Open-access First report on yeasts Meyerozyma guilliermondii and Trichosporon asahii associated with Crassostrea sp. oysters in an intertidal region and in an oyster farm on the Amazonian coast of Maranhão State, Brazil

Primeiro relato das leveduras Meyerozyma guilliermondii e Trichosporon asahii associadas às ostras Crassostrea sp. em uma região entremarés e de ostreicultura da costa Amazônica Maranhense, Brasil

Abstract

Yeasts are widely distributed in marine ecosystems and play essential roles in maintaining their productivity. However, the identification of yeasts in marine invertebrates, especially in organisms used for human consumption, such as oysters, remains limited. This study aimed to identify yeast species in Crassostrea sp. oysters, collected from wild-harvesting and aquaculture sites along the Amazonian coast of Maranhão, Brazil. A total of 40 oyster samples were collected over two sampling months and subjected to microbiological analysis using Potato Dextrose Agar following serial decimal dilutions. Molecular identification was performed through ITS rRNA sequencing, and species similarity was assessed in dendrograms. Microbiological results revealed the presence of both mycelial fungi and yeasts, with higher densities of mycelial fungi found in the extraction and cultivation areas, whose averages were approximately 1.7 × 103 and 2.1 × 103 CFU/g, respectively, with high variability among samples. Yeasts were more abundant in cultivated oysters (4.3 × 103 CFU/g) compared to wild oysters (6.2 × 102 CFU/g). This study focused exclusively on yeast strains and molecularly identified Meyerozyma guilliermondii and Trichosporon asahii among the isolates. This is the first report of these species in oysters. These yeasts may have an allochthonous origin associated with anthropogenic factors and natural dispersion, as both are frequently found in warm-blooded animals. Therefore, this study provides relevant data for future investigations into the ecological roles of yeasts in marine invertebrates and their impacts on coastal ecosystems.

Keywords:
Crassostrea sp.; fungal diversity; marine fungi; mangroves; bivalve mollusks

Resumo

Leveduras estão amplamente distribuídas no ecossistema marinho e desempenham papéis essenciais na produtividade desse ambiente. No entanto, a identificação de leveduras em invertebrados marinhos, especialmente em organismos utilizados na alimentação humana, como ostras, ainda é escassa. Este estudo tem como objetivo identificar leveduras em ostras Crassostrea sp., coletadas em áreas de extrativismo de moluscos bivalves e de ostreicultura, na costa amazônica maranhense, Brasil. Foram coletadas 40 amostras de ostras no total durante dois meses amostrais e inoculadas para ensaios microbiológicos em meio de Batata-Dextrose-Ágar após diluições em séries decimais. A identificação molecular foi realizada por sequenciamento do rRNA ITS, e a similaridade das espécies foi analisada em dendogramas. Os resultados microbiológicos indicaram a presença de fungos miceliais e leveduras, com maior densidade de fungos miceliais nas áreas de extrativismo e cultivo, cujas médias foram de aproximadamente 1,7 × 103 e 2,1 × 103 UFC/g, respectivamente, e com alta variabilidade entre as amostras. As leveduras apresentaram maior abundância nas áreas de cultivo (4,3 × 103 UFC/g) em comparação às de extrativismo (6,2 × 102 UFC/g). Este estudo focou, exclusivamente, nas cepas de leveduras e identificou molecularmente Meyerozyma guilliermondii e Trichosporon asahii dentre os isolados. Este relato foi pioneiro nessas espécies em ostras. Essas leveduras podem ter origem alóctone associada a fatores antropogênicos e à dispersão natural, pois ambas são, frequentemente, encontradas em animais de sangue quente. Portanto, o presente estudo fornece dados relevantes para futuras investigações sobre os papéis ecológicos das leveduras em invertebrados marinhos e sobre seus impactos em ecossistemas costeiros.

Palavras-chave:
Crassostrea sp.; diversidade fúngica; fungos marinhos; manguezais; moluscos bivalves

1. Introduction

Oysters, particularly those of the Crassostrea genus, are ecologically and economically important bivalve mollusks commonly found in estuarine regions (Zeidan et al., 2012) and represent the third most significant aquaculture activity in Brazil (IBGE, 2021a). In Maranhão, Crassostrea gasar Dautzenberg, 1891 and Crassostrea rhizophorae Guilding, 1828 are widely cultivated and sold locally (França et al., 2013; Lopes et al., 2018; Sousa et al., 2023). Due to their filter-feeding activity, oysters accumulate high microbial loads, including pathogenic microorganisms, most notably bacteria, viruses, and fungi, particularly molds and yeasts from surrounding waters (Yang et al., 2015) and contaminated rivers and estuaries (Silva et al., 2020), which raises public health concerns, as the consumption of raw or lightly cooked oysters may lead to foodborne illnesses in humans (Padovan et al., 2020).

Among the associated microorganisms, marine yeasts, also known as manglicolous yeasts, are widely distributed and exhibit adaptations to saline and nutrient-poor environments (Kutty and Philip, 2008; Kaewkrajay et al., 2020; Zhu et al., 2023). These unicellular fungi contribute to nutrient cycling (Zaky et al., 2014). Marine yeasts may form mutualistic, commensal or parasitic associations with invertebrates (Nimsi et al., 2023), and these interactions may benefit hosts through nutrient supplementation, protective compounds or structural support (Pham et al., 2021; Kurtzman et al., 2011). Some yeast species exhibit host specificity, particularly in crustaceans and bivalves, including oysters (Nimsi et al., 2023). Reported associations include yeasts in Anomalocardia flexuosa Linnaeus, 1767, Calyptogena spp., Laevilacunaria antarctica E. von Martens, 1885 and Nacella concinna Strebel, 1908 (De Araújo et al., 1995; Godinho et al., 2019).

The Amazonian coastline in Maranhão, Brazil, extends for 640 km and includes the Amazon Macrotidal Mangrove Coast (AMMC), a relatively intact mangrove belt spanning approximately 480 km and 7,600 km2 across the states of Pará and Maranhão (Souza Filho, 2005; Nascimento Junior et al., 2013; Schettini et al., 2020). These mangroves are characterized by macrotidal fluctuations of up to 7 meters (Sampaio et al., 2020). Despite the ecological richness of this region, studies on marine yeasts associated with oysters remain limited. No studies have reported the presence of Meyerozyma guilliermondii or Trichosporon asahii in Crassostrea sp. oysters from the Maranhão coast. This represents a gap in understanding yeast diversity and its potential implications for public health.

Based on the above, this study aimed to identify, through sequencing of the ITS region of rDNA, yeast species molecularly isolated from Crassostrea sp. oysters collected on the Amazon coast of Maranhão, Brazil. The central hypothesis is that these bivalve mollusks harbor yeast species influenced by local environmental and anthropogenic conditions. This work represents the first record of fungal diversity associated with oysters in this region, which is relevant to the extraction, commercialization, and consumption of these organisms. The results obtained contribute to the microbiological knowledge of oysters and provide support for future sanitary monitoring and public health risk assessment actions.

2. Materials and Methods

2.1. Study sites

The current study was conducted at two different sites: Site 1 (S1) and Site 2 (S2). Both sites belong to the urban agglomeration microregion of Maranhão Island, Northern Maranhão mesoregion, Maranhão State, Brazil (IBGE, 2021b) (Figure 1).

Figure 1
Map of Maranhão Island showing the study collection sites, with emphasis on the yellow circle highlighting Site 1, which is a bivalve mollusk extraction environment in Pau Deitado region, Paço do Lumiar Municipality (MA), as well as on the red circle highlighting Site 2, which is an oyster-growing environment located at Ilha das Ostras, Raposa Municipality (MA). Source: GeoEnvironmental Center (NUGEO/UEMA), 2024.

Site 1 (S1) is located in Pau Deitado region, Paço do Lumiar Municipality, at coordinates 02°31'818” S and 044°05'080” W. This region covers approximately 127.193 km2 and its population is close to 145.643 inhabitants - population density equals 1.145,06 inhabitants/km2 (IBGE, 2022). Climate in this region is classified as tropical humid with minor annual variation. Temperatures remain high over the year: 26°C, on average (Barros et al., 2000).

S1 is part of an estuarine environment featured by relatively well-preserved mangroves. It is subjected to both anthropogenic influence by nearby communities and to the natural dynamics of the ecosystem itself. These features shape its ecological processes (Almeida et al., 2021). Accordingly, the area is traditionally used for the extraction of marine organisms, and it provides economic and nutritional support to local riverside communities. Artisanal fishing, which is substantiated by traditional ecological knowledge, works as primary income and subsistence source (Carvalho et al., 2020).

Site 2 (S2) is located in an oyster farming zone in Ilha das Ostras, Raposa Muicipality, Maranhão State, at coordinates 02°25'22” S and 44°05'21” W. This area covers approximately 79.213 km2, and houses 30.839 inhabitants - population density equals 389.32 inhabitants/km2 (IBGE, 2022) (Figure 2). This municipality experiences equatorial tropical climate with a dry season (from July to December) and a rainy season (from January to June). Mean yearly temperature exceeds 26°C (Monteles et al., 2009; Santos et al., 2011).

Figure 2
Sampling sites in Maranhão State, Brazil. A) Area 1 represents a natural oyster extraction site located in Pau Deitado region, Paço do Lumiar Municipality. B) Area 2 corresponds to an oyster farming site located at Ilha das Ostras, Raposa Municipality.

Shellfish harvesting is primarily artisanal in S2 and it is one of the main income and subsistence sources for the local population due to oysters’ collection and selling (Silva et al., 2021). The herein assessed region provides favorable environmental conditions for bivalve farming, including salinity levels, temperature, pH and dissolved oxygen (De França et al., 2013; Antônio et al., 2021). Cultivation structures at the sampling site are integrated to the mangrove environment. These structures are built by local fishermen who use artisanal methods. These facilities support oysters’ trade and their consumption by fishermen themselves.

2.2. Field collection of Crassostrea sp. specimens

Specimens were manually collected from two different study sites, under different seasonal conditions, to investigate the presence and diversity of fungal strains associated with Crassostrea sp. Oysters were collected from both study sites. Sampling at S1 took place in January 2023 at the rainy season, whereas sampling at S2 happened in December 2023, at the dry season. The total of 40 oyster specimens belonging to genus Crassostrea sp. were manually collected: 20 samples from each site.

The oysters were placed in isothermal boxes that were previously disinfected with 70% alcohol and filled with water from oysters’ respective natural habitats. They were manually collected from sampling sites S1 and S2. The oysters were taken, while still alive, to the laboratory (within the maximum time laps of four hours). They were kept at room temperature during transportation. The collected material was taken to the Microbiology, Pathology and Biotechnology Laboratory (MIPABIO), at State University of Maranhão (UEMA). The samples were stored in controlled environment at temperature ranging from 18°C to 22°C, to ensure their viability and preservation until the analysis time. The analysis was carried out within 12 hours, at most.

2.3. Isolation of Crassostrea sp. samples

The isolation protocol by Sousa et al. (2020), with modifications, was adopted to investigate fungal diversity associated with Crassostrea spp. All microbiological laboratory tools were sterilized through autoclaving at 121°C for 15 minutes, before their use, to minimize contamination risk during sample processing. The specimens were divided into groups, based on collection sites. Oysters’ soft tissue was removed, and 25 g of their flesh was collected. The tissue was homogenized, and 3 g of the total sample was distributed into three different Petri dishes: 1 g of tissue per dish. Each dish held 9 mL liquid potato-dextrose (B.D.) culture medium (prepared with 250 mL distilled water, 50 g potato and 10 g dextrose), which is a nutrient-rich medium conducive to fungal strains’ growth and sporulation, including marine fungi (Xu et al., 2018).

The material was transferred to a test tube to the first sample dilution (10−1). Subsequently, 1 mL aliquots were taken and added to test tubes filled with 9 mL liquid B.D. to generate decimal dilutions equal 10−2 and 10−3. This procedure led to nine sample dilutions of the three initial fractions.

Twenty-four hours later, the aliquot of 1 mL of each dilution was placed on Petri dishes filled with Potato Dextrose Agar (B.D.A.) - 39.0 g B.D.A. in 1L purified water autoclaved for 15 minutes at 121°C; pH was adjusted to 5.6 ± 0.2 at 25°C. The manufacturer’s instructions were followed Merck, KGaA (Germany; batch number: VM780130). This process was carried out in triplicate. The spread plate technique was used for inoculation purpose.

Samples were incubated for five consecutive days in B.O.D. (Biol manufacturer’s ogical Oxygen Demand) germination chamber (Model 347 CDG, FANEM LTDA) at temperature of 25 °C ± 2°C, under 12-hour photoperiod. Colony-Forming Units (CFU/g) were observed in microscope. Optical microscopy images were acquired using an Axio Scope.A1 microscope (Carl Zeiss) equipped with a 40× objective lens. Additionally, methylene blue staining was applied to enhance the contrast of fungal structures.

The grown fungal strains were deposited in Prof. Gilson Soares da Silva Mycotheca (MGSS), at the Agricultural Sciences and Agronomic Biotechnology Center, UEMA’s Plant Pathology Laboratory, under registration numbers MGSS 516 and MGSS 517.

2.4. Yeast strains molecular identification

The aliquot of 1 mL of yeast sample was initially taken with an automatic pipette and transferred to a microcentrifuge tube (Eppendorf) filled with YPD (Yeast Extract Peptone Dextrose) liquid medium for yeast strains’ molecular identification. This method has proven effective for fungal strains, mainly for yeasts grown in 50 mL Erlenmeyer flasks (Wei et al., 2018). The sample was placed in Orbital Shaker (DSR-10, Global Trade) and kept under constant agitation at 150 RPM for 7 days to stimulate yeast-like vegetative growth.

2.4.1. DNA extraction procedure

The procedures adopted to extract DNA from yeast strains followed the protocol by Kurtzman and Fell (1998), with modifications by Teixeira (2019). Yeast isolates in microtubes were centrifuged (MCD-2000, HT) at 12.000 RPM for 3 minutes. Subsequently, 100 µL lysis buffer (10 mM Tris-HCl, pH 8; 25 mM EDTA, pH 8; 100 mM NaCl; 0.5% SDS; Ludwig Biotecnologia Ltda) was added to each microtube to break the cell wall and the membrane. The mix was vortexed (1005, Biomatic) and incubated in water bath (BM 1102, FANEM LTDA) at 65 °C for 30 minutes.

The aliquot of 200 µL chloroform:isoamyl alcohol (24:1), which is an organic solvent for protein denaturation and DNA purification, was added under Gas Exhaust Hood, after incubation (CE 0703, Permution LTDA). The tubes were manually homogenized and centrifuged at 13.200 RPM, for 15 minutes The total of 70 µL supernatant from each microtube was transferred to a new tube and labeled. The aliquot of 70 µL isopropanol (analytical grade, P.A., ISOFAR, Brazil; CAS 67-63-0) was added at room temperature for DNA precipitation; it was followed by gentle inversion and by 15-minute incubation.

The samples were centrifuged at 13,200 RPM for 10 minutes. The supernatant was discarded by inversion. The aliquot of 200 µL ice-cold ethanol was added to each microtube to remove salt residues; it was followed by gentle inversion and centrifugation at 13.200 RPM for 10 minutes. The supernatant was discarded and the ethanol-washing step was repeated.

The pellet at the bottom of the microtube was resuspended in 50 µL TE buffer (Tris-EDTA, 0.1 M, pH 8, purity 99.8%, Ludwig Biotecnologia Ltda) for hydration purpose. The samples were incubated in oven at 37 °C for 1 hour. Total extracted DNA was quantified in NanoDrop ND1000 spectrophotometer (NanoDrop Technologies). The DNA was diluted to the concentration of 100 ng/µL and stored at -20 °C.

2.4.2. ITS region amplification

The ITS region of the rRNA was amplified by using primers ITS1 (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) (Thermo Fisher Scientific) to assess yeast strains’ taxonomic identity (White et al., 1990; Gardes and Bruns, 1993). Each PCR reaction was prepared in total volume of 20 µL, and it consisted of 10 µL 2x Master Mix (Promega), 8.6 µL nuclease-free water, 0.4 µL each primer and 1 µL DNA template.

PCR was carried out in thermal cycler (Veriti 96-Well Thermal Cycler, Thermo Fisher Scientific) programmed as follows: initial denaturation at 95 °C for 5 minutes followed by 35 denaturation cycles at 95 °C for 30 seconds, annealing at 52 °C for 30 seconds and extension at 72 °C for 1 minute. A final extension step was taken at 72 °C for 8 minutes.

2.4.3. Analysis of genetic sequences

Genetic sequences were aligned in CLUSTAL-W software (Thompson et al., 1994) based on the gap/extension penalty parameters suggested by Schneider et al. (2017): 10/0.05 or 20/0.1, to enable accurate yeast strains’ taxonomic identification and phylogenetic analysis. The generated file was converted into Fasta format and the sequences were edited in CHROMAS 2.6.6 software (https://chromas.software.informer.com/) to visually inspect alignment and potentially correct insertion or deletion codes. The resulting sequences were used for identification purpose, and they were based on comparisons to the GenBank database. It was done in BLAST (Basic Local Alignment Search Tool) software configured with the BLASTn option against the non-redundant (nr) database (Altschul et al., 1990). Similarity analysis was performed by plotting a dendrogram based on genetic distances. It was plotted through the Neighbor-Joining method, in MEGA 11 software (Tamura et al., 2021). The total of 1.000 bootstrap replicates were applied to validate the dendrogram.

3. Results

3.1. Microbial counts

According to the mycelial fungi and yeasts count in S1 and S2, which was expressed as colony-forming units per gram (CFU/g), the mean count of mycelial fungi was 1.7 × 103 CFU/g ± 2.045 × 103 in S1, whereas mean yeasts was 6.2 × 102 CFU/g. On the other hand, mean mycelial fungi was 2.0 × 103 CFU/g ± 1.5 × 103 in S2, and yeasts reached 4.3 × 103 CFU/g in it (Table 1).

Table 1
Colony-forming unit counts (CFU/g) of mycelial fungi and yeasts isolated from sampling sites S1 and S2. Values are expressed as mean ± standard deviation (SD) in scientific notation (×10N).

Fungal counts was considerably higher in S2, because its average was three to four times higher than that observed in S1. This finding suggests higher fungal biomass at this site. In addition, yeast abundance was lower in S1, as highlighted by the lower CFU/g values. These patterns can be influenced by factors such as substrate availability, local weather variations or anthropogenic impacts. Although these variables were not directly investigated in the current study, findings have underscored the microbial ecology complexity in dynamic environments such as the macro-tidal zone of Maranhão State’s Amazonian coast.

The present results mostly refer to yeast species. Each species is represented by a single taxon per sampling site, as identified through molecular methods. It is worth observing that other fungal strains were also isolated; however, they did not meet the required quality or viability criteria. Therefore, they were not included in the analysis.

3.2. Morphological identification

Based on the macroscopic morphological features observed in the isolated colonies, the strain in Figure 3A was consistent with genus Meyerozyma sp., including yellowish-white color, smooth and opaque surface, buttery texture, and creamy consistency to the touch. These traits are often described for yeasts belonging to this genus, mainly M. guilliermondii (Kurtzman et al., 2011). Figure 3B, in its turn, displays a colony with creamy white color and radial morphology. It was featured as mostly dry, membranous surface with cerebriform appearance, furrows and undulations. These features comply with morphological descriptions of genus Trichosporon sp. (Lee et al., 1990).

Figure 3
Yeast colonies isolated from Crassostrea sp. oysters: A) Meyerozyma guilliermondii. B) Trichosporon asahii.

The optical micrographs presented in Figure 4A and 4B show M. guilliermondii cells with ovoid to elliptical morphology, exhibiting blastoconidia with characteristic multilateral budding, pseudohyphae, and small cellular aggregates (Sibirny, 1996). In contrast, Figure 4C and 4D displays T. asahii structures, including branched septate hyphae, pseudohyphae, arthroconidia arranged in short chains, oval yeast cells, and some exhibiting lateral blastoconidia (Colombo et al., 2011; Wang et al., 2009).

Figure 4
Optical microscopy images depicting distinct cell types of Meyerozyma guilliermondii and Trichosporon asahii. Figures A and B show oval to elliptical yeast cells with blastoconidia, pseudohyphae, and cellular aggregates. Figure C displays oval yeast cells, blastoconidia, and arthroconidia arranged in short chains, along with pseudohyphae. In Figure D, septate and branched hyphae, mature arthroconidia in the process of being released, and cell clusters adhered to the hyphae are evident. Scale bars: 10 µm. Magnification: 40×. Staining: methylene blue.

3.3. Yeast isolates molecular identification

The sequencing of the rRNA ITS region led to fragments of approximately 500 base pairs (bp), and it allowed identifying one single yeast taxon at each sampling site. The S1 isolate was assigned to phylum Ascomycota and identified as M. guilliermondii. The S2 isolate belonged to the phylum Basidiomycota and was identified as T. asahii. This study provided the first report on these yeasts’ association with oysters.

3.4. Phylogenetic and similarity analyses

According to the similarity analysis, the investigated species showed 98.31% identity with M. guilliermondii and 98.98% with T. asahii. The sequences’ BLAST results and phylogenetic analysis were applied to confirm yeast identities, as depicted in Figures 5 and 6. Based on the constructed dendrograms, the sequenced species clustered with their corresponding species, which are deposited in the National Center for Biotechnology Information (NCBI) database. The isolated strains were deposited in GenBank under accession numbers PP374821 and PP374822.

Figure 5
Phylogenetic dendrogram of the Internal Transcribed Spacer (ITS) region plotted from the nucleotide sequence of a Meyerozyma guilliermondii sample. The sample clustered with species Meyerozyma guilliermondii, which is among the species belonging to genus Meyerozyma. Rhizopus stolonifera var. stolonifer stolonifer representatives were used as outgroup. Bootstrap values recorded based on using 1.000 replicates are indicated at the branching points. Accession numbers are shown in brackets. The sequenced sample is highlighted. Bar: 0.050 estimated substitutions.
Figure 6
Phylogenetic dendrogram of the Internal Transcribed Spacer (ITS) region plotted from the nucleotide sequence of a Trichosporon asahii sample. The sample clustered with species Trichosporon asahii. Rhizopus stolonifera var. stolonifer stolonifer representatives were used as outgroup among species belonging to genus Trichosporon. Bootstrap values recorded based on using 1.000 replicates are indicated at the branching points. Accession numbers are shown in brackets. The sequenced sample is highlighted. Bar: 0.10 estimated substitutions.

Compatibility to genera Meyerozyma sp. and Trichosporon sp. was confirmed by the colonies’ morphological features. In addition, analysis of rDNA’s ITS region allowed identifying the isolates as M. guilliermondii and T. asahii. They recorded high identity rate (>98%) in comparison to sequences deposited in GenBank. Although it is known that the ITS marker alone can have limitations in some yeast groups, species-level identification was herein supported by both genus-consistent morphological features and high-sequence similarity. It led to confidence in the taxonomic assignment. Nonetheless, it is important emphasizing that the use of complementary markers, such as the D1/D2 region of the LSU rDNA, can be adopted in future studies for additional confirmation purpose.

3.5. Genetic records importance for mycological research

It is worth emphasizing that recording fungal strains, such as M. guilliermondii and T. asahii in genetic databases is essential for validation, besides working as reference for future studies. These records enhance reliability and accuracy, and provide comparative data to researchers in several fields, including taxonomy, ecology and evolution. Therefore, contributions to genetic databases make broad, dynamic and accessible collaboration easier among researchers and institutions. Lineage records allow information sharing, scientific research support and information outspread in society.

4. Discussion

This study is the first to identify two yeast species, Meyerozyma guilliermondii and Trichosporon asahii, associated with Crassostrea oysters collected from wild-harvesting and farming sites along the Amazonian coast of Maranhão State, in areas used by local communities for shellfish collection and trade. Identification was based on colony morphology and ITS region analysis of rDNA. The region’s mangroves are ecologically distinct from other Brazilian mangroves due to a macrotidal regime, high rainfall, complex hydrography, and sediment composition, which support high biodiversity (Lacerda et al., 2002).

Morphological screening identified the genera Meyerozyma sp. and Trichosporon sp., based on criteria from Kurtzman et al. (2011), Lee et al. (1990), and Colombo et al. (2011). Subsequent molecular analysis of the ITS region confirmed the species M. guilliermondii and T. asahii. The D1/D2 region was not used, as the ITS region offers greater nucleotide variability and more polymorphic sites (Delva et al., 2022) and is particularly effective in distinguishing closely related species due to its higher substitution rates (Fajarningsih, 2016). Nouraei et al. (2024) also demonstrated the ITS region’s effectiveness in yeast identification.

This discussion outlines the occurrence of these yeasts in other marine organisms and aquatic environments, their ecological roles, potential biotechnological applications, and the current limitations in marine fungal research.

4.1. Taxonomy and identification

Molecular identification revealed two yeast species associated with Crassostrea sp. oysters: Meyerozyma guilliermondii, isolated from oysters at a bivalve extraction site (S1), and Trichosporon asahii, found in oysters from a farming environment. Both sites are in mangrove ecosystems.

M. guilliermondii produces branched pseudohyphae with verticillate blastoconidia and lacks true hyphae (Sibirny, 1996), consistent with our findings (Bregnard et al., 2024). Colonies are yellowish-white, ranging from smooth to rough. This aerobic yeast grows optimally at ~30 °C and tolerates salinity above seawater levels (Pitt and Miller, 1970; Sibirny, 1996; Yan et al., 2021). While T. asahii is a dimorphic basidiomycete characterized by the formation of dry, yellowish and wrinkled colonies. It produces blastoconidia, arthroconidia, and hyphae, with cells that vary in shape and occur singly or in pairs, as confirmed in the present study (Colombo et al., 2011). Its morphology shifts depending on environmental conditions (Karashima et al., 2002; Di Bonaventura et al., 2006).

The occurrence of both species in mangrove oysters may reflect their ecological plasticity. M. guilliermondii exhibits salinity tolerance, while T. asahii displays morphological adaptability under variable conditions.

4.2. Association with marine invertebrates

Both yeasts have been reported in association with marine invertebrates, though not in oysters, and such occurrences in other marine hosts remain rare (Kutty and Philip, 2008). M. guilliermondii has been isolated from zoanthids, sponges, sea snails, starfish, isopods, algae, and marine sediments (Kaewkrajay et al., 2020, 2021; Duarte et al., 2013). Its detection in Antarctic waters suggests cold adaptation (Godinho et al., 2019). T. asahii has been identified only once in a bivalve Corbicula fluminea Strebel, 1908, from the Seomjin River, Korea (Heo et al., 2022); both C. fluminea and Crassostrea sp. belong to class Bivalvia.

No studies to date have addressed the ecological roles or potential host impacts of M. guilliermondii or T. asahii in marine invertebrates. This scenario must result from the scarcity of studies focused on yeast identification, since it limits investigations about their ecological roles and potential applications, despite their promising features.

4.3. Ecological association

The presence of M. guilliermondii in the environment has been linked to fecal contamination by warm-blooded animals. Hoondee et al. (2019) identified this species in Thai mangroves and associated it with animal excreta, while Brandão et al. (2010) reported similar findings in lakes in Southwestern Brazil. Its occurrence in Crassostrea sp. oysters on the Amazonian coast of Maranhão may thus reflect mangrove dynamics and inputs from warm-blooded organisms, suggesting it is an allochthonous yeast in this environment.

In this context, the presence of M. guilliermondii may also relate to its broad ecological distribution and ability to adapt to marine environments, as demonstrated by Cai et al. (2021), who described the GXDK6 strain as tolerant to saline stress, acidity, and heavy metals. Similarly, Lim et al. (2025) reported its ability to form biofilms resembling those of opportunistic pathogens such as Candida albicans, indicating ecological plasticity and the potential to colonize filter-feeding organisms subject to salinity fluctuations, such as oysters.

By contrast, T. asahii was isolated by Kunthiphun et al. (2018) from Thai mangroves, with the authors noting that its presence may indicate environmental pollution. T. asahii is also frequently associated with human infections (Commenges et al., 2024) and was recently implicated in an epidemic outbreak in a frog aquaculture system, characterized by high mortality and cross-species virulence (Wang et al., 2025). Although this case did not involve bivalves or marine environments, it suggests that T. asahii may act as an emerging pathogen in aquatic farming systems, raising concerns for environmental and food safety.

Its occurrence in the present study site could therefore result from similar factors, such as anthropogenic pollution or inputs from warm-blooded fauna, as proposed for M. guilliermondii.

4.4. Biotechnological potential

The biotechnological potential of M. guilliermondii and T. asahii in mangrove and intertidal environments has been documented. M. guilliermondii was isolated from Rhizophora mucronata leaves in the Pichavaram Mangrove Forest (India), exhibiting cytotoxicity against Hep2 and MCF-7 cell lines (Joel and Bhimba, 2013). It was also found in Kandelia obovata roots in the Huizhou mangrove reserve (China), where it produced secondary metabolites such as depsidones and isoindolinones (Chen et al., 2015). This yeast has also shown promising potential for the sustainable production of biofuels and bioproducts through lipid synthesis using residual oil (Zain et al., 2025)

T. asahii has demonstrated phosphorus removal from wastewater under varying chemical conditions (Han et al., 2022) and flavonoid production with antioxidant activity in strains isolated from raw honeycombs (Xue et al., 2023). It is also considered a promising secretion of extracellular enzymes that degrade pathogenic fungi (Yan et al., 2018; Zhang et al., 2020). It also acts as a biological control agent by inhibiting the growth of phytopathogenic fungi, such as Alternaria sp., through the production of volatile compounds, toxins, and hydrolytic enzymes (Bosqueiro et al., 2020).

The occurrence of both yeasts in aquatic environments, along with their bioactive compound production and waste degradation capacity, highlights their biotechnological potential, which remains underexplored. Further research is needed to advance their application.

4.5. Public health implications

The yeasts identified in this study, M. guilliermondii and T. asahii, are clinically relevant and associated with superficial and invasive infections in humans. M. guilliermondii has been frequently reported in candidemia cases in Latin America (Francisco et al., 2023; Lorrine et al., 2023). T. asahii is an emerging opportunistic pathogen linked to trichosporonosis and fungemia, especially in immunocompromised individuals (Chitasombat et al., 2012).

Their presence in marine environments is concerning, as human-associated yeasts are likely non-native and may result from anthropogenic input (Kutty and Philip, 2008), posing risks to marine organisms, including oysters, and to human health. Although yeasts can accumulate in bivalves (Buck et al., 1977; Monapathi et al., 2020), M. guilliermondii and T. asahii have not been reported in oysters. However, other pathogenic fungi such as Aspergillus and Fusarium have been detected in C. gigas (Borzykh & Zvereva, 2012 and 2018), known for their toxicogenic and hepatotoxic potential.

It has been observed that M. guilliermondii exhibits virulence factors such as adhesins and enolases, which are capable of binding to human extracellular matrix proteins, potentially facilitating its adhesion and invasion in immunocompromised hosts (Amran et al., 2023). T. asahii, in turn, demonstrates environmental resilience and produces extracellular enzymes that enhance its survival on food surfaces and biological tissues, including honey and dairy products (Commenges et al., 2024). Although there are no direct reports of these yeasts in Crassostrea oysters, the cited studies indicate their ability to colonize aquatic environments and certain food products, suggesting that bivalve mollusks may also serve as hosts for their persistence, as has been observed for other yeasts in mollusks (Monapathi et al., 2020).

Despite the risks associated with marine toxins (Turner et al., 2017), fungal contamination in bivalves is understudied. Most research prioritizes bacterial pathogens like Vibrio spp., often neglecting mycotoxins. Brazilian regulations lack specific limits for mycotoxins in animal-derived foods, revealing a public health gap that requires further attention (Oliveira et al., 2024).

4.6. Limitations and improvements for future research

Studies on fungal isolation, particularly of yeasts, involve methodological complexity, from sampling to isolation techniques, which contributes to gaps in understanding their distribution and ecological roles in marine environments, as standardized methods are still under development (Zhu et al., 2023; Hassett et al., 2020).

We emphasize that this study provides relevant insights into the yeasts associated with oysters; however, we acknowledge important methodological limitations that may have affected the depth of the analyses conducted. For instance, yeast identification was based on a single molecular marker which, although widely used (ITS region), may be insufficient to ensure phylogenetic accuracy for species with high sequence similarity (Zhu et al., 2023). Additionally, morphological characterization was incomplete due to the absence of microscopy images, resulting from technical issues at the university, which could have complemented molecular data and supported the morphological differentiation of the isolates obtained.

Similarly, the limited spatial and temporal scope of sampling represents another constraint, as it was conducted in only two areas and during a single season, which may restrict broader ecological generalizations, particularly in the Amazon coastal region of Maranhão, an environment characterized by high variability and strong anthropogenic influence (Boekhout et al., 2022). Robust experimental design, including adequate sample size, replication, and molecular protocols, is crucial for reliable statistical analyses and assessments of yeast communities (Hassett et al., 2020).

Despite these limitations, this study contributes to advancing knowledge on the diversity of yeasts associated with Crassostrea sp. oysters in Maranhão, highlighting species that, until now, had not been reported in these marine organisms. As future perspectives, we encourage further studies employing metagenomic approaches capable of detecting broader and non-culturable fungal communities (Grossart et al., 2019), as well as continuous environmental monitoring that accounts for seasonal variability. These complementary strategies may provide a more comprehensive understanding of the ecological roles played by these yeasts in marine invertebrates and their surrounding environments.

Substantial challenges persist in accurately characterizing marine yeasts. Further studies should prioritize the Amazonian coast of Maranhão, an underexplored region with high potential for fungal diversity and biotechnological applications (Rosa et al., 2023).

5. Conclusion

This study presents the first record of two marine yeasts associated with Crassostrea sp. oysters from distinct shellfish extraction and oyster farming sites in mangrove areas along the Amazonian coast of Maranhão State, Brazil. The scarcity of studies on the incidence of yeasts in marine organisms commonly consumed raw by humans highlights a significant gap in scientific knowledge and limits our understanding of their diversity and potential impact on human health. Moreover, the lack of research in this field hinders the identification of possible interactions between these yeasts and marine trophic chains. Although the findings suggest the presence of likely allochthonous yeasts, the study offers valuable insights into their association with oysters and lays a relevant foundation for future research on the ecological roles of interactions between yeasts, marine invertebrates, and coastal ecosystems.

Acknowledgements

The authors would like to thank Maranhão Research, Scientific, and Technological Development Support Foundation (FAPEMA - Process BM-07933/22) for supporting this research, as well as Warwick Estevam Kerr Genetics and Molecular Biology Laboratory (LabWick/UEMA) for conducting the molecular procedures.

Data Availability Statement

The entire data set that supports the results of this study was published in the article itself.

