Phylogenetic analyses on the mite Allopsoroptoides galli (Acari: Astigmata) using the molecular markers 18S and 28S rRNAABSTRACT
The mite Allopsoroptoides galli has been described as a psoroptoidid belonging to the subfamily Psoroptidae. This feather mite was first found in the year 2010, parasitizing hens on an egg farm in the state of São Paulo, Brazil. A phylogenetic investigation on the first DNA sequences of the mite A. galli was conducted. Through the polymerase chain reaction technique, fragments of the 18S and 28S rRNA region were amplified and then sequenced using the Sanger method. The sequences obtained were deposited in GenBank (OK533677 and OK533676). The identity of the amplified DNA fragments was established by entering the sequences obtained into the BLAST software. Listed sequences from GenBank, from both the 18S and the 28S region, were retrieved and aligned to subsequently set up phylogenetic trees, by means of the neighbor-joining (NJ), maximum parsimony (MP), and maximum likelihood (ML) methods. For both sequences obtained experimentally, the search in the GenBank DNA database yielded high similarity only with sequences of the pyroglyphid mite Dermatophagoides farinae. All the phylogenetic trees obtained for 18S rRNA sequences and 28S rRNA sequences presented a high degree of discordance with the current taxonomy.
Keywords
feather mites;
Guira guira
; Psoroptidae
INTRODUCTION
In the year 2013, the mite Allopsoroptoides galli was described by MIRONOV as a psoroptoidid belonging to the subfamily Psoroptidae. This feather mite was first found in the year 2010, parasitizing hens on an egg farm in the state of São Paulo, Brazil (TUCCI et al., 2014). After its description, A. galli was found in wild birds of the species Guira guira, which is widely distributed in Brazil. This bird species was believed to be the primary host of A. galli, and it was thought likely that horizontal transmission from G. guira to laying hens had occurred (HERNANDES et al., 2014).
According to PROCTOR (2003), the greatest diversity of mites associated with birds is in the suborder Astigmata. However, psoroptids in Astigmata, belonging to the superfamilies Analgoidea, Freyanoidea, and Pterolichoidea, are considered to be the true feather mites. They comprise approximately 2,000 species, and almost all of them are obligate symbionts. The superfamily Analgoidea accounts for around 50% of the feather mite fauna in non-Passeriformes birds, while in Passeriformes its supremacy is practically absolute (DABERT; MIRONOV, 1999).
Since 1915, many new genera have been attributed to the family Analgidae (sensu TROUESSART, 1915), which has made it necessary to establish subdivisions. DUBININ (1956) doubled the number of genera belonging to the family Analgidae, partly through including genera that had been attributed by TROUESSART (1915) to the family Pterolichae, and partly through adding new genera. At that time, the first divisions of this family into subfamilies were proposed. In 1958, GAUD elevated the subfamily Psoroptoididae to family level: it had previously belonged to the family Analgidae. In this reclassification, the new family Psoroptoididae was divided into two subfamilies: Psoroptidae, and Pandalurinae.
There is no direct evidence regarding the phylogenetic history of feather mites because of the lack of fossil data. Feather mites are considered to be a paraphyletic group, and the main factor in the evolution of analgids has been their cospeciation with their hosts. The fact that the grouping of their main clades does not have any good synapomorphic characteristics suggests that the likely explanation for the polytomy of analgids is that explosive radiation occurred soon after they first emerged (DABERT; MIRONOV, 1999).
Notably, there has been dynamism in the morphological taxonomic classifications of feather mites. This suggests that there is a need to correlate phylogeny with morphology to establish their taxonomic positions. The present study consisted of a phylogenetic investigation on the first DNA sequences from the mite A. galli, obtained by using the rRNA molecular markers 18S and 28S, with the aim of adding to the phylogenetic knowledge of feather mites. The field of knowledge requires a large volume of research to develop its integrative taxonomy, with the underlying purpose of understanding the evolution of feather mite species.
MATERIAL AND METHODS
DNA extraction
Fifty A. galli mites were placed in a 1.5-mL sterile plastic tube with a lid, containing 25 µL of ultrapure water. The tube was heated at 100°C for 3 min, in a Labnet heating block.
Amplification via PCR of the molecular markers 18S and 28S of the mite A. galli
The oligonucleotide sequences used for performing polymerase chain reaction (PCR) to obtain 18S and 28S rRNA were as described by KLIMOV and OCONNOR (2008). The exception was the oligonucleotide 9r, which was planned through multiple alignments of sequences of the same allele from organisms that were as close as possible, according to their morphological classifications, for which sequences were available in public DNA databases. The amplification of the DNA fragment from the 18S region was performed through PCR using the oligonucleotide pair 1f-Astigs and 9r (5’ – TTGTTACGACTTTTACTTCCTCTAGA – 3), while that of the 28S region was done using the pair 28S-1F-Astigs and 28SFF. The reagent used in both reactions was 2.0 × Taq DNA Polymerase Master Mix Red (1.5 mM MgCl2) (Ampliqon). For each reaction, 12.5 μL of the mix, 2.5 of each oligonucleotide, 2.5 μL of DNA sample, and 8 μL of ultrapure water were used. Water was used in the reactions as a negative control. For the amplification reaction of the 18S rRNA, the cycling used consisted of an initial denaturation at 94°C for 3 min, followed by 25 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s and synthesis at 72°C for 2,5 min. For the amplification reaction of the 28S rRNA, there was an initial denaturation at 94 °C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 61°C for 30 s, and synthesis at 72°C for 2,5 min.
