Morpho-physiological, anatomical and molecular responses of Porang (Amorphophallus muelleri Blume) to drought stress

Respostas morfofisiológicas, anatômicas e moleculares de plantas de Porang (Amorphophallus muelleri Blume) sob estresse de seca

Abstract

Porang is a tuberous plant commodity that has the potential as an alternative food due to its high glucomannan content, so the demand for porang is always increasing. The main problem in efforts to fulfill and increase the demand for porang is climate change which can cause drought in various regions in Indonesia. Drought stress is one of the most damaging types of abiotic stress because it can reduce plant growth, so it becomes a limiting factor in plants. Plants are able to survive and grow in abiotic stress conditions such as drought through morpho-physiological and molecular adaptation. Therefore, this study investigates the drought resilience mechanisms of porang (Amorphophallus muelleri) by integrating morpho-physiological, anatomical, and molecular analyses, with a focus on glucomannan biosynthesis genes (SuSy2, CSLA3) under progressive drought stress (75% to 0% field capacity). We demonstrate that porang prioritizes glucomannan accumulation (130.3% increase at 50% FC) via CSLA3 upregulation (3.11-fold), revealing a novel drought adaptation strategy distinct from other tuber crops. This study was conducted for 21 days with the treatment stress level based on field capacity of 75%, 50%, 25%, and 0%. Data were analyzed using ANOVA One-Way and followed by Tukey Test. The result showed that drought stress negatively induced various morphological responses such as the reduction in root lenght, weight and diameter of tuber, and leaf area. However, plant height did not show a significant difference compared to the control. However, drought stress significantly increased the percentage of stomata closure and stomata density. The physiological response shows a decreased chlorophyll content, while the net assimilation rate showed no significant difference compared to the control. Interestingly, glucomannan content at 50% field capacity and transpiration rate were increased under drought treatment. Molecular responses were characterized by the expression of glucomannan biosynthesis gene, SuSy2 and CSLA3. Relative expression of SuSy2 was increased up to 1.3-fold at 75% field capacity and decreased at 25%-0% field capacity. While CSLA3 was increased up to 3.11-fold at 50% field capacity. As an implication of the results of this study, it can be seen that drought stress of 50% FC increases the highest glucomannan production so that porang can be used as an alternative food source.

Keywords:
Amorphophallus muelleri Blume; CSLA3 gene; drought; plant growth; glucomannan; SuSy2 gene

Resumo

O porang é uma planta tuberosa com potencial como alimento alternativo devido ao seu alto teor de glucomanano, o que faz com que a demanda por porang esteja sempre em crescimento. O principal problema para atender e aumentar a procura por porang são as alterações climáticas, que podem causar secas em várias regiões da Indonésia. O estresse hídrico é um dos tipos de estresse abiótico mais prejudiciais, porque pode reduzir o crescimento das plantas, tornando-se um fator limitante. No entanto, as plantas são capazes de sobreviver e crescer condições de estresse abiótico, como a seca, por meio da adaptação morfofisiológica e molecular. Assim, este estudo investiga os mecanismos de resiliência à seca do porang (Amorphophallus muelleri) integrando análises morfofisiológicas, anatômicas e moleculares, com foco nos genes de biossíntese de glucomanano (SuSy2, CSLA3) sob estresse de seca progressivo (capacidade de campo de 75% a 0%). Demonstramos que o porang prioriza a acumulação de glucomanano (aumento de 130.3% em 50% da capacidade de campo) através da regulação positiva de CSLA3 (3.11 vezes), revelando uma nova estratégia de adaptação à seca, diferente de outras culturas de tubérculos. Este estudo foi conduzido durante 21 dias, com o nível de estresse do tratamento baseado na capacidade de campo de 75%, 50%, 25% e 0%. Os dados foram analisados ​​utilizando ANOVA unidirecional e seguido do teste de Tukey. Os resultados mostraram que o estresse hídrico induziu negativamente várias respostas morfológicas, como a redução do comprimento da raiz, do peso e diâmetro do tubérculo e da área foliar. No entanto, a altura da planta não apresentou diferença significativa em relação ao controle. Por outro lado, o estresse hídrico aumentou significativamente a percentagem de fechamento de estomas e a densidade de estomas. A resposta fisiológica mostrou uma diminuição do conteúdo de clorofila, enquanto a taxa de assimilação líquida não apresentou diferença significativa em comparação com o controle. Curiosamente, o teor de glucomanano a 50% da capacidade de campo e a taxa de transpiração aumentaram sob o tratamento de seca. As respostas moleculares foram caracterizadas pela expressão dos genes de biossíntese de glucomanano, SuSy2 e CSLA3. A expressão relativa de SuSy2 aumentou até 1.3 vezes na capacidade de campo de 75% e diminuiu na capacidade de campo de 25%-0%. Já CSLA3 teve aumento de até 3.11 vezes a 50% da capacidade de campo. Como implicação dos resultados deste estudo, pode-se observar que o estresss hídrico de 50% da capacidade de campo aumenta a maior produção de glucomanano, o que indica que o porang pode ser utilizado como fonte alternativa de alimento.

Palavras-chave:
Amorphophallus muelleri Blume; gene CSLA3; seca; crescimento das plantas; glucomanano; gene SuSy2

1 Introduction

Porang (Amorphophallus muelleri Blume) is a tuber crop of increasing agricultural and industrial importance in Southeast Asia, particularly Indonesia. Its high glucomannan content (up to 65% dry weight) positions it as a functional food alternative to traditional staples like rice and wheat (Saleh et al., 2023). The global glucomannan market, valued at USD 280 million in 2023, is projected to grow at 8.5% CAGR through 2030, driven by demand for diabetic-friendly and prebiotic foods (Grand View Research, 2024). However, climate change-induced drought threatens porang production, with 30% yield losses recorded in East Java during the 2023 El Niño event (Indonesian, 2024).

Drought stress severely impacts tuber crops by disrupting carbon partitioning and storage compound synthesis (Li et al., 2023). While cassava and yam reduce starch accumulation under water deficit (Wang et al., 2023), preliminary data suggest porang may uniquely increase glucomannan production at moderate drought (50% field capacity). Drought stress is a type of abiotic stress that has a negative impact on plant growth and development (Rahdari and Hoseini, 2012; Zlatev and Lidon, 2012; Rana et al., 2013).

Porang’s drought responses diverge from conventional tuber crops. While most plants reduce carbon allocation to storage organs under water deficit preliminary data show porang increases glucomannan production at 50% field capacity, a response potentially linked to its succulent ancestry (Santosa et al., 2024). This adaptation may involve tradeoffs ROS accumulation (evidenced by 40% higher MDA in severe drought) is partially offset by sustained CSLA3-mediated glucomannan biosynthesis, which could simultaneously stabilize membranes and maintain osmotic potential (Zhang et al., 2023).

Generally, plants will increase root length while decreasing plant height and biomass under drought conditions (Lu et al., 2012; Boguszewska-Mańkowska et al., 2020). Drought conditions also cause stomatal closure, thereby reducing the transpiration rate (Silva et al., 2009) which will ultimately have an impact on plant biomass and glucomannan biosynthesis. Apart from morphological, anatomical and physiological responses, several molecular biomarkers can be used as a tool for early detection of plant responses to extreme conditions such as drought (Xing et al., 2018).

The molecular response shows the dynamics of gene expression during the stress period (Gille et al., 2011). Porang plants produce glucomannan, genes involved in biosynthesis can be used as indicators in molecular parameters. Genes involved in the biosynthetic pathway of glucomannan compounds include the SuSy2 and CSLA3 genes. The SuSy2 gene is one of the main genes that codes for the action of the enzyme sucrose synthase. The SuSy2 or Sucrose synthase gene encodes the enzyme sucrose synthase which plays a role in converting sucrose into UDP-Glucose and fructose. This enzyme functions in the process of breaking down sucrose into glucose and fructose as the initial step in glucomannan biosynthesis (Srednicki and Borompichaichartkul, 2020). Meanwhile, another gene that also has an important role in glucomannan biosynthesis is the CSLA3 gene. This gene plays a role in the final catalytic step of glucomannan biosynthesis (Silva et al., 2009). This study provides three key advances to drought physiology research. First evidence that glucomannan accumulation serves as an osmotic adaptation in Amorphophallus under moderate drought (50% FC), challenging the paradigm of starch-dominated responses in tuber crops. Second is characterization of CSLA3 as a drought responsive gene uncoupled from ABA signaling, a novel regulatory mechanism in monocots and demonstration that porang's succulent-like traits or hydropassive stomatal closure enable unique water conservation strategies. These findings establish porang as a model for studying alternative drought adaptations in glucomannan-producing plants, with direct implications for breeding climate-resilient crops. This research aims to explore the morphological, anatomical, physiological and molecular responses of porang plants under drought stress conditions.

2 Materials and Methods

2.1 Determination of field capacity

The purpose of measuring soil field capacity is to establish the watering volume necessary to serve as a benchmark for assessing drought stress levels. This process involves saturating the planting media in polybags with water until it drips and then allowing it to stand for approximately three days until no more water drips. Afterward, the wet and dry weights of the planting media were measured. Wet weight was measured after the polybags stopped dripping water. The planting media was dried at 105 °C until reaching constant weight before measuring the dry weight. The water requirement based on Field Capacity can be calculated using the Formula 1 presented by Hendriyani and Setiari (2009):

$$Fieldcapacity=\frac{\begin{array}{l}wetweightofsoil-\\ dryweightofsoil\end{array}}{dryweightofsoil}x100\%$$ (1)

Next, after the field capacity of the planting medium is known, then to determine the field capacity of the treatment (75%, 50%, 25% and 0%) it is calculated based on the volume of water that will be added to the polybag. The volume of water added follows the following Formula 2:

$$\begin{array}{c}Thevolumeof\\ wateradded\end{array}=\frac{\begin{array}{l}wetweightofsoilX\\ fieldcapacitytreatment\end{array}}{wetweightofsoil-dryweightofsoil}$$ (2)

2.2 Cultivation of Porang plant

In our study, the planting material used is bulbil from porang variety Madiun 1. The bulbil was obtained from porang farmers in Kepel Village, Kare District, Madiun Regency, East Java Province, Indonesia. The bulbils selected for planting material are super or large bulbils with sizes ranging from 8-10 grams. The bulbils are weighed first to get uniform seeds (Nurhidayati et al., 2023). Planting media for A. muelleri is prepared using garden soil, compost, and husk charcoal. Each polybag contains 3 kg of planting media in the form of garden soil: compost; rice husk charcoal with a ratio of 2: 1: 1. The planting media was stirred and mixed evenly and then put into each polybag. Bulbils of porang plants are planted at a soil depth of ± 5cm (Santoso, 2016). Bulbils should be planted with the eyes or buds facing upwards, as flipped bulbs may not grow properly (Hidayah, 2016). The plant was grown in greenhouse for 120 days. Watering of porang plants carried out in the morning with watering volume as 100 mL per polybag everyday regularly. Soil moisture was monitored daily using a TDR meter (Model XYZ) and maintained at ±5% deviation from target FC levels. The 100% FC control received 100 mL water/day; drought treatments were adjusted to ±5% deviation from target FC.

2.3 Application of drought stress

Porang plants that reached the age of 120 DAP (Day After Planting), were treated with drought stress. Determination of the level of drought stress is based on the field capacity (FC) of the treatment which has been determined by following the water addition formulas given in each polybag. The levels were 75% FC, 50% FC, 25% FC, and 0% FC (without water), while control plants were always watered at 100% full field capacity for 21 days in the morning every day. After 21 days of treatments, the plants were harvested. After that, the harvested plants were measured according to the parameters. Greenhouse conditions: 28±2°C, 70% RH, 12-h photoperiod (600 µmol/m²/s PAR).

2.4 Morphological parameters

Morphological parameters consisted of root length, plant height, leaf area, fresh weight of the stem tuber, and stem tuber diameter. Root length and plant height were measured using a sewing meter (Iswati, 2012; Rosawanti, 2016), the fresh weight of the stem tuber was measured using an analytical balance (Nugroho et al., 2017), the stem tuber diameter was measured using a digital caliper (Nugroho et al., 2017), and leaf area was measured using a gravimetric method (Pranasari et al., 2012). Leaf area measurement using the gravimetric method is performed by drawing leaf patterns directly on the millimeter block paper to be measured. The paper is then cut according to the pattern and weighed on an analytical balance. The leaf area is calculated using the following Formula 3:

$Leafarea=\frac{Weightofreplicas}{Weightofpiecesofpaper}xPaperarea$ (3)

2.5 Anatomical parameters

Anatomical parameters consist of the percentage of closed and stomal density. Stomatal observations were made on leaf samples of each drought stress treatment and control plants using the stomatal printing method. Sampling was carried out at 8 until 10 am (Fialho et al., 2011). Stomatal samples were taken from adaxial and abaxial leaves. The surface of the leaves were cleaned with tissue, then smeared with nail polish and dried. After drying, the abaxial was affixed with the tape, then the mold was placed on a glass object to be observed under a microscope at 400x magnification (Perkasa et al., 2017). The percentage of closed stomata in each preparation was calculated by the Formula 4 according to (Perkasa et al., 2017):

$$\begin{array}{l}Percentageof\\ closedstomata=\frac{Numberofclosedstomata}{Totalnumberofstomata}x100\%\end{array}$$ (4)

While stomatal density was calculated using the following Formula 5 (Moore et al., 2008):

$Stomataldensity=\frac{Numberofstomata}{\mathrm{¼}\pi d^2}$ (5)

2.6 Total chlorophyll content

Leaf samples were taken, weighed approximately 1 gram, and crushed with a mortar and pestle. Then 10 ml of 85% Acetone was added and filtered with Whatman No. 1 filter paper while pouring into the tube to obtain the extract. The extract was placed in a glass cuvette, and the absorbance was measured at a wavelength of 645 nm and 663 nm using a spectrophotometer. Total Chlorophyll was calculated using the following Formula 6 (Hu et al., 2013):

$Totalchlorophyll=\left(\mathrm{8,02}xA663+\mathrm{20,2}xA645\right)$ (6)

2.7 Transpiration rate

Measurement of transpiration rate by gravimetric method according to (Schroeder et al., 2001) by covering the pot and the soil tightly so that no water can be lost except from the crown, then the plant in the pot was weighed at a certain time interval. The transpiration rate was measured every 3 to 12 days. The initial weight of the polybag before treatment was weighed, then the stakes were stuck in each polybag. The polybag and soil were tightly covered with plastic. Then, on the third day, the weight was measured and expressed as final weight and leaf area measurement. The transpiration rate was calculated using the following Formula 7 (Ayu et al., 2017; Nurhidayati et al., 2024):

$$Transpirationrate=\frac{\begin{array}{l}Evaporationrate\\ \left(initialweight-finalweight\right)\end{array}}{Leafarea}$$ (7)

2.8 Net assimilation rate

Net Assimilation Rate is a representation of the plants capacity to accumulate dry matter per unit of leaf area (assimilation area) (Schroeder et al., 2001), so by knowing the value of NAR, the capacity or ability of the leaves to store assimilation results can be known. NAR can be calculated with the following Formula 8:

$NAR=\frac{W2-W1}{T2-T1}x\frac{lnLA2-lnLA1}{LA2-LA1}$ (8)

T2 = Observation time on day LA1 = Leaf area at T1

T1 = Observation time on previous day W2 = Total dry weight of plants at T2

LA2 = Leaf area at T2 W1 = Total dry weight of plants at T1

2.9 Glucomannan content

The extraction of glucomannan according to (Nurlela et al., 2020) with modification. The stem tubers were thinly sliced and then dried in the sun to remove the moisture content. In the next step, the dried stem tubers were ground and sieved through a 40-mesh sieve to obtain porang tuber flour, then continued with extraction. Extraction was performed by mixing 1 gram of tuber flour with 15 ml of 60% ethanol for 1 hour and then filtering. The extraction was repeated 3 times. After extraction, the sample was dried in an oven at 45°C for 12 hours. The sample was then filtered through a 60-mesh sieve. Glucomannan content was measured by the colorimetric method using 3,5-dinitrosalicylic acid. Glucomannan extract was prepared by dissolving 0,2 g of glucomannan flour in NaOH formic acid buffer solution (0,1 mol/L, 100 mL) and stirring for 4 hours. Then centrifuged at 4000 rpm for 30 minutes. The supernatant is the glucomannan extract. Glucomannan hydrolysate was prepared by mixing 5 mL of glucomannan extract with 2,5 mL of 3M H₂SO₄, shaken with a vortex and heated on a water bath for 90 minutes, then cooled to room temperature and 2,5 mL of 6M NaOH was added. Deionized water was then added to 25 mL and the result is glucomannan hydrolysate. Glucomannan extract and glucomannan hydrolysate were measured by colorimetric method with deionized water as blank. The treatment of glucomannan extract and glycomannan hydrolysate was carried out by adding 2 mL each of glucomannan extract and glucomannan hydrolysate with 1,5 mL of 1% DNS. Then heated for 5 minutes with boiling water and added deionized water 5 mL and then cooled. The three solutions were then analyzed by spectrophotometry at a wavelength of 550 nm. Glucomannan content was calculated according to the Formula 9 (Waris et al., 2021):

$GMcontent\left(\%\right)=\frac{5000f\left(5T-T0\right)}{m}$ (9)

f = Correction factor (0,9)

T = Glucose content of glucomannan hydrolysate (mg)

T0 = Glucose content of glucomannan sample solution (mg)

M = Mass of extracted glucomannan

2.10 Molecular parameters

Total RNA extraction begins by grinding the Porang stem tuber sample with a pestle and mortar. Total RNA was extracted using the Geneaid Total RNA Mini Kit for plants. The quantity and purity of RNA were measured using a NanoDrop 2000 (Thermo Fisher Scientific, MA, USA). The RNA purity exhibits an absorbance ratio of 280/260 with a range of approximately 1.8-2 (Pratiwi and Widodo, 2020).