References

  • ALMEIDA, S.F., BELFORT, M.R., CUTRIM, M.V., CARVALHO-COSTA, L.F., PEREIRA, S.R. and LUVIZOTTO-SANTOS, R., 2021. DNA damage in an estuarine fish inhabiting the vicinity of a major Brazilian port. Anais da Academia Brasileira de Ciências, vol. 93, no. 2, pp. e20190652. http://doi.org/10.1590/0001-3765202120190652 PMid:33950142.
    » http://doi.org/10.1590/0001-3765202120190652
  • ALTSCHUL, S.F., GISH, W., MILLER, W., MYERS, E.W. and LIPMAN, D.J., 1990. Basic local alignment search tool. Journal of Molecular Biology, vol. 215, no. 3, pp. 403-410. http://doi.org/10.1016/S0022-2836(05)80360-2 PMid:2231712.
    » http://doi.org/10.1016/S0022-2836(05)80360-2
  • AMRAN, A.I., LIM, S.J., NOOR, N.D.M., SALLEH, A.B. and OSLAN, S.N., 2023. Enolase in Meyerozyma guilliermondii strain SO: sequential and structural insights of MgEno4581 as a putative virulence factor and host-fungal interactions through comprehensive in silico approaches. Microbial Pathogenesis, vol. 176, pp. 106025. http://doi.org/10.1016/j.micpath.2023.106025 PMid:36754101.
    » http://doi.org/10.1016/j.micpath.2023.106025
  • ANTÔNIO, Í.G., SOUSA, A., LENZ, T.M., FUNO, I.C.S.A., LOPES, R.G.P.S. and FIGUEIREDO, M.B., 2021. Reproductive cycle of the mangrove oyster, Crassostrea rhizophorae (Bivalvia: Ostreidae) cultured in a macrotidal high-salinity zone on the Amazon mangrove coast of Brazil. Acta Amazonica, vol. 51, no. 2, pp. 113-121. http://doi.org/10.1590/1809-4392202003582
    » http://doi.org/10.1590/1809-4392202003582
  • ARAUJO, F.V., SOARES, C.A.G., HAGLER, A.N. and MENDONÇA-HAGLER, L.C., 1995. Ascomycetous yeast communities of marine invertebrates in a Southeast Brazilian mangrove ecosystem. Antonie van Leeuwenhoek, vol. 68, no. 2, pp. 91-99. http://doi.org/10.1007/BF00873096 PMid:8546456.
    » http://doi.org/10.1007/BF00873096
  • BARROS, V.L.L., REBÊLO, J.M.M. and SILVA, F.S., 2000. Flebotomíneos (Diptera, Psychodidae) de capoeira do município do Paço do Lumiar, estado do Maranhão, Brasil: área de transmissão de leishmaniose. Cadernos de Saude Publica, vol. 16, no. 1, pp. 265-270. http://doi.org/10.1590/S0102-311X2000000100030 PMid:10738174.
    » http://doi.org/10.1590/S0102-311X2000000100030
  • BOEKHOUT, T., AMEND, A.S., EL BAIDOURI, F., GABALDÓN, T., GEML, J., MITTELBACH, M., ROBERT, V., TAN, C.S., TURCHETTI, B., VU, D., WANG, Q.M. and YURKOV, A., 2022. Trends in yeast diversity discovery. Fungal Diversity, vol. 114, no. 1, pp. 491-537. http://doi.org/10.1007/s13225-021-00494-6
    » http://doi.org/10.1007/s13225-021-00494-6
  • BORZYKH, O.G. and ZVEREVA, L.V., 2012. Mycobiota of the giant oyster Crassostrea gigas (Thunberg, 1787) (Bivalvia) from the Peter the Great Bay of the Sea of Japan. Mikrobiologiia, vol. 81, no. 1, pp. 117-119. http://doi.org/10.1134/S0026261712010031 PMid:22629688.
    » http://doi.org/10.1134/S0026261712010031
  • BORZYKH, O.G. and ZVEREVA, L.V., 2018. Fungal assemblages associated with commercial bivalve species in coastal waters of the Sea of Japan, Russia. Botanica Marina, vol. 61, no. 4, pp. 355-363. http://doi.org/10.1515/bot-2017-0088
    » http://doi.org/10.1515/bot-2017-0088
  • BOSQUEIRO, A.S., BIZARRIA JÚNIOR, R. and ROSA-MAGRI, M.M., 2020. Potential of Trichosporon asahii against Alternaria sp. and mechanisms of actions. Summa Phytopathologica, vol. 46, no. 1, pp. 20-25. http://doi.org/10.1590/0100-5405/220861
    » http://doi.org/10.1590/0100-5405/220861
  • BRANDÃO, L.R., MEDEIROS, A.O., DUARTE, M.C., BARBOSA, A.C. and ROSA, C.A., 2010. Diversity and antifungal susceptibility of yeasts isolated by multiple-tube fermentation from three freshwater lakes in Brazil. Journal of Water and Health, vol. 8, no. 2, pp. 279-289. http://doi.org/10.2166/wh.2009.170 PMid:20154391.
    » http://doi.org/10.2166/wh.2009.170
  • BREGNARD, D., CAILLEAU, G., VAN ZONNEVELD, W., REGENSPURG, S., BINDSCHEDLER, S. and JUNIER, P., 2024. Co-isolamento de Penicillium citrinum e seu parceiro de troca celular Meyerozyma guilliermondii de uma usina geotérmica. bioRxiv In press. http://doi.org/10.1101/2024.06.19.599737
    » http://doi.org/10.1101/2024.06.19.599737
  • BUCK, J.D., BUBUCIS, P.M. and COMBS, T.J., 1977. Occurrence of human-associated yeasts in bivalve shellfish from Long Island Sound. Applied and Environmental Microbiology, vol. 33, no. 2, pp. 370-378. http://doi.org/10.1128/aem.33.2.370-378.1977 PMid:322610.
    » http://doi.org/10.1128/aem.33.2.370-378.1977
  • CAI, X., SUN, H., BAI, H., CHEN, Y., KASHIF, M., BU, R., MO, X., SU, G., OU, Q., YAN, B. and JIANG, C., 2021. Survival mechanism of a novel marine multistress-tolerant Meyerozyma guilliermondii GXDK6 under high NaCl stress as revealed by integrative omics analysis. bioRxiv In press. http://doi.org/10.1101/2021.06.28.450280
    » http://doi.org/10.1101/2021.06.28.450280
  • CARVALHO, I.F. S., MENDES, D.C. S., SODRÉ, C.F.L., FRANÇA, E.R. R., NASCIMENTO, I.T., MILKE, R. and LENZ, T.M., 2020. Fishing characterization in a fishing community in the town of Paço do Lumiar, Maranhão, Brazil. Brazilian Journal of Development, vol. 6, no. 10, pp. 81471-81482. http://doi.org/10.34117/bjdv6n10-537
    » http://doi.org/10.34117/bjdv6n10-537
  • CHEN, S., LIU, Z., LIU, Y., LU, Y., HE, L. and SHE, Z., 2015. New depsidones and isoindolinones from the mangrove endophytic fungus Meyerozyma guilliermondii (HZ-Y2) isolated from the South China Sea. Beilstein Journal of Organic Chemistry, vol. 11, no. 1, pp. 1187-1193. http://doi.org/10.3762/bjoc.11.133 PMid:26425177.
    » http://doi.org/10.3762/bjoc.11.133
  • CHITASOMBAT, M.N., KOFTERIDIS, D.P., JIANG, Y., TARRAND, J., LEWIS, R.E. and KONTOYIANNIS, D.P., 2012. Rare opportunistic (non-Candida, non-Cryptococcus) yeast bloodstream infections in patients with cancer. The Journal of Infection, vol. 64, no. 1, pp. 68-75. http://doi.org/10.1016/j.jinf.2011.11.002 PMid:22101079.
    » http://doi.org/10.1016/j.jinf.2011.11.002
  • COLOMBO, A.L., PADOVAN, A.C.B. and CHAVES, G.M., 2011. Current knowledge of Trichosporon spp. and trichosporonosis. Clinical Microbiology Reviews, vol. 24, no. 4, pp. 682-700. http://doi.org/10.1128/CMR.00003-11 PMid:21976604.
    » http://doi.org/10.1128/CMR.00003-11
  • COMMENGES, A., COUCHENEY, F., LESSARD, M.H., DRIDER, D. and LABRIE, S., 2024. Trichosporon asahii: Taxonomy, health hazards, and biotechnological applications. Fungal Biology Reviews, vol. 49, pp. 100369. http://doi.org/10.1016/j.fbr.2024.100369.
  • DELVA, E., ARISURYANTI, T. and ILMI, M., 2022. Genetic diversity of Amylomyces rouxii from Ragi Tapai in Java island based on ribosomal regions ITS1/ITS2 and D1/D2. Mycobiology, vol. 50, no. 2, pp. 132-141. http://doi.org/10.1080/12298093.2022.2028436 PMid:35571863.
    » http://doi.org/10.1080/12298093.2022.2028436
  • DI BONAVENTURA, G., POMPILIO, A., PICCIANI, C., IEZZI, M., D’ANTONIO, D. and PICCOLOMINI, R., 2006. Biofilm formation by the emerging fungal pathogen Trichosporon asahii: development, architecture, and antifungal resistance. Antimicrobial Agents and Chemotherapy, vol. 50, no. 10, pp. 3269-3276. http://doi.org/10.1128/AAC.00556-06 PMid:17005804.
    » http://doi.org/10.1128/AAC.00556-06