Electrophoresis on agarose gel
The PCR product was analyzed on 1.5% agarose gel containing UniSafe™ Dye at the dilution of 1:20,000 v/v from stock, and the gel runs were done at 100 V. The visualization of the fragment size was based on a DNA molecular mass marker of 100 bp.
Purification of DNA fragments
DNA fragments of the expected molecular mass were purified using the commercial kit ExoSAP-IT™ PCR Product Cleanup Reagent (Thermo Fisher), following the manufacturer’s instructions.
DNA sequencing
Sequencing via Sanger’s method was done with the reagent Big Dye 3.1TM (Thermo Fisher Technologies), following the manufacturer’s instructions, using the same oligonucleotides as used for the amplification. The DNA fragments thus generated were analyzed in an automated capillary sequencer (Thermo Fisher Technologies), and 15 µL of the products from the sequencing reactions were applied to the run gel.
Phylogenetic analyses
The identity of the DNA fragments that were amplified was established by entering the sequences obtained into the BLAST software (Basic Local Alignment Search ToolTM, NCBI). The sequences from GenBank that are listed in Tables 1 and 2 were retrieved and aligned using the MUSCLE software, to then set up phylogenetic trees through the Mega10.0.5TM software, using the neighbor-joining (NJ), maximum parsimony (MP), and maximum likelihood (ML) methods.
18S rRNA sequences used for multiple alignments with the sequence obtained from Allopsoroptoides galli for the generation of phylogenetic trees.
28S rRNA sequences were used for multiple alignments with the sequence obtained from Allopsoroptoides galli for the generation of phylogenetic trees.
The phylogenetic trees generated through the ML method were inferred using a two-parameter maximum likelihood model (Kimura-2) and the highest logarithmic probability value possible. The initial trees for the heuristic search were obtained in an automated manner by applying the NJ and BioNJ algorithms to a matrix of genetic distances that was calculated through pairwise alignments by means of a composite maximum likelihood approach and selection of the topology with the highest logarithmic probability value possible.
The phylogenetic trees generated through the MP method were obtained by using the subtree-pruning-regrafting algorithm at the search level of 1. In this, the initial trees were obtained through random addition of sequences (100 replicates). The phylogenetic trees generated through the NJ method were calculated by using the LogDet model for evolutionary distances, with elimination of all positions at which there were no data to be calculated (option of complete deletion).
RESULTS
The sequences of 18S and 28S rRNA from the mite A. galli that were obtained in this study were composed of 589 and 642 base pairs, respectively. They have been deposited in GenBank with the following accession codes: OK533677, and OK533676.
A search in the DNA database of GenBank using the BLAST software (Basic Local Alignment Search Tool), with the experimental sequence obtained from 18S rRNA of the mite A. galli, resulted in a list of sequences of high similarity (around 95%) to DNA sequences from the family Psoroptoididae and others in the same superfamily (Analgoidea). However, after restricting the database only to rRNA sequences that had been reviewed and classified as highly reliable, the same search only returned sequences with high similarity (94%) to the pyroglyphid mite Dermatophagoides farinae. In the latter consultation, the other sequences presented similarities less than or equal to 85%. In both alignments, the percentage coverage of each sequence found was close to 100%.
The investigations on the 28S rRNA of the mite A. galli using the same databases as above resulted in a list of sequences of similarity around 83% with DNA sequences of the family Psoroptoididae and others of the same superfamily (Analgoidea). Like in the search with the sequence of 18S rRNA, a consultation restricted to data of greater reliability showed that the greatest similarity (81%) was with the 28S rRNA of the mite D. farinae, belonging to the family Pyroglyphidae.
The phylogenetic tree for the sequence of 18S rRNA that was set up using the MP method grouped the sequence of the mite A. galli with those of the genus Pandalura. The species of Pandalura and Picalgoides were grouped in their respective genera in nearby clades. The sequence of the genus Hyomesalges was unexpectedly grouped with the genera of the subfamily Pandalurinae. In this simulation, the sequences of both the tick R. (Boophilus) microplus and the pyroglyphid mite D. farinae were grouped with the psoroptoidids. This grouping was also unexpectedly obtained for the sequences of 28S rRNA through the same simulation method. In this tree of sequences of 28S rRNA, the genera Picalgoides, Mesalgoides, and Pandalura were grouped in monophyletic branches according to the respective genera, and the mite A. galli was grouped monophyletically with a baseline dichotomy between a species of the genus Hyomesalges in the subfamily Psoroptoidinae and the pyroglyphid mite D. farinae (Fig. 1).
Phylogenetic trees with 18S and 28S rRNA sequences from Allopsoroptoides galli by the maximum parsimony method.
The phylogenetic tree for the sequence of 18S rRNA of the mite A. galli that was set up using the NJ method grouped the sequence of the tick R. (Boophilus) microplus concordantly with the current taxonomy. This was not seen with the sequence of the pyroglyphid mite D. farinae, which was grouped with the psoroptoidids. