A., SANTO, F.E., OLIVEIRA, F.C., CHAVES, F.C.M., CHAGAS, E.C., MARTINS, M.L. and DE CAMPOS, C.M., 2020. Essential oils of Ocimum gratissimum and Zingiber officinale as anesthetics for the South American catfish Pseudoplatystoma reticulatum. Aquaculture, vol. 528, pp. 735595. http://doi.org/10.1016/j.aquaculture.2020.735595
  » http://doi.org/10.1016/j.aquaculture.2020.735595
• SOLICHOVÁ, K., NĚMEČKOVÁ, I., ŠVIRÁKOVÁ, E. and HORÁČKOVÁ, Š., 2019. Novel identification methods including a species-specific PCR for hazardous Bacillus species. Acta Alimentaria, vol. 48, no. 4, pp. 415-422. http://doi.org/10.1556/066.2019.48.4.2
  » http://doi.org/10.1556/066.2019.48.4.2
• SUTILI, F.J., KREUTZ, L.C., NORO, M., GRESSLER, L.T., HEINZMANN, B.M., DE VARGAS, A.C. and BALDISSEROTTO, B., 2014. The use of eugenol against Aeromonas hydrophila and its effect on hematological and immunological parameters in silver catfish (Rhamdia quelen). Veterinary Immunology and Immunopathology, vol. 157, no. 3-4, pp. 142-148. http://doi.org/10.1016/j.vetimm.2013.11.009 PMid:24368084.
  » http://doi.org/10.1016/j.vetimm.2013.11.009
• SUTILI, F.J., VELASQUEZ, A., PINHEIRO, C.G., HEINZMANN, B.M., GATLIN 3RD, D.M. and BALDISSEROTTO, B., 2016. Evaluation of Ocimum americanum essential oil as an additive in red drum (Sciaenops ocellatus) diets. Fish & Shellfish Immunology, vol. 56, pp. 155-161. http://doi.org/10.1016/j.fsi.2016.07.008 PMid:27417228.
  » http://doi.org/10.1016/j.fsi.2016.07.008
• TAHERI MIRGHAED, A., FAYAZ, S. and HOSEINI, S.M., 2019. Effects of dietary 1,8-cineole supplementation on serum stress and antioxidant markers of common carp (Cyprinus carpio) acutely exposed to ambient ammonia. Aquaculture, vol. 509, pp. 8-15. http://doi.org/10.1016/j.aquaculture.2019.04.071
  » http://doi.org/10.1016/j.aquaculture.2019.04.071
• TAHERI MIRGHAED, A., HOSEINI, S.M. and GHELICHPOUR, M., 2018. Effects of dietary 1,8-cineole supplementation on physiological, immunological and antioxidant responses to crowding stress in rainbow trout (Oncorhynchus mykiss). Fish & Shellfish Immunology, vol. 81, pp. 182-188. http://doi.org/10.1016/j.fsi.2018.07.027 PMid:30010015.
  » http://doi.org/10.1016/j.fsi.2018.07.027
• TAN, H.Y., CHEN, S.W. and HU, S.Y., 2019. Improvements in the growth performance, immunity, disease resistance, and gut microbiota by the probiotic Rummeliibacillus stabekisii in Nile tilapia (Oreochromis niloticus). Fish & Shellfish Immunology, vol. 92, pp. 265-275. http://doi.org/10.1016/j.fsi.2019.06.027 PMid:31202962.
  » http://doi.org/10.1016/j.fsi.2019.06.027
• TARKHANI, R., IMANI, A., JAMALI, H. and FARSANI, H.G., 2017a. Anaesthetic efficacy of eugenol on various size classes of angelfish (Pterophyllum scalare Schultze, 1823). Aquaculture Research, vol. 48, no. 10, pp. 5263-5270. http://doi.org/10.1111/are.13339
  » http://doi.org/10.1111/are.13339
• TARKHANI, R., IMANI, A., JAMALI, H. and SARVI MOGHANLOU, K., 2017b. Anaesthetic efficacy of eugenol on Flowerhorn (Amphilophus labiatus × Amphilophus trimaculatus). Aquaculture Research, vol. 48, no. 6, pp. 3207-3215. http://doi.org/10.1111/are.13151
  » http://doi.org/10.1111/are.13151
• VALLADÃO, G.M., GALLANI, S.U., PALA, G., JESUS, R.B., KOTZENT, S., COSTA, J.C., SILVA, T.F.A. and PILARSKI, F., 2017. Practical diets with essential oils of plants activate the complement system and alter the intestinal morphology of Nile tilapia. Aquaculture Research, vol. 48, no. 11, pp. 5640-5649. http://doi.org/10.1111/are.13386
  » http://doi.org/10.1111/are.13386
• VALLADÃO, G.M.R., GALLANI, S.U. and PILARSKI, F., 2018. South American fish for continental aquaculture. Reviews in Aquaculture, vol. 10, no. 2, pp. 351-369. http://doi.org/10.1111/raq.12164
  » http://doi.org/10.1111/raq.12164
• VANDENDOOL, H. and KRATZ, P.D., 1963. A generalization of the retention index system including linear temperature programmed gas-liquid partition chromatography. Journal of Chromatography. A, vol. 11, no. C, pp. 463-471. http://doi.org/10.1016/S0021-9673(01)80947-X PMid:14062605.
  » http://doi.org/10.1016/S0021-9673(01)80947-X
• VASEEHARAN, B. and THAYA, R., 2014. Medicinal plant derivatives as immunostimulants: an alternative to chemotherapeutics and antibiotics in aquaculture. Aquaculture International, vol. 22, no. 3, pp. 1079-1091. http://doi.org/10.1007/s10499-013-9729-3
  » http://doi.org/10.1007/s10499-013-9729-3
• WANG, A.R., RAN, C., RINGØ, E. and ZHOU, Z.G., 2018. Progress in fish gastrointestinal microbiota research. Reviews in Aquaculture, vol. 10, no. 3, pp. 626-640. http://doi.org/10.1111/raq.12191
  » http://doi.org/10.1111/raq.12191
• ZENG, Z., XU, X., ZHANG, Q., LI, P., ZHAO, P., LI, Q., LIU, J. and PIAO, X., 2015. Effects of essential oil supplementation of a low-energy diet on performance, intestinal morphology and microflora, immune properties and antioxidant activities in weaned pigs. Animal Science Journal, vol. 86, no. 3, pp. 279-285. http://doi.org/10.1111/asj.12277 PMid:25302651.
  » http://doi.org/10.1111/asj.12277
• ZHANG, R., WANG, X.W., LIU, L.L., CAO, Y.C. and ZHU, H., 2020. Dietary oregano essential oil improved the immune response, activity of digestive enzymes, and intestinal microbiota of the koi carp, Cyprinus carpio. Aquaculture, vol. 518, pp. 734781. http://doi.org/10.1016/j.aquaculture.2019.734781
  » http://doi.org/10.1016/j.aquaculture.2019.734781
• ZHENG, Z.L., TAN, J.Y.W., LIU, H.Y., ZHOU, X.H., XIANG, X. and WANG, K.Y., 2009. Evaluation of oregano essential oil (Origanum heracleoticum L.) on growth, antioxidant effect and resistance against Aeromonas hydrophila in channel catfish (Ictalurus punctatus). Aquaculture, vol. 292, no. 3-4, pp. 214-218. http://doi.org/10.1016/j.aquaculture.2009.04.025
  » http://doi.org/10.1016/j.aquaculture.2009.04.025

Publication Dates

• Publication in this collection
  14 Mar 2025
• Date of issue
  2025

History

• Received
  26 Feb 2024
• Accepted
  01 Dec 2024