  • DUARTE, A.W., DAYO-OWOYEMI, I., NOBRE, F.S., PAGNOCCA, F.C., CHAUD, L.C., PESSOA, A., FELIPE, M.G. and SETTE, L.D., 2013. Taxonomic assessment and enzymes production by yeasts isolated from marine and terrestrial Antarctic samples. Extremophiles, vol. 17, no. 6, pp. 1023-1035. http://doi.org/10.1007/s00792-013-0584-y PMid:24114281.
    » http://doi.org/10.1007/s00792-013-0584-y
  • FAJARNINGSIH, N.D., 2016. Internal Transcribed Spacer (ITS) as DNA barcoding to identify fungal species: a review. Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology, vol. 11, no. 2, pp. 37-44. http://doi.org/10.15578/squalen.v11i2.213
    » http://doi.org/10.15578/squalen.v11i2.213
  • FRANÇA, V.L.D., MONTELES, J.S., FUNO, I.C.S.A. and CASTRO, A.C.L.D., 2013. Seleção de áreas potenciais para o cultivo de ostra nativa, Crassostrea spp. e Sururu, Mytella falcata, em Raposa, Maranhão. Arquivos de Ciências do Mar, vol. 46, no. 1, pp. 62-75.
  • FRANCISCO, E.C., RIBEIRO, F.D.C., ALMEIDA JUNIOR, J.N., PEDONI, D.B., MATTA, D.A., DOLANDE, M., MELO, A.S.A., LIMA, R.F., AQUINO, V.R., CORZO-LEÓN, D.E., ZURITA, J., CORTES, J.A., NUCCI, M. and COLOMBO, A.L., 2023. Emergence of cryptic species and clades of Meyerozyma guilliermondii species complex exhibiting limited in vitro susceptibility to antifungals in patients with candidemia. Microbiology Spectrum, vol. 11, no. 5, pp. e0511522. http://doi.org/10.1128/spectrum.05115-22 PMid:37698428.
    » http://doi.org/10.1128/spectrum.05115-22
  • GARDES, M. and BRUNS, T.D., 1993. ITS primers with enhanced specificity for Basidiomycetes: application to identification of mycorrhizae and rusts. Molecular Ecology, vol. 2, no. 2, pp. 113-118. http://doi.org/10.1111/j.1365-294X.1993.tb00005.x PMid:8180733.
    » http://doi.org/10.1111/j.1365-294X.1993.tb00005.x
  • GODINHO, V.M., DE PAULA, M.T.R., SILVA, D.A.S., PARESQUE, K., MARTINS, A.P., COLEPICOLO, P., ROSA, L.H. and ROSA, L.H., 2019. Diversity and distribution of hidden cultivable fungi associated with marine animals of Antarctica. Fungal Biology, vol. 123, no. 7, pp. 507-516. http://doi.org/10.1016/j.funbio.2019.05.001 PMid:31196520.
    » http://doi.org/10.1016/j.funbio.2019.05.001
  • GROSSART, H.P., VAN DEN WYNGAERT, S., KAGAMI, M., WURZBACHER, C., CUNLIFFE, M. and ROJAS-JIMENEZ, K., 2019. Fungi in aquatic ecosystems. Nature Reviews. Microbiology, vol. 17, no. 6, pp. 339-354. http://doi.org/10.1038/s41579-019-0175-8 PMid:30872817.
    » http://doi.org/10.1038/s41579-019-0175-8
  • HAN, J., QIU, Q., GAO, M., QIU, L., WANG, Y., SUN, S., SONG, D. and MA, J., 2022. Phosphorus removal from municipal wastewater through a novel Trichosporon asahii BZ: performance and mechanism. Chemosphere, vol. 298, pp. 134329. http://doi.org/10.1016/j.chemosphere.2022.134329 PMid:35304214.
    » http://doi.org/10.1016/j.chemosphere.2022.134329
  • HASSETT, B.T., VONNAHME, T.R., PENG, X., JONES, E.G. and HEUZÉ, C., 2020. Global diversity and geography of planktonic marine fungi. Botanica Marina, vol. 63, no. 2, pp. 121-139. http://doi.org/10.1515/bot-2018-0113
    » http://doi.org/10.1515/bot-2018-0113
  • HEO, Y.J., JO, H., KIM, J.Y., KIM, G.Y., JOO, G.J. and KIM, H.W., 2022. Application of DNA metabarcoding for identifying the diet of Asian clam (Corbicula fluminea, Müller, 1774). Sustainability, vol. 15, no. 1, pp. 441. http://doi.org/10.3390/su15010441
    » http://doi.org/10.3390/su15010441
  • HOONDEE, P., WATTANAGONNIYOM, T., WEERAPHAN, T., TANASUPAWAT, S. and SAVARAJARA, A., 2019. Occurrence of oleaginous yeast from mangrove forest in Thailand. World Journal of Microbiology & Biotechnology, vol. 35, no. 7, pp. 108. http://doi.org/10.1007/s11274-019-2680-3 PMid:31267227.
    » http://doi.org/10.1007/s11274-019-2680-3
  • INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATÍSTICA – IBGE, 2021a [viewed 16 July 2025]. Panorama da aquicultura de moluscos [online]. IBGE. Available from: https://cidades.ibge.gov.br/
    » https://cidades.ibge.gov.br/
  • INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATÍSTICA – IBGE, 2021b. Estimativas da população residente com data de referência 1° de julho de 2021. Brasília: IBGE.
  • INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATÍSTICA – IBGE, 2022. Censo Demográfico Brasília: IBGE.
  • JOEL, E.L. and BHIMBA, B.V., 2013. Evaluation of secondary metabolites from mangrove associated fungi Meyerozyma guilliermondii. Alexandria Journal of Medicine, vol. 49, no. 3, pp. 189-194. http://doi.org/10.1016/j.ajme.2013.04.003
    » http://doi.org/10.1016/j.ajme.2013.04.003
  • KAEWKRAJAY, C., CHANMETHAKUL, T. and LIMTONG, S., 2020. Assessment of diversity of culturable marine yeasts associated with corals and zoanthids in the Gulf of Thailand, South China sea. Microorganisms, vol. 8, no. 4, pp. 474. http://doi.org/10.3390/microorganisms8040474 PMid:32225058.
    » http://doi.org/10.3390/microorganisms8040474
  • KAEWKRAJAY, C., PUTCHAKARN, S. and LIMTONG, S., 2021. Cultivable yeasts associated with marine sponges in the Gulf of Thailand, South China Sea. Antonie van Leeuwenhoek, vol. 114, no. 3, pp. 253-274. http://doi.org/10.1007/s10482-021-01518-6 PMid:33575960.
    » http://doi.org/10.1007/s10482-021-01518-6
  • KARASHIMA, R., YAMAKAMI, Y., YAMAGATA, E., TOKIMATSU, I., HIRAMATSU, K. and NASU, M., 2002. Increased release of glucuronoxylomannan antigen and induced phenotypic changes in Trichosporon asahii by repeated passage in mice. Journal of Medical Microbiology, vol. 51, no. 5, pp. 423-432. http://doi.org/10.1099/0022-1317-51-5-423 PMid:11990495.
    » http://doi.org/10.1099/0022-1317-51-5-423
  • KUNTHIPHUN, S., CHOKREANSUKCHAI, P., HONDEE, P., TANASUPAWAT, S. and SAVARAJARA, A., 2018. Diversity and characterization of cultivable oleaginous yeasts isolated from mangrove forests. World Journal of Microbiology & Biotechnology, vol. 34, no. 9, pp. 125. http://doi.org/10.1007/s11274-018-2507-7 PMid:30083778.
    » http://doi.org/10.1007/s11274-018-2507-7
  • KURTZMAN, C.P. and FELL, J.W., 1998. The yeasts, a taxonomic study 4th ed. Amsterdam: Elsevier Science.
  • KURTZMAN, C.P., FELL, J.W., BOEKHOUT, T. and ROBERT, V., 2011. Methods for isolation, phenotypic characterization and maintenance of yeasts. In: C. KURTZMAN, J.W. FEL and T. BOEKHOUT, eds. The yeasts: a taxonomic study. Amsterdam: Elsevier, pp. 7-110. http://doi.org/10.1016/B978-0-444-52149-1.00007-0
    » http://doi.org/10.1016/B978-0-444-52149-1.00007-0
  • KUTTY, S.N. and PHILIP, R., 2008. Marine yeasts: a review. Yeast, vol. 25, no. 7, pp. 465-483. http://doi.org/10.1002/yea.1599 PMid:18615863.
    » http://doi.org/10.1002/yea.1599
  • LACERDA, L.D., CONDE, J.E., KJERFVE, B., ALVAREZ-LEÓN, R., ALARCÓN, C. and POLANÍA, J. 2002. American mangroves. In Mangrove ecosystems: function and management. Berlin, Heidelberg: Springer Berlin Heidelberg, pp. 1-62.. http://doi.org/10.1007/978-3-662-04713-2_1
    » http://doi.org/10.1007/978-3-662-04713-2_1
  • LEE, J.W., MELCHER, G.A., RINALDI, M.G., PIZZO, P.A. and WALSH, T.J., 1990. Patterns of morphologic variation among isolates of Trichosporon beigelii. Journal of Clinical Microbiology, vol. 28, no. 12, pp. 2823-2827. http://doi.org/10.1128/jcm.28.12.2823-2827.1990 PMid:2280018.
    » http://doi.org/10.1128/jcm.28.12.2823-2827.1990
  • LIM, S.J., MUHD NOOR, N.D., SABRI, S., MOHAMAD ALI, M.S., SALLEH, A.B. and OSLAN, S.N., 2025. Features of the rare pathogen Meyerozyma guilliermondii strain SO and comprehensive in silico analyses of its adherence-contributing virulence factor agglutinin-like sequences. Journal of Biomolecular Structure & Dynamics, vol. 43, no. 7, pp. 3728-3748. http://doi.org/10.1080/07391102.2023.2300757 PMid:38189364.
    » http://doi.org/10.1080/07391102.2023.2300757
  • LOPES, R.G.P.S., ANTONIO, Í.G., TCHAIKA, L., BARROS, M.C. and FRAGA, E., 2018. Molecular identification of native oysters on the coast of Maranhão, Brazil. Boletim do Instituto de Pesca, vol. 44, no. 4, pp. e377. http://doi.org/10.20950/1678-2305.2018.44.4.377
    » http://doi.org/10.20950/1678-2305.2018.44.4.377
  • LORRINE, O.E., RAHMAN, R.N.Z.R.A., TAN, J.S., SALLEH, A.B. and OSLAN, S.N., 2023. Homology modeling and analysis of vacuolar aspartyl protease from a novel yeast expression host Meyerozyma guilliermondii strain SO. Arabian Journal for Science and Engineering, vol. 48, no. 1, pp. 81-91. http://doi.org/10.1007/s13369-022-07153-1
    » http://doi.org/10.1007/s13369-022-07153-1
  • MONAPATHI, M.E., BEZUIDENHOUT, C.C. and JAMES RHODE, O.H., 2020. Aquatic yeasts: diversity, characteristics and potential health implications. Journal of Water and Health, vol. 18, no. 2, pp. 91-105. http://doi.org/10.2166/wh.2020.270 PMid:32300084.
    » http://doi.org/10.2166/wh.2020.270
  • MONTELES, J.S., ALMEIDA FUNO, I.C.S., SANTOS DE CASTRO, T.C., PIRES VIANA, D.C., CONCEIÇÃO, F.S. and FRANÇA, V.L., 2009. Percepção sócio-ambiental das marisqueiras no município de Raposa-MA. Revista Brasileira de Engenharia de Pesca, vol. 4, no. 2, pp. 34-45. http://doi.org/10.18817/repesca.v4i2.141
    » http://doi.org/10.18817/repesca.v4i2.141
  • NASCIMENTO JUNIOR, W.R., SOUZA-FILHO, P.W.M., PROISY, C., LUCAS, R.M. and ROSENQVIST, A., 2013. Mapping changes in the largest continuous Amazonian mangrove belt using object-based classification of multisensor satellite imagery. Estuarine, Coastal and Shelf Science, vol. 117, pp. 83-93. http://doi.org/10.1016/j.ecss.2012.10.005
    » http://doi.org/10.1016/j.ecss.2012.10.005
  • NIMSI, K.A., MANJUSHA, K., HATHA, A.A.M. and KATHIRESAN, K., 2023. Diversity, distribution, and bioprospecting potentials of manglicolous yeasts: a review. FEMS microbiology ecology, vol. 99, no. 5, pp. 1-7. http://doi.org/10.1093/femsec/fiad044 PMid:37142411.
    » http://doi.org/10.1093/femsec/fiad044
  • NOURAEI, H., GHARECHAHI, F., ZARESHAHRABADI, Z., ZOMORODIAN, K., GHARAVI, A., KHODADADI, H., ANSARI, S., AMIRZADEH, N. and PAKSHIR, K., 2024. Molecular characterization of non-Cryptococcus yeast communities isolated from Eucalyptus trees. Current Medical Mycology, vol. 10, pp. 1-6. http://doi.org/10.22034/CMM.2024.345184.1500 PMid:39744339.
    » http://doi.org/10.22034/CMM.2024.345184.1500
  • OLIVEIRA, A.G.L.D., FERNANDES, R.B., SANTOS, F.D.S., SILVA, I.D.S.D., GATTI, M.J.D.A., MORAES, A.M.L.D., MELLO-SILVA, C.C. and SANTOS, C.P., 2024. Filamentous fungi associated with the brown mussel, Perna perna (Bivalvia: Mytilidae), off the coast of Rio de Janeiro, Brazil. Marine Biology Research, vol. 20, no. 5-6, pp. 123-137. http://doi.org/10.1080/17451000.2024.2323727
    » http://doi.org/10.1080/17451000.2024.2323727
  • PADOVAN, A., KENNEDY, K., ROSE, D. and GIBB, K., 2020. Microbial quality of wild shellfish in a tropical estuary subject to treated effluent discharge. Environmental Research, vol. 181, pp. 108921. http://doi.org/10.1016/j.envres.2019.108921 PMid:31757407.
    » http://doi.org/10.1016/j.envres.2019.108921
  • PHAM, T.T., DINH, K.V. and NGUYEN, V.D., 2021. Biodiversity and enzyme activity of marine fungi with 28 new records from the tropical coastal ecosystems in Vietnam. Mycobiology, vol. 49, no. 6, pp. 559-581. http://doi.org/10.1080/12298093.2021.2008103 PMid:35035248.
    » http://doi.org/10.1080/12298093.2021.2008103
  • PITT, J.I. and MILLER, M.W., 1970. Speciation in the yeast genus Metschnikowia. Antonie van Leeuwenhoek, vol. 36, no. 3, pp. 357-381. http://doi.org/10.1007/BF02069037 PMid:5312513.
    » http://doi.org/10.1007/BF02069037
  • ROSA, C.A., LACHANCE, M.A., LIMTONG, S., SANTOS, A.R.O., LANDELL, M.F., GOMBERT, A.K., MORAIS, P.B., SAMPAIO, J.P., GONÇALVES, C., GONÇALVES, P., GÓES-NETO, A., SANTA-BRÍGIDA, R., MARTINS, M.B., JANZEN, D.H. and HALLWACHS, W., 2023. Yeasts from tropical forests: Biodiversity, ecological interactions, and as sources of bioinnovation. Yeast (Chichester, England), vol. 40, no. 11, pp. 511-539. http://doi.org/10.1002/yea.3903 PMid:37921426.
    » http://doi.org/10.1002/yea.3903
  • SAMPAIO, D.D.S., SANTOS, M.D.L.S., TAGLIARO, C.H. and BEASLEY, C.R., 2020. Variation in environmental characteristics of waters among Amazon coast oyster culture units. Acta Amazonica, vol. 50, no. 4, pp. 295-304. http://doi.org/10.1590/1809-4392202000250
    » http://doi.org/10.1590/1809-4392202000250
  • SANTOS, P.V.C.J., ALMEIDA-FUNO, I.C.S., PIGA, F.G., FRANÇA, V.L., TORRES, S.A. and MELO, C.D.P., 2011. Perfil sócioeconômico de pescadores do município da Raposa, Estado do Maranhão. Revista Brasileira de Engenharia de Pesca, vol. 6, no. 1, pp. I-IVX. http://doi.org/10.18817/repesca.v6i1.337
    » http://doi.org/10.18817/repesca.v6i1.337
  • SCHETTINI, C.A., ASP, N.E., OGSTON, A.S., GOMES, V.J., MCLACHLAN, R.L., FERNANDES, M.E., NITTROUER, C.A., TRUCCOLO, E.C. and GARDUNHO, D.C., 2020. Circulation and fine‐sediment dynamics in the Amazon Macrotidal Mangrove Coast. Earth Surface Processes and Landforms, vol. 4, no. 3, pp. 574-589. http://doi.org/10.1002/esp.4756
    » http://doi.org/10.1002/esp.4756
  • SCHNEIDER, V.A., GRAVES-LINDSAY, T., HOWE, K., BOUK, N., CHEN, H.C., KITTS, P.A., MURPHY, T.D., PRUITT, K.D., THIBAUD-NISSEN, F., ALBRACHT, D., FULTON, R.S., KREMITZKI, M., MAGRINI, V., MARKOVIC, C., MCGRATH, S., STEINBERG, K.M., AUGER, K., CHOW, W., COLLINS, J., HARDEN, G., HUBBARD, T., PELAN, S., SIMPSON, J.T., THREADGOLD, G., TORRANCE, J., WOOD, J.M., CLARKE, L., KOREN, S., BOITANO, M., PELUSO, P., LI, H., CHIN, C.S., PHILLIPPY, A.M., DURBIN, R., WILSON, R.K., FLICEK, P., EICHLER, E.E. and CHURCH, D.M., 2017. Evaluation of GRCh38 and de novo haploid genome assemblies demonstrates the enduring quality of the reference assembly. Genome Research, vol. 27, no. 5, pp. 849-864. http://doi.org/10.1101/gr.213611.116 PMid:28396521.
    » http://doi.org/10.1101/gr.213611.116
  • SIBIRNY, A.A., 1996. Pichia guilliermondii In: K. WOLF, ed. Nonconventional yeasts in biotechnology 1st ed. Heidelberg: Springer Berlin, pp. 255–275. http://doi.org/10.1007/978-3-642-79856-6_7
    » http://doi.org/10.1007/978-3-642-79856-6_7
  • SILVA, C.M., SILVA, A.L.P., WATANABE, K.F.C., CHAVES BEZERRA, N.P., BEZERRA, D.C., GOMES, H.M., FREIRE, T.B., SANTOS, L.S., CARVALHO NETA, A.V., SILVA, E.M.C. and COIMBRA, V.C.S., 2020. First report of detection of Toxoplasma gondii DNA in oysters (Crassostrea sp.) in the state of Maranhão. Revista Brasileira de Parasitologia Veterinária, vol. 29, no. 3, pp. e003720. http://doi.org/10.1590/s1984-29612020050 PMid:32667502.
    » http://doi.org/10.1590/s1984-29612020050
  • SILVA, N.B.A., MENDES, E.D.S., OLIVEIRA, W.R.R., CRUZ, T.D.S., VIANA, M.V., ARAÚJO, C.P.M. and SOARES, P.V.C.S., 2021. Levantamento dos riscos ocupacionais das marisqueiras no município de Raposa-MA. Brazilian Journal of Development, vol. 7, no. 7, pp. 69628-69644. http://doi.org/10.34117/bjdv7n7-235
    » http://doi.org/10.34117/bjdv7n7-235
  • SOUSA, B.F.S., AGUIAR, N.N., ALVES, L.M.C. and COSTA, M.C.P., 2020. Apis mellifera honey sanitary quality related to its form of collection. Brazilian Journal of Development, vol. 6, no. 10, pp. 79959-79972. http://doi.org/10.34117/bjdv6n10-428
    » http://doi.org/10.34117/bjdv6n10-428
  • SOUSA, C.B., COSTA, F.N., DA SILVA ALMEIDA FUNO, I.C., FREITAS, A.S. and BARROS, T.M., 2023. Qualidade microbiológica de ostras e de águas em manguezais de macromaré da costa amazônica (ilha de São Luís, MA), Brasil. Engenharia Sanitaria e Ambiental, vol. 28, pp. e20220051. http://doi.org/10.1590/s1413-415220220051
    » http://doi.org/10.1590/s1413-415220220051
  • SOUZA FILHO, P.W.M., 2005. Costa de manguezais de macromaré da Amazônia: cenários morfológicos, mapeamento e quantificação de áreas usando dados de sensores remotos. Revista Brasileira de Geofísica, vol. 23, no. 4, pp. 23. http://doi.org/10.1590/S0102-261X2005000400006
    » http://doi.org/10.1590/S0102-261X2005000400006
  • TAMURA, K., STECHER, G. and KUMAR, S., 2021. MEGA11: molecular evolutionary genetics analysis version 11. Molecular Biology and Evolution, vol. 38, no. 7, pp. 3022-3027. http://doi.org/10.1093/molbev/msab120 PMid:33892491.
    » http://doi.org/10.1093/molbev/msab120
  • TEIXEIRA, J., 2019. Comunidades de leveduras associadas a abelhas sem ferrão na região de Mata Seca em Minas Gerais. Belo Horizonte: Universidade Federal de Minas Gerais, 66 p. Dissertação de Mestrado em Microbiologia.
  • THOMPSON, J.D., HIGGINS, D.G. and GIBSON, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, vol. 22, no. 22, pp. 4673-4680. http://doi.org/10.1093/nar/22.22.4673 PMid:7984417.
    » http://doi.org/10.1093/nar/22.22.4673
  • TURNER, A.D., DHANJI-RAPKOVA, M., ROWLAND-PILGRIM, S., TURNER, L.M., RAI, A., VENUGOPAL, M.N., KARUNASAGAR, I. and GODHE, A., 2017. Assessing the presence of marine toxins in bivalve molluscs from southwest India. Toxicon, vol. 140, pp. 147-156. http://doi.org/10.1016/j.toxicon.2017.11.001 PMid:29109054.
    » http://doi.org/10.1016/j.toxicon.2017.11.001
  • WANG, H., KUANG, G., ZHANG, J., TIAN, Y., HU, Y., WANG, S., TANG, X., JIANG, Y., DU, L., WEI, J. and LIU, J., 2025. Emerging anthropozoonotic threat in amphibian aquaculture: first report of Trichosporon asahii-induced epidemic with cross-species virulence. Aquaculture Reports, vol. 43, pp. 102948. http://doi.org/10.1016/j.aqrep.2025.102948
    » http://doi.org/10.1016/j.aqrep.2025.102948
  • WANG, W.L., YANG, R.Y. and AO, J.H., 2009. Uncommon characteristics of the structure and development of Trichosporon asahii. Chinese Medical Journal, vol. 122, no. 15, pp. 1806-1810. PMid:19781330.
  • WEI, X., GUO, S., GONG, L.F., HE, G., PANG, K.L. and LUO, Z.H., 2018. Cultivable fungal diversity in deep-sea sediment of the East Pacific Ocean. Geomicrobiology Journal, vol. 35, no. 9, pp. 790-797. http://doi.org/10.1080/01490451.2018.1473531
    » http://doi.org/10.1080/01490451.2018.1473531
  • WHITE, T.J., BRUNS, T., LEE, S. and TAYLOR, J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: M.A. INNIS, D.H. GELFAND, J.J. SNINSKY and T.J. WHITE, eds. PCR protocols: a guide to methods and applications. New York: Academic Press.
  • XU, W., GUO, S., GONG, L., ALIAS, S.A., PANG, K.L. and LUO, Z.H., 2018. Phylogenetic survey and antimicrobial activity of cultivable fungi associated with five scleractinian coral species in the South China Sea. Botanica Marina, vol. 61, no. 1, pp. 75-84. http://doi.org/10.1515/bot-2017-0005
    » http://doi.org/10.1515/bot-2017-0005
  • XUE, S.J., LIU, J., LI, X.C., ZHANG, X.T., XIN, Z.Z., JIANG, W.W. and ZHANG, J.Y., 2023. First natural yeast strain trichosporon asahii hz10 with robust flavonoid productivity and its potential biosynthetic pathway. Journal of Agricultural and Food Chemistry, vol. 71, no. 45, pp. 17130-17140. http://doi.org/10.1021/acs.jafc.3c05188 PMid:37909088.
    » http://doi.org/10.1021/acs.jafc.3c05188
  • YAN, W., GAO, H., QIAN, X., JIANG, Y., ZHOU, J., DONG, W., XIN, F., ZHANG, W. and JIANG, M., 2021. Biotechnological applications of the non-conventional yeast Meyerozyma guilliermondii. Biotechnology Advances, vol. 46, pp. 107674. http://doi.org/10.1016/j.biotechadv.2020.107674 PMid:33276074.
    » http://doi.org/10.1016/j.biotechadv.2020.107674
  • YAN, Y., ZHENG, X., APALIYA, M.T., YANG, H. and ZHANG, H., 2018. Transcriptome characterization and expression profile of defense-related genes in pear induced by Meyerozyma guilliermondii. Postharvest Biology and Technology, vol. 141, pp. 63-70. http://doi.org/10.1016/j.postharvbio.2018.03.011
    » http://doi.org/10.1016/j.postharvbio.2018.03.011
  • YANG, X., WU, Q., ZHANG, J., HUANG, J., CHEN, L., LIU, S., YU, S. and CAI, S., 2015. Prevalence, enumeration, and characterization of Salmonella isolated from aquatic food products from retail markets in China. Food Control, vol. 57, pp. 308-313. http://doi.org/10.1016/j.foodcont.2015.03.046
    » http://doi.org/10.1016/j.foodcont.2015.03.046
  • ZAIN, N.A.A., TAN, K.L., KAHAR, P. and OGINO, C., 2025. Lipid production from palm acid oil (PAO) as a sole carbon source by Meyerozyma guilliermondii. Processes, vol. 13, no. 2, pp. 311. http://doi.org/10.3390/pr13020311
    » http://doi.org/10.3390/pr13020311
  • ZAKY, A.S., TUCKER, G.A., DAW, Z.Y. and DU, C., 2014. Marine yeast isolation and industrial application. FEMS Yeast Research, vol. 14, no. 6, pp. 813-825. http://doi.org/10.1111/1567-1364.12158 PMid:24738708.
    » http://doi.org/10.1111/1567-1364.12158
  • ZEIDAN, G.C., LUZ, M.D.S.A. and BOEHS, G., 2012. Parasites of economically important bivalves from the southern coast of Bahia State, Brazil. Revista Brasileira de Parasitologia Veterinária, vol. 21, no. 4, pp. 391-398. http://doi.org/10.1590/S1984-29612012000400009 PMid:23295820.
    » http://doi.org/10.1590/S1984-29612012000400009
  • ZHANG, X., ZONG, Y., LI, Z., YANG, R., LI, Z., BI, Y. and PRUSKY, D., 2020. Postharvest Pichia guilliermondii treatment promotes wound healing of apple fruits. Postharvest Biology and Technology, vol. 167, pp. 111228. http://doi.org/10.1016/j.postharvbio.2020.111228
    » http://doi.org/10.1016/j.postharvbio.2020.111228
  • ZHU, H.Y., HAN, D.Y., GUO, L.C., LI, J.N., WEI, X.Y., ZHANG, R.P., WANG, Q.M., SHANG, Y.J., LUO, L.J., WEI, Y.H., LIU, X.A. and BAI, F.Y., 2023. Diversity and distribution of yeasts in intertidal zones of China. Frontiers in Marine Science, vol. 10, pp. 1286511. http://doi.org/10.3389/fmars.2023.1286511
    » http://doi.org/10.3389/fmars.2023.1286511

Edited by

  • Editor:
    Felipe Polivanov Ottoni

Publication Dates

  • Publication in this collection
    27 Oct 2025
  • Date of issue
    2025

History

  • Received
    23 July 2024
  • Accepted
    08 Aug 2025
Creative Common - by 4.0
This is an Open Access article distributed under the terms of the Creative Commons Attribution license (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
location_on
Instituto Internacional de Ecologia R. Bento Carlos, 750, 13560-660 São Carlos SP - Brasil, Tel. e Fax: (55 16) 3362-5400 - São Carlos - SP - Brazil
E-mail: bjb@bjb.com.br
rss_feed Acompanhe os números deste periódico no seu leitor de RSS
Ir para o topo Reportar erro