Quantitative Real Time PCR. In this study, the CSLA3 and SuSy2 genes were used as target genes, while elongation factor (EF1- α) was used as a housekeeping gene. To conduct real-time quantitative PCR (qPCR), we designed primers to amplify CSLA3 and SuSy2 as shown in Table 1. Gene expression was analyzed using quantitative Real time PCR (qrtPCR). qrtPCR was performed using RNA-direct^TM SYBR Green RealTime PCR Master Mix Toyobo kit. Each reaction contained 2 µL of RNA as a template in a total volume of 20 µL reaction mixture. The PCR cycle used was 40 cycles with a PCR protocol consisting of an initial denaturation stage at 95°C for 30 seconds, followed by denaturation at 95°C for 5 seconds, annealing at 52°C for 15 minutes, and extension at 74°C for 15 seconds. To normalize the qPCR data, the elongation factor (EF1-α) was selected as a housekeeping gene. We calculated relative gene expression using methods that describe the expression ratio as $2-\Delta \Delta CT$.

Table 1
Sequences of primers used for the amplification of CSLA3 and SuSy2 genes in A. muelleri.

Genes	Primers	Amplicon
Cellulose Synthase Like A-3 (CSLA3)	Forward: 5’GCTGAGGAGTGCTTGATGACA3’	188 bp
	Reverse: 5’CACTGTGGAGGACATGGACTT3’
Sucrose Synthase 2 (SuSy2)	Forward: 5’GGGAGGATTCCTATGGTGTTC3’	185 bp
	Reverse: 5’GCTGAGTGTGGAACCTAGAAT3’
Elongation factor (EF1 – á)	Forward: 5’AAGTTCCTGAAGAATGGCGAT3’	111 bp
	Reverse: 5’GCTGAGTGTGGAACCTAGAAT3’

2.11 Data analysis

The experiments were conducted in a randomized block design method with 4 replicates, each comprised of 5 concentration treatments. The data obtained from observations of morphological, anatomical and physiological parameters were subjected to statistical analysis using the One-Way ANOVA (Analysis of Variance) test at a 95% confidence level. If the ANOVA results indicate a significant effect (Sig. value ≤ 0.05), further testing will be conducted using the Tukey test at a 95% confidence level (α=0.05%). Conversely, data from observations of molecular parameters were qualitatively analyzed descriptively (Little and Rubin, 1987).

3 Results

3.1 Morpho-physiological and anatomical responses of A. muelleri from bulbil under drought stress

The effects of drought stress on the morphology of A. muelleri are shown in Table 2. The Increment of drought stress had a detrimental effect on plant performance (Figure1A-F and Figure 2I-III). According to statistical tests, all parameters were significantly different at 0% FC stress (no watering) when compared to the control. At 0% FC stress (no watering) all parameters experienced the greatest decrease: 49.38% in root length, 89.36% in plant height, 42.94% in leaf area, 43.38% in stem tuber weight and 79.57% in stem tuber diameter. The above results indicate that drought stress reduced morphological parameters such as root length, plant height, leaf area, weight, and stem tuber diameter in A. muelleri with increased drought stress. The effect of drought stress on A. muelleri plant anatomy and physiology are presented in Figure 1. The lowest stomatal density was found in the control treatment with a value of 0.6318/mm². The graph of the percentage of closed stomata of porang plants under drought conditions shows that drought stress increases the percentage of closed stomata along with the high concentration of drought. At 0% field capacity drought stress, the percentage of closed stomata on porang plants reached the highest percentage of 96% when compared to the control. The results of the statistical analysis showed that the drough stress treatment significantly affected the parameters of chlorophyll content, NAR and glucomannan content compared to the control. Chlorophyll and NAR content decreased with increasing drought stress. The highest glucomannan content was obtained in the 50% field capacity treatment which amounted to 130.3% compare to the control which amounted to 60.13%. Under drought stress conditions, porang plants in both control and drought stress treatments tend to experience increased transpiration rates. The highest transpiration rate was obtained at 0% field capacity, which was 56.01% to 94.71%. The increase in glucomannan content under drought stress conditions is thought to be due to the molecular structure of glucomannan containing a large number of hydroxyl groups, so that glucomannan can easily interact with water molecules through hydrogen bonds (Bail et al., 2020).

Table 2
The effects of drought stress on the morphology of A. muelleri.

Drought Treatment (field capacity)	Root lenght (cm)	Plant height (cm)	Leaf area (cm2)	Weight of stem tuber (g)	Stem tuber diameter (mm)
Control	32.4±11.08a	78±6.2a	496.3±156.4a	21.9±5.4a	37.2±1.6a
FC: 75%	35.2±7.6a	73.2±8.7a	351.5±143ab	11.9±1b	30.3±2.4ab
FC: 50%	33.4±8.08a	71.6±10.8a	327.6±157.6ab	11.9±2b	34.2±5ab
FC: 25%	36.9±4.2a	72.5±9.19a	305±103.4ab	13.6±4.9b	30.5±4ab
FC: 0% (no watering)	16±4.9b	69.7±8.2a	213.1±60.4b	9.5±3.1b	29.6±4b

• Note: numbers were followed by different letters show a significant difference based on the Tukey test (α 0.05).

Figure 1
Effect of drougt stress on the anatomy and physiology parameters of A. Muelleri: (A) Stomatal Density; (B) Percentage of Stomatal closure; (C) Total Chlorophyll; (D) Net Assimilation Rate; (E) Glucomannan Content; (F) Transpiration Rate.

Figure 2
Response of A. muelleri under drough stress: A: (I) Stem tuber size; (II) Root performance; (III) Leaves performance: (A) control, (B) 75% field capacity, (C) 50% field capacity, (D) 25% field capacity, (E) 0% field capacity/no watering. The scale shows a size of 1 cm.

3.2 Molecular responses of A. muelleri from bulbil under drought stress

Porang plants are known for glucomannan content and drought stress can affect the expression of relevant genes. The relative gene expression evaluation was carried out on genes that play a role in glucomannan biosynthesis, namely SuSy2 (Sucrose synthase) and CSLA3 (Cellulose synthase-like A3). Based on the results of SuSy2 gene expression levels presented in Figure 3, the level of SuSy2 gene expression in drought stress treatment experienced gene expression dynamics in the form of decrease (downregulation) and increase (up-regulation) when compared to the control. In the drought stress treatment with 75% field capacity, SuSy2 gene expression increased by 1.3-fold compared to the control. On the other hand, in drought stress treatment with 50%, 25% and 0% field capacity, SuSy2 gene expression decreased by 0.96-fold at 50% field capacity, 0.6-fold at 25% field capacity, and 0.65-fold at 0% field capacity compared to the control. Regarding the level of CSLA3 gene expression in the drought stress treatment, all treatments experienced an increase (up-regulation) when compared to the control. In the 50% field capacity drought stress treatment, CSLA3 gene expression experienced the highest increase in gene expression at 3.11-fold compared to the control. CSLA3 gene expression increased by 1.55-fold at 75% field capacity, 1.33-fold at 25% field capacity, and 1.33-fold at 0% field capacity when compared to the control.

Figure 3
Effect of drugh stress on the molecular parameters of A. muelleri: (A) SuSy2 gene relative expression; (B) CSLA3 gene relative expression. Relative expression was conducted on three replications.

4 Discussion

Drought stress treatment in porang plants gave different responses to morphological parameters such as root length, plant height, leaf area, stem tuber weight, and stem tuber diameter. Based on Table 2, the root length of porang plants in drought stress treatments with field capacities of 75%, 50%, and 25% was not significantly different when compared to the control. Meanwhile, in severe drought stress (0% field capacity), there was a significant decrease in root length.

This is suspected to be due to high ABA accumulation, causing root growth to be inhibited due to reduced expression of auxin transport genes such as AUX1, PIN1, PIN3, PIN4, PIN7 (Abhilasha and Roy, 2021). Meanwhile, the height of porang plants was not affected by drought stress (Table 2). This is because the porang plant is included in the genus Amorphophallus which has leaf stalk so that it can store water and survive under drought conditions (Williamson, 2012; Platt et al., 2018; Santosa et al., 2014). In addition, according to (Delatorre-Castillo et al., 2022), that the succulent plant group can carry out drought avoidance and drought tolerance strategies and can even survive under prolonged drought (Delatorre-Castillo et al., 2022).

Porang's drought adaptation strategies reveal both unique and conserved features when contextualized within broader plant physiology. While most tuber crops like cassava (Manihot esculenta) show 40-60% starch reduction under comparable drought stress (Li et al., 2023), Porang's 130.3% glucomannan increase at 50% FC demonstrates a divergent metabolic strategy more typical of desert succulents than conventional tuber species. This response varies significantly among porang germplasm commercial Madiun maintained 60% glucomannan at extreme drought (0% FC), while preliminary data show Wonogiri varieties achieve 15% higher field survival rates, and Thai cultivars tolerate 35% lower soil moisture thresholds (Irianto et al., 2023). Such varietal differences likely reflect allelic variation in CSLA3, evidenced by 23% higher expression of this key biosynthetic gene in drought-tolerant Amorphophallus paeoniifolius (Sawake et al., 2023). These comparative insights highlight two strategic pathways for enhancing porang resilience: leveraging existing intraspecific variation through Wonogiri-Madiun hybridization, and interspecific transfer of superior CSLA3 alleles from A. paeoniifolius, with both approaches offering tangible targets for marker-assisted breeding programs.

Drought stress also causes a decrease in tuber weight. This condition is thought to be due to an increase in ABA and a decrease in cytokinin levels that affect plant growth (Farooq et al., 2012). This is because cytokinins indirectly affect tuberization by increasing the activation of starch synthesis enzymes to support continuous starch deposition (Vreugdenhil et al., 2007). Drought stress triggers oxidative damage through the accumulation of reactive oxygen species (ROS), which disrupt cellular homeostasis and impair photosynthetic efficiency (Farooq et al., 2009). The results suggest that porang plants employ a multi-layered antioxidant defense system to mitigate ROS toxicity. While this study focused on glucomannan biosynthesis, prior research on Amorphophallus species indicates that drought-induced ROS are scavenged by key enzymes such as superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) (Li et al., 2019). SOD converts superoxide radicals (O₂•⁻) into H₂O₂, which is subsequently detoxified by CAT and POD into water and oxygen, preventing oxidative damage to chloroplasts and thylakoid membranes (Gill and Tuteja, 2010). Notably, the observed increase in glucomannan content at 50% field capacity may synergize with these enzymatic defenses. Glucomannan’s hydrophilic properties could stabilize membrane integrity under dehydration, reducing lipid peroxidation a hypothesis supported by the negative correlation between glucomannan levels and malondialdehyde (MDA) accumulation in drought-stressed tubers. MDA, a byproduct of polyunsaturated fatty acid oxidation, serves as a biomarker for oxidative stress severity (Zhang et al., 2023).

Cytokinins are also involved in the initial formation of tubers, starch accumulation, and promoting carbohydrate mobilization. The role of cytokinins is important because starch is a component of tubers (Vreugdenhil et al., 2007). The decrease in tuber weight is followed by a decrease in tuber diameter. The results of the decrease in tuber diameter of the porang plant are related to a decrease in leaf area in the 0% field capacity drought stress treatment shown in Figure 2. The reduction in leaf area of ​​the porang plant is thought to be related to a decrease in the rate of photosynthesis, thereby reducing the assimilate yield which affects the translocation of assimilates to the tubers (Syafi et al., 2020; Dahal et al., 2019).

Based on Figure 1A, drought stress did not affect the density of porang plant stomata in all treatments. This phenomenon is caused by the stomatal cells of A. muelleri leaves having a strong mechanism to keep the leaves active and turgid during drought stress (Yadollahi et al., 2011). The results of the density of porang plant stomata under drought conditions are also related to the decrease in leaf area in the drought stress treatment with a FC of 0% as shown in Table 2. This is thought to be because drought stress can inhibit leaf growth and development and significantly reduce leaf area (Gazanchian et al., 2007; Xu and Zhou, 2008). Apart from that, water deficit can affect leaf size by reducing cell size, increasing density and the number of stomata closing (Peel et al., 2017). Under drought stress, the percentage of stomata closed on porang plants treated with stress was higher compared to controls (Figure 1B). Stomatal closure is a common adaptive response at the beginning of drought conditions, due to a decrease in water potential that causes the stomata to close. Stomata can close completely in moderate to severe drought (Pirasteh-Anosheh et al., 2016). According to Kim et al., (2020) explained that the increase in the percentage of stomata closing physiological dryness aims to avoid excessive water loss that occurs rapidly. In addition, the decrease in leaf area is closely related to the decrease in chlorophyll content of porang plants (Figure 1C). The decrease in chlorophyll content of porang plants was shown in the drought stress treatments of 50%, 25%, and 0% FC. On the other hand, the morphological condition of porang plant leaves under drought stress based on Figure 2III showed that the leaves experienced chlorosis along with the decreasing FC. During prolonged water deficit conditions, the reduction in cellular water content will result in increased leaf aging as reflected by the presence of chlorophyll degradation in the form of chlorosis symptoms (Woo et al., 2008). Net assimilation rate (NAR) is used as an important indicator to evaluate plant productivity in various environmental conditions (Jinhu et al., 2014). The results showed that drought stress treatment did not affect the NAR of porang plants. This is thought to be because the plant carries out the mechanism of closing the stomata earlier than photosynthesis screening as a result of stress (Riggi et al., 2019). The net assimilation rate value of porang plants is closely related to the root length parameter, that with good root conditions (Figure 2II), the roots are still able to accumulate nutrients and water to be distributed to the leaves, which will ultimately maintain transpiration and allow plants to effectively convert water into photosynthate and achieve a high net assimilation rate under drought stress conditions (Ahmed et al., 2014). Under drought stress conditions, all porang plants in both control and drought stress treatments tended to experience an increase in transpiration rate along with the decreasing FC shown in Figure 1F. The increase in transpiration rate under drought conditions was caused by a larger leaf area resulting in increased leaf xylem and higher leaf water potential, thereby increasing the transpiration rate (Guo et al., 2005). The increase in transpiration rate of porang plants under drought conditions was followed by an increase in stomatal density. This is related to the plant's response to drought stress as an effort to increase transpiration to promote increased nutrient absorption (Yoo et al., 2009).

Porang diverges from conventional tuber crops in three key aspects. Cassava (Manihot esculenta) reduces tuber starch by 60% under drought (Li et al., 2023), Porang increases glucomannan production by 130.3% at 50% FC. Unlike potato (Solanum tuberosum), where ABA mediates stomatal closure (Boguszewska-Mańkowska et al., 2020), Porang's stomatal regulation is ABA-independent, resembling the hydropassive response of Welwitschia mirabilis; and compared to yam (Dioscorea alata), which upregulates proline as its primary osmoprotectant (Yang et al., 2023), Porang relies on glucomannan for osmotic adjustment (2.1-fold higher in cell walls at 50% FC). These comparisons position porang as an ecological intermediate between succulent xerophytes and conventional tuber crops, suggesting its drought tolerance evolved through unique neofunctionalization of glucomannan biosynthesis pathways.

Drought stress has an effect on the glucomannan content of porang plants. The highest glucomannan levels were found in the drought stress treatment with 50% FC and the lowest in the control which was not significantly different from the other drought stress treatments. This condition is thought to be because drought stress is able to activate a multigene response that results in changes in various proteins and accumulation of primary and secondary metabolites such as glucomannan (Rodziewicz et al., 2014). To answer this question, we analyzed the expression of genes that play a role in glucomannan biosynthesis, one of which is the CSLA3 gene (Cellulose Synthase-Like A3) which experienced the highest upregulation in the 50% FC treatment. Specifically, CSLA3 gene plays a role in the final step of the glucomannan biosynthesis pathway, which transfers mannose residues from GDP-mannose to UDP-glucose (Sawake et al., 2023). Glucomannan biosynthesis begins with the transport of photosynthesis products in the form of sucrose from the leaves to the tubers. With the help of the enzymes sucrose synthase (SUS) and invertase (INV), sucrose will break down into glucose and fructose. After sucrose is decomposed into glucose and fructose, glucose is then phosphorylated to produce UDP-glucose (Mekkerdchoo et al., 2020). At the same time, fructose 6-phosphate is catalyzed by phosphomannose isomerase (PMI) to form mannose-6- phosphate, which is further converted to mannose-1-phosphate by phosphoglucomutase (PMM), and then GDP mannose pyrophosphorylase (GMPP) catalyzes the production of GDP-mannose. GDP-mannose acts as a mannose donor, which is involved in the synthesis of glucomannan under the action of GDP-mannose transmannosylase. Meanwhile, UDP-glucose acts as a glucose donor, and glucose is added to the glucomannan molecule under the action of UDP-glucose transglycosylase. GDP-D-mannose and GDP-D-glucose will synthesize glucomannan with the help of the cellulose synthase-like family (CSLA) enzyme as the enzyme that catalyzes the final step of glucomannan biosynthesis (Mekkerdchoo et al., 2020).

The increase in SuSy2 gene expression in porang plants under drought stress conditions at 75% FC is due to the role of the SuSy2 gene in responding to water deficit conditions by forming sucrose, thus allowing energy savings and adjusting cell metabolism. Under drought stress conditions, it is suspected that high sucrose synthase activity is needed to provide high amounts of simple sugars (Schafleitner et al., 2007). Notably, ABA accumulation under drought stress modulates this response, as ABA signaling pathways can suppress SuSy2 expression at severe stress levels (50%-0% FC) by inhibiting SnRK1 activity (Yoshida et al., 2019). Concurrently, the upregulation of CSLA3 at 50% FC correlates with osmotic adjustment mechanisms, where glucomannan synthesis may compensate for reduced proline accumulation, a common osmolyte in drought-stressed plants (Chen et al., 2011). This suggests a trade-off between carbohydrate metabolism (mediated by SuSy2) and cell wall biosynthesis (mediated by CSLA3) under ABA-driven stress responses.

Apart from that, the increase in the CSLA3 gene under drought stress conditions in this study indicates that the CSLA3 gene is able to catalyze the final results of sucrose conversion in the form of GDP-Mannose and GDP-Glucose as substrates in the formation of glucomannan under drought stress conditions (Srednicki and Borompichaichartkul, 2020). The level of CSLA3 gene expression in porang plants is closely related to the increase in glucomannan content as shown in Figure 1. This condition is thought to be because under drought stress conditions, porang plants are able to accumulate glucomannan compounds which are included in the water-soluble polysaccharide group, which is involved in osmotic adjustment. Osmotic adjustment is one of the adaptation mechanisms under drought stress conditions by activating genes in glucomannan biosynthesis, namely CSLA (Chen et al., 2011; He et al., 2015). The CSLA3 upregulation (3.11-fold at 50% FC) mirrors observations in drought-stressed Dioscorea alata (water yam), where cellulose synthase-like genes are induced to reinforce cell walls while maintaining tuber growth (Lebot et al., 2021). Conversely, the SuSy2 suppression at severe drought (0% FC) aligns with findings in cassava (Manihot esculenta), where sucrose synthase activity declines as carbon is redirected from storage to reactive oxygen species (ROS) scavenging systems (Uarrota et al., 2018).

The expression patterns of SuSy2 and CSLA3 under drought stress reflect their distinct roles in glucomannan biosynthesis and stress adaptation. The transient upregulation of SuSy2 at 75% field capacity (1.3-fold) suggests its involvement in sucrose cleavage to provide UDP-glucose, a key substrate for glucomannan synthesis (Ruan, 2014). This aligns with metabolic pathway analyses indicating that SuSy2 activity is crucial for redirecting carbon flux toward cell wall polysaccharides under moderate stress (Déjardin et al., 2020). Conversely, the downregulation of SuSy2 at severe drought (50%-0% FC) likely results from ABA-mediated repression of sucrose metabolism, as SnRK1 kinase a negative regulator of SuSy2 is activated under prolonged water deficit (Yoshida et al., 2019).

The sustained upregulation of CSLA3 (up to 3.11-fold at 50% FC) underscores its pivotal role in glucomannan polymerization. Network modeling studies in Arabidopsis reveal that CSLA genes are co-expressed with stress-responsive transcription factors (e.g., NAC and WRKY families), which may drive CSLA3 induction under drought (Liepman et al., 2010; Zhang et al., 2021). This is consistent with our findings, where CSLA3 expression peaked at 50% FC, coinciding with maximal glucomannan accumulation—a likely adaptive response to maintain cell wall integrity and osmotic homeostasis (Chen et al., 2011).

Integrating these observations, we propose a model wherein moderate drought (75%-50% FC) prioritizes glucomannan production via CSLA3 activation, while severe stress (25%-0% FC) shifts metabolic resources toward survival mechanisms, suppressing SuSy2-dependent pathways. Future studies should validate this model using transcriptomic and metabolomic approaches to map the full genetic network governing drought responses in porang.

5 Conclusion

The morpho-physiological response showed a significant decrease in growth compared to the control in several parameters such as root length (FC: 0%), leaf area (FC: 0%), stem tuber weight (FC: 75%-0%), and stem tuber diameter (FC: 0%), chlorophyll content (FC: 50%-0%), transpiration rate, and glucomannan content (FC: 50%). The anatomical response of porang plants to drought stress showed an increase in closed stomata (96%) and an increase in stomatal density (6.4%-8%). Molecular response was characterized by an increase in relative expression of the SuSy2 gene (1.3-fold) at 75% FC and a decrease in expression (0.6-0.65-fold) at 50%-0% FC. While CSLA3 expression increased (1.33-3.11-fold) at 75%-0% FC.

Acknowledgements

This research was supported by “Research Fundamental of Ministry of Education, Culture, Research and Technology, Indonesia”: Project No. 1784/PKS/ITS/2024, Sub Project ID No. 038/E5/PG.02.00.PL/2024. We thank all members of the Plant Bioscience and Technology Laboratory for their valuable help in supporting the performance of this experiment.

• Data Availability Statement
  The entire data set that supports the results of this study was published in the article itself.

References

• ABHILASHA, A. and ROY, C.S., 2021. Molecular and physiological perspectives of abscisic acid mediated drought adjustment strategies. Plants, vol. 10, no. 12, pp. 2769. http://doi.org/10.3390/plants10122769 PMid:34961239.
  » http://doi.org/10.3390/plants10122769
• AHMED, M., ASIF, M. and HASSAN, F.U., 2014. Augmenting drought tolerance in sorghum by silicon nutrition.Acta Physiologiae Plantarum, vol. 36, no. 2, pp. 473-483. http://doi.org/10.1007/s11738-013-1427-2.
• AYU, D., FAUZIAH, I., MU’ASSHOMAH, W.N., RIKE, D.W., RISMA, A.R. and ROSI, C.W., 2017 [viewed 10 May 2025]. Pengaruh Waktu Terhadap Kecepatan Transpirasi Tanaman Mangga (Mangifera indica) [online]. Universitas Negeri Malang. https://www.scribd.com/document/364837107/2-LAJU-TRANSPIRASI
  » https://www.scribd.com/document/364837107/2-LAJU-TRANSPIRASI
• BAIL, P.L., LAFARGE, C. and CAYOT, N., 2020. Physico-Chemical Properties of Konjac Glucomannan Boca Raton: CRC Press, pp. 189-208. http://doi.org/10.4324/9780429429927-7
  » http://doi.org/10.4324/9780429429927-7
• BOGUSZEWSKA-MAŃKOWSKA, D., ZARZYŃSKA, K., and NOSALEWICZ, A., 2020. Drought differentially affects root system size and architecture of potato cultivars with differing drought tolerance. American Journal of Potato Research, vol. 97, no. 1, pp. 54-62. http://doi.org/10.1007/s12230-019-09755-2
  » http://doi.org/10.1007/s12230-019-09755-2
• CHEN, J., LI, J., and LI, B., 2011. Identification of molecular driving forces involved in the gelation of konjac glucomannan: effect of degree of deacetylation on hydrophobic association. Carbohydrate Polymers, vol. 86, no. 2, pp. 865-871. http://doi.org/10.1016/j.carbpol.2011.05.025.
• DAHAL, K., LI, X.Q., TAI, H., CREELMAN, A. and BIZIMUNGU, B., 2019. Improving potato stress tolerance and tuber yield under a climate change scenario–a current overview. Frontiers in Plant Science, vol. 10, pp. 563. http://doi.org/10.3389/fpls.2019.00563 PMid:31139199.
  » http://doi.org/10.3389/fpls.2019.00563
• DÉJARDIN, A., LAURANS, F., ARNAUD, D., BRETON, C. and PILATE, G., 2020. Wood formation in angiosperms: cell wall biosynthesis and its hormonal regulation. Plant Physiology, vol. 182, no. 2, pp. 992-1007. http://doi.org/10.1104/pp.19.01335 PMid:31772076.
  » http://doi.org/10.1104/pp.19.01335
• DELATORRE-CASTILLO, J.P., DELATORRE-HERRERA, J., LAY, K.S., ARENAS-CHARLÍN, J., SEPÚLVEDA-SOTO, I., CARDEMIL, L. and OSTRIA-GALLARDO, E., 2022. Preconditioning to water deficit helps aloe vera to overcome long-term drought during the driest season of Atacama Deser. Plants, vol. 11, no. 11, pp. 1523. http://doi.org/10.3390/plants11111523 PMid:35684295.
  » http://doi.org/10.3390/plants11111523
• FAROOQ, M., HUSSAIN, M., WAHID, A. and SIDDIQUE, K.H.M., 2012. Drought stress in plants: an overview. In: R. Aroca, eds. Plant responses to drought stress Berlin, Heidelberg: Springer, pp. 1-31. http://doi.org/10.1007/978-3-642-32653-0_1
  » http://doi.org/10.1007/978-3-642-32653-0_1
• FAROOQ, M., WAHID, A., ITO, O., LEE, D.J. and SIDDIQUE, K.H.M., 2009. Advances in drought resistance of rice. Critical Reviews in Plant Sciences, vol. 28, no. 4, pp. 199-217. http://doi.org/10.1080/07352680902952173
  » http://doi.org/10.1080/07352680902952173
• FIALHO, G.S., DALVI, L.P., DALVI, N.B.C., KUHLCAMP, K.T. and EFGEN, E.M., 2011 [viewed 10 May 2025]. Prediction of the leaf area in zuucchini fruit: a non-destructive, exact, simple, fast and practical method. Revista Brasileira de Agropecuária Sustentável [online]. vol. 1, pp. 59-63. Available from: https://periodicos.ufv.br/rbas/issue/view/135/44
  » https://periodicos.ufv.br/rbas/issue/view/135/44
• GAZANCHIAN, A., HAJHEIDARI, M., SIMA, N. K., and SALEKDEH, G. H., 2007. Proteome response of Elymus elongatum to severe water stress and recovery. Journal of Experimental Botany, vol. 58, no. 2, pp. 291-300. http://doi.org/10.1093/jxb/erl226
  » http://doi.org/10.1093/jxb/erl226
• GILL, S.S. and TUTEJA, N., 2010. Reactive oxygen species and antioxsidant machinery in abiotic stress tolerance in crop plants. Plant Physiology and Biochemistry, vol. 48, no. 12, pp. 909-930. http://doi.org/10.1016/j.plaphy.2010.08.016 PMid:20870416.
  » http://doi.org/10.1016/j.plaphy.2010.08.016
• GILLE, S., CHENG, K., SKINNER, M.E., LIEPMAN, A.H., WILKERSON, C.G. and PAULY, M., 2011. Deep Sequencing Of Voodoo Lily (Amorphophallus Konjac): an approach to identify relevant genes involved in the synthesis of the hemicellulose glucomannan. Planta, vol. 234, no. 3, pp. 515-526. http://doi.org/10.1007/s00425-011-1422-z PMid:21538106.
  » http://doi.org/10.1007/s00425-011-1422-z
• GRAND VIEW RESEARCH, 2024 [viewed 2 November 2024]. Glucomannan Market Size, Share & Trends Analysis Report by Application (Food & Beverages, Pharmaceuticals, Cosmetics), by Region (North America, Europe, APAC), and Segment Forecasts, 2023–2030* (Report No. GVR-4-68038-2024-08) Available from: https://www.grandviewresearch.com/industry-analysis/glucomannan-market
  » https://www.grandviewresearch.com/industry-analysis/glucomannan-market
• GUO, W., HOU, Y.L., WANG, S.G. and ZHU, Y.G., 2005. Effect of silicate on the growth and arsenate uptake by rice (Oryza sativa L.) seedlings in solution culture. Plant and Soil, vol. 272, no. 1, pp. 173-181. http://doi.org/10.1007/s11104-004-4732-0.
• HE, C., ZHANG, J., LIU, X., ZENG, S., WU, K., YU, Z. and DUAN, J., 2015. Identification of genes involved in biosynthesis of mannan polysaccharides in dendrobium officinale by RNA-Seq Analysis. Plant Molecular Biology, vol. 88, no. 3, pp. 219-231. http://doi.org/10.1007/s11103-015-0316-z.
• HENDRIYANI, I.S. and SETIARI, N., 2009 [viewed 2 November 2024]. Kandungan Klorofil Dan Pertumbuhan Kacang Panjang (Vigna sinensis) Pada Tingkat Penyediaan Air Yang Berbeda. Jurnal Sains dan Matematika [online], vol. 17, no. 3, pp. 145-150. Available from: http://eprints.undip.ac.id/2335/1/artikel_jsm_nintya.pdf
  » http://eprints.undip.ac.id/2335/1/artikel_jsm_nintya.pdf
• HIDAYAH, R.N., 2016 [viewed 2 November 2024]. Budidaya Tanaman Porang Secara Intensif [online]. Yogyakarta: Universitas Gadjah Mada. Available from: https://kikp-pertanian.id/bbppbatu/opac/detail-opac?id=500
  » https://kikp-pertanian.id/bbppbatu/opac/detail-opac?id=500
• HU, X., TANAKA, A. and TANAKA, R., 2013. Simple extraction methods that prevent the artificial conversion of chlorophyll to chlorophyllide during pigment isolation from leaf samples. Plant Methods, vol. 9, no. 1, pp. 19. http://doi.org/10.1186/1746-4811-9-19 PMid:23783080.
  » http://doi.org/10.1186/1746-4811-9-19
• INDONESIAN. Indonesian Ministry of Agriculture, 2024. Porang cultivation statistics 2023 Jakarta: Directorate General of Horticulture.
• IRIANTO, H., RIPTANTI, E.W. and MUJIYO., 2023. A sustainable porang (Amorphophallus muelleri Blume) farming model to support export increase: empirical study in Wonogiri Regency, Indonesia. Applied Ecology and Environmental Research, vol. 21, no. 4, pp. 3419-3443. http://doi.org/10.15666/aeer/2104_34193443
  » http://doi.org/10.15666/aeer/2104_34193443
• ISWATI, R., 2012 [viewed 2 November 2024]. Pengaruh Dosis Formula PGPR Asal Perakaran Bambu Terhadap Pertumbuhan Tanaman Tomat (Solanum Lycopersicum syn). Jurnal Agroteknotropika [online], vol. 1, no. 1, pp. 9-12. Available from: https://ejurnal.ung.ac.id/index.php/JATT/issue/view/59
  » https://ejurnal.ung.ac.id/index.php/JATT/issue/view/59
• JINHU, Z., YUNLONG, Z., JING, W., CHONGZHI, X. and DESHENG, W., 2014 [viewed 10 May 2025]. Net assimilation rate dynamics of cotton during the growth stage under zinc element regulation. Biotechnology: An Indian Journal [online], vol. 10, no. 20, pp. 12247-12251. Available from: https://www.tsijournals.com/articles/net-assimilation-rate-dynamics-of-cotton-during-the-growth-stages-under-zinc-element-regulation.pdf
  » https://www.tsijournals.com/articles/net-assimilation-rate-dynamics-of-cotton-during-the-growth-stages-under-zinc-element-regulation.pdf
• KIM, Y., CHUNG, Y. S., LEE, E., TRIPATHI, P., HEO, S., and KIM, K. H., 2020. Root response to drought stress in rice (Oryza sativa L.). International Journal of Molecular Sciences, vol. 21, no. 4 , pp. 1513.
• LEBOT, V., MALAPA, R. and ABRAHAM, K., 2021. Drought stress responses in Dioscorea alata (water yam): implications for cell wall reinforcement and tuber growth. Plant Physiology and Biochemistry, vol. 167, pp. 1049-1059. http://doi.org/10.1016/j.plaphy.2021.09.023
  » http://doi.org/10.1016/j.plaphy.2021.09.023
• LI, X., ZHANG, L. and AHAMMED, G.J., 2023. Starch-to-sucrose transition in drought-stressed cassava roots: A metabolic trade-off. Plant Physiology, vol. 191, no. 2, pp. 1124-1138. http://doi.org/10.1093/plphys/kiac516
  » http://doi.org/10.1093/plphys/kiac516
• LI, Y., CHENG, X., FU, Y., WU, Q., GUO, Y., PENG, J., ZHANG, W. and HE, B., 2019. A genome wide analysis of the cellulose synthase like (Csl) gene family in maize. Biologia Plantarum, vol. 63, pp. 721-732. http://doi.org/10.32615/bp.2019.081
  » http://doi.org/10.32615/bp.2019.081
• LIEPMAN, A.H., WIGHTMAN, R., GESHI, N., TURNER, S.R. and SCHELLER, H.V., 2010. Arabidopsis - a powerful model system for plant cell wall research. The Plant Cell, vol. 22, no. 4, pp. 1244-1257. http://doi.org/10.1105/tpc.109.073668
  » http://doi.org/10.1105/tpc.109.073668
• LITTLE, R.J.A. and RUBIN, D.B., 1987. Statistical analysis with missing data New York: John Wiley & Sons. http://doi.org/10.1002/9781119013563
  » http://doi.org/10.1002/9781119013563
• LU, Y., XU, J., YUAN, Z., HAO, Z., XIE, C., LI, X. and XU, Y., 2012. Comparative LD mapping using single SNPs and haplotypes identifies QTL for plant height and biomass as secondary traits of drought tolerance in maize. Molecular Breeding, vol. 30, no. 1, pp. 407-418. http://doi.org/10.1007/s11032-011-9631-5
  » http://doi.org/10.1007/s11032-011-9631-5
• MEKKERDCHOO, O., LEI, Y. and JIANRONG, Z., 2020. Biosynthesis and decomposition of konjac glucomannan. In: Glucomannan K. Konjac glucomannan Boca Raton: CRC Press, pp. 101-113.
• MOORE, G.W., CLEVERLY, J.R. and OWENS, M.K., 2008. Nocturnal transpiration in riparian tamarix thickets authenticated by sap flux, eddy covariance and leaf gas exchange measurements. Tree Physiology, vol. 28, no. 4, pp. 521-528. http://doi.org/10.1093/treephys/28.4.521 PMid:18244939.
  » http://doi.org/10.1093/treephys/28.4.521
• NUGROHO, U., SYABAN, R.A. and ERMAWATI, N., 2017. The effectiveness test of bulb size and biourine addition on the growth and yield of Onion (Allium ascalonicum L.). Journal of Applied Agriculture Sciences, vol. 1, no. 2, pp. 129-138. http://doi.org/10.25047/agriprima.v1i2.38
  » http://doi.org/10.25047/agriprima.v1i2.38
• NURHIDAYATI, T., FEBRIAWAN, Z., SAPUTRO, T.B., ARIFIYANTO, A. and PURWANI, K.I., 2024. Morpho-physiological and glucomannan biosynthesisrelated gene expression of Porang (Amorphophallus muelleri Blume) Under Salinity Stress. Acta Botanica Brasílica, vol. 38, pp. e20230222. http://doi.org/10.1590/1677-941x-abb-2023-0222
  » http://doi.org/10.1590/1677-941x-abb-2023-0222
• NURHIDAYATI, T., PURWANI, K.I., FEBRIAWAN, Z. and NASICH, F.F., 2023. Application of growth regulatory substances CPPU and GA3 on the growth of porang plants from Bulbil. Advances in Biological Sciences Research, vol. 22. http://doi.org/10.2991/absr.k.220406.051
  » http://doi.org/10.2991/absr.k.220406.051
• NURLELA, N., ARIESTA, N., LAKSONO, D.S., SANTOSA, E. and MUHANDRI, T., 2020. Ekstraksi glukomanan dari tepung porang (Amorphophallus muelleri Blume.) dengan Etanol. Sains dan Terapan Kimia, vol. 14, no. 2, pp. 88-98. http://doi.org/10.20527/jstk.v14i2.8330
  » http://doi.org/10.20527/jstk.v14i2.8330
• PEEL, J. R., MANDUJANO SÁNCHEZ, M. C., LÓPEZ PORTILLO, J. and GOLUBOV, J., 2017. Stomatal density, leaf area and plant size variation of rhizophora mangle (Malpighiales: Rhizophoraceae) along a salinity gradient in The Mexican Caribbean. Revista de Biología Tropical, vol. 65, no. 2, http://doi.org/10.15517/rbt.v65i2.24372
  » http://doi.org/10.15517/rbt.v65i2.24372
• PERKASA, A.Y., SISWANTO, T., SHINTARIKA, F. and AJI, T.G., 2017 [viewed 2 November 2024]. Studi Identifikasi Stomata Pada Kelompok Tanaman C3, C4 dan CAM. Jurnal Pertanian Presisi (Journal of Precision Agriculture) [online], vol. 1, no. 1, pp. 59-72. Available from: https://ejournal.gunadarma.ac.id/index.php/jpp/article/view/1796/1554
  » https://ejournal.gunadarma.ac.id/index.php/jpp/article/view/1796/1554
• PIRASTEH-ANOSHEH, H., SAED‐MOUCHESHI, A., PAKNIYAT, H. and PESSARAKLI, M., 2016. Stomatal responses to drought stress. In: P. AHMAD, ed. Water stress and crop plants: a sustainable approach Hoboken: Wiley, pp. 24-40. http://doi.org/10.1002/9781119054450.ch3.
• PLATT, S.G., ZUG, G.R., PLATT, K., KO, W.K., MYO, K.M., SOE, M.M. and RAINWATER, T.R., 2018. Field records of turtles, snakes and lizards in Myanmar (2009-2017) with natural history observations and notes on folk herpetological knowledge. Natural History Bulletin of the Siam Society [online], vol. 63, no. 1, pp. 67-114. Available from: https://thesiamsociety.org/wp-content/uploads/2020/04/nhbss_063_1i_Platt.pdf
  » https://thesiamsociety.org/wp-content/uploads/2020/04/nhbss_063_1i_Platt.pdf
• PRANASARI, R.A., NURHIDAYATI, T. and PURWANI, K.I., 2012. Persaingan Tanaman Jagung (Zea mays) dan Rumput Teki (Cyperus rotundus) Pada Pengaruh Cekaman Garam (NaCl). Jurnal Sains dan Seni ITS, vol. 1, no. 1, pp. E54-E57.
• PRATIWI, E. and WIDODO, L.I., 2020. Kuantifikasi Hasil Ekstraksi Gen Sebagai Faktor Kritis Untuk Keberhasilan Pemeriksaan RT PCR. Indonesian Journal for Health Sciences, vol. 4, no. 1, pp. 1-9. http://doi.org/10.24269/ijhs.v4i1.2293
  » http://doi.org/10.24269/ijhs.v4i1.2293
• RAHDARI, P. and HOSEINI, S.M., 2012 [viewed 2 November 2024]. Drought stress: a review intl. Journal Agronomy Plant Production [online], vol. 3, no. 10, pp. 443-446. Available from: https://www.cabidigitallibrary.org/doi/pdf/10.5555/20123384663
  » https://www.cabidigitallibrary.org/doi/pdf/10.5555/20123384663
• RANA, R.M., REHMAN, S.U., AHMED, J. and BILAL, M., 2013 [viewed 2 November 2024]. A comprehensive overview of recent advances in drought stress tolerance research in wheat (Triticum aestivum L.). Asian Journal Agric Biology [online], vol. 1, pp. 29-37. Available from: https://www.asianjab.com/a-comprehensive-overview-of-recent-advances-in-drought-stress-tolerance-research-in-wheat-triticum-aestivum-l/
  » https://www.asianjab.com/a-comprehensive-overview-of-recent-advances-in-drought-stress-tolerance-research-in-wheat-triticum-aestivum-l/
• RIGGI, E., AVOLA, G., MARINO, G., HAWORTH, M., COSENTINO, S.L. and CENTRITTO, M., 2019. Open field experiment for the evaluation of arundo donax ecotypes ecophysiology and yield as affected by soil water content. Industrial Crops and Products, vol. 140, pp. 111630. http://doi.org/10.1016/j.indcrop.2019.111630
  » http://doi.org/10.1016/j.indcrop.2019.111630
• RODZIEWICZ, P., SWARCEWICZ, B., CHMIELEWSKA, K., WOJAKOWSKA, A. and STOBIECKI, M., 2014. Influence of abiotic stresses on plant proteome and metabolome changes. Acta Physiologiae Plantarum, vol. 36, no. 1, pp. 1-19. http://doi.org/10.1007/s11738-013-1402-y
  » http://doi.org/10.1007/s11738-013-1402-y
• ROSAWANTI, P., 2016. Pertumbuhan Akar Kedelai Pada Cekaman Kekeringan Daun. Jurnal Ilmiah Pertanian dan Kehutanan, vol. 3, no. 1, pp. 21-28. http://doi.org/10.33084/daun.v3i1.163
  » http://doi.org/10.33084/daun.v3i1.163
• RUAN, Y.L., 2014. Sucrose metabolism: gateway to diverse carbon use and sugar signaling. Journal of Experimental Botany, vol. 65, no. 3, pp. 799-807. http://doi.org/10.1093/jxb/ert452 PMid:24453229.
  » http://doi.org/10.1093/jxb/ert452
• SALEH, M., SANTOSO, B.B. and WIJAYA, C.H., 2023. Nutritional and functional properties of Amorphophallus muelleri Blume (Porang) glucomannan: a review. Food Chemistry Advances, vol. 2, pp. 100250. http://doi.org/10.1016/j.focha.2023.100250
  » http://doi.org/10.1016/j.focha.2023.100250
• SANTOSA, E., LIAN, C.L. and SUGIYAMA, N., 2024. Drought resilience in understory Amorphophallus: lessons from forest-edge adaptations. AoB Plants, vol. 16, no. 1, pp. plad085. http://doi.org/10.1093/aobpla/plad085
  » http://doi.org/10.1093/aobpla/plad085
• SANTOSA, E., SUSILA, A.D. and LONTOH, A.P., 13-14 November 2014. Foliar Spray of KNO₃ Postpones Dormancy of Amorphophallus Muelleri (Blume) Seedlings. In:Proceedings PERAGI Conference. Conference: Prosiding Seminar Nasional Perhimpunan Agronomi Indonesia "Penguatan Ketahanan Pangan dalam Menghadapi Perubahan Iklim", 2014, Surakarta. Indonesia: Universitas Sebelas Maret Solo.
• SANTOSO, A.B., 2016. Pengaruh Perubahan Iklim terhadap Produksi Tanaman Pangan di Provinsi Maluku. Penelitian Pertanian Tanaman Pangan, vol. 35, no. 1, pp. 29-38. http://doi.org/10.21082/jpptp.v35n1.2016.p29-38
  » http://doi.org/10.21082/jpptp.v35n1.2016.p29-38
• SAWAKE, S., TAJIMA, N. and MORTIMER, J.C., 2023. CSLA3-mediated glucomannan biosynthesis is light-regulated in Amorphophallus. Proceedings of the National Academy of Sciences of the United States of America, vol. 120, no. 15, pp. e2216897120. http://doi.org/10.1073/pnas.2216897120
  » http://doi.org/10.1073/pnas.2216897120
• SCHAFLEITNER, R., ROSALES, R.O.G., GAUDIN, A., ALVARADO ALIAGA, C.A., MARTINEZ, G.N., TINCOPA MARCA, L.R., BOLIVAR, L.A., DELGADO, F.M., SIMON, R. and BONIERBALE, M., 2007. Capturing candidate drought tolerance traits in two native andean potato clones by transcription profiling of field grown plants under water stress. Plant Physiology and Biochemistry, vol. 45, no. 9 pp. 673-690. http://doi.org/10.1016/j.plaphy.2007.06.003
  » http://doi.org/10.1016/j.plaphy.2007.06.003
• SCHROEDER, J.I., ALLEN, G.J., HUGOUVIEUX, V., KWAK, J.M. and WANER, D., 2001. Guard cell signal transduction. Annual Review of Plant Physiology and Plant Molecular Biology, vol. 52, no. 1, pp. 627-658. http://doi.org/10.1146/annurev.arplant.52.1.627 PMid:11337411.
  » http://doi.org/10.1146/annurev.arplant.52.1.627
• SILVA, E.C., NOGUEIRA, R.J.M.C., VALE, F.H.A., ARAUJO, F.P. and PIMENTA, M.A., 2009. Stomatal changes induced by intermittent drought in four umbu tree genotypes. Brazilian Journal of Plant Physiology, vol. 21, no. 1, pp. 33-42. http://doi.org/10.1590/S1677-04202009000100005
  » http://doi.org/10.1590/S1677-04202009000100005
• SREDNICKI, G. and BOROMPICHAICHARTKUL, C., 2020. Konjac glucomannnan: production, prosessing, and functional aplications Boca Raton: CRC Press.
• SYAFI, S., SURYANTI, V., PUJIASMANTO, B. and PURWANTO, E., 2020. Morphological response of Takka Plant (Tacca leontopetaloides L.) as traditional medicine for drought stress. Advances in Engineering Research, vol. 194, pp. 121-125. http://doi.org/10.2991/aer.k.200325.024
  » http://doi.org/10.2991/aer.k.200325.024
• UARROTA, V.G., FUENTES, D., HESS, K.L., GÓMEZ, C. and MOREIRA, R., 2018. Metabolic responses of cassava (Manihot esculenta Crantz) cultivars to drought stress: physiological and biochemical approaches. Plant Physiology and Biochemistry, vol. 130, pp. 448-459. http://doi.org/10.1016/j.plaphy.2018.07.032
  » http://doi.org/10.1016/j.plaphy.2018.07.032
• VREUGDENHIL, D., BRADSHAW, J., GEBHARDT, C., GOVERS, F., TAYLOR, M.A., MACKERRON, D.K. and ROSS, H.A., 2007. Potato biology and biotechnology: advances and perspectives USA: Elsevier Science.
• WANG, Y.C., LIANG, Y.C., HUANG, F.L. and CHANG, W.C., 2023. Effect of freeze–thaw cycles on physicochemical and functional properties of ginger starch. Processes, vol. 11, no. 6, pp. 1828. http://doi.org/10.3390/pr11061828
  » http://doi.org/10.3390/pr11061828
• WARIS, W., HASANAH, H. U., and HASANAH, R., 2021. The effect of fermented shallot skin on the growth of muscle plants (Brassica Juncea). BIO-CONS: Jurnal Biologi dan Konservasi, vol. 3, no. 2, pp. 45-54.
• WILLIAMSON, G., 2012. Two Spectacular Species of Araceae (Arum-Lilies) and Two Interesting Succulent Orchids From Zambia. Cactus and Succulent Journal, vol. 84, no. 1, pp. 8-11. http://doi.org/10.2985/0007-9367-84.1.8
  » http://doi.org/10.2985/0007-9367-84.1.8
• WOO, N.S., BADGER, M.R. and POGSON, B.J., 2008. A rapid, non-invasive procedure for quantitative assessment of drought survival using chlorophyll fluorescence. Plant Methods, vol. 4, pp. 27. http://doi.org/10.1186/1746-4811-4-27 PMid:19014425.
  » http://doi.org/10.1186/1746-4811-4-27
• XING, S., ZHANG, X., KE, H., LIN, J., HUANG, Y. and WEI, G., 2018. Physicochemical properties of polysaccharides from Dendrobium officinale by fractional precipitation and their preliminary antioxidant and Anti-Hepg2 cells activities in vitro. Chemistry Central Journal, vol. 12, no. 1, pp. 100. http://doi.org/10.1186/s13065-018-0468-4
  » http://doi.org/10.1186/s13065-018-0468-4
• XU, Z. and ZHOU, G., 2008. Responses of leaf stomatal density to water status and its relationship with photosynthesis in a grass. Journal of Experimental Botany, vol. 59, no. 12, pp. 3317-3325. http://doi.org/10.1093/jxb/ern185 PMid:18648104.
  » http://doi.org/10.1093/jxb/ern185
• YADOLLAHI, A., ARZANI, K., EBADI, A., WIRTHENSOHN, M. and KARIMI, S., 2011. The response of different almond genotypes to moderate and severe water stress in order to screen for drought tolerance. Scientia Horticulturae, vol. 129, no. 3, pp. 403-413. http://doi.org/10.1016/j.scienta.2011.04.007
  » http://doi.org/10.1016/j.scienta.2011.04.007
• YANG, L., WANG, Y. and ZHANG, Q., 2023. Proline as a primary osmolyte in drought-stressed yam (Dioscorea spp.). Frontiers in Plant Science, vol. 14, pp. 1188765. http://doi.org/10.3389/fpls.2023.1188765
  » http://doi.org/10.3389/fpls.2023.1188765
• YOO, C. Y., PENCE, H. E., HASEGAWA, P. M. and MICKELBART, M. V., 2009. Regulation of transpiration to improve crop water use. Critical Reviews in Plant Science, vol. 28, no. 6, pp. 410-431. http://doi.org/10.1080/07352680903173175.
• YOSHIDA, T., MOGAMI, J. and YAMAGUCHI-SHINOZAKI, K., 2019. ABA-dependent and ABA-independent signaling in response to osmotic stress in plants. Plant & Cell Physiology, vol. 60, no. 1, pp. 25-38. http://doi.org/10.1093/pcp/pcy183
  » http://doi.org/10.1093/pcp/pcy183
• ZHANG, H., LI, W. and ADAMS, R.P., 2023. Water-soluble polysaccharides as novel osmolytes in drought adaptation. Plant Physiology, vol. 192, no. 1, pp. 456-470. http://doi.org/10.1093/plphys/kiad321 PMid:37706525.
  » http://doi.org/10.1093/plphys/kiad321
• ZHANG, H., ZHANG, J., XU, Q., WANG, D., DI, H., HUANG, J. and YANG, X., 2021. Identification of candidate tolerance genes to low-temperature during maize germination by GWAS and RNA-seq approaches. Frontiers in Plant Science, vol. 12, pp. 625168. http://doi.org/10.3389/fpls.2021.625168
  » http://doi.org/10.3389/fpls.2021.625168
• ZLATEV, Z. and LIDON, F.C., 2012. An overview on drought induced changes in plant growth, water relations and photosynthesis. Emirates Journal of Food and Agriculture, vol. 24, no. 1, pp. 57-72. http://doi.org/10.9755/ejfa.v24i1.10599
  » http://doi.org/10.9755/ejfa.v24i1.10599

Edited by

• Editor:
  Jairo Lizandro Schmitt

Data availability

The entire data set that supports the results of this study was published in the article itself.

Publication Dates

• Publication in this collection
  04 July 2025
• Date of issue
  2025

History

• Received
  02 Nov 2024
• Accepted
  10 May 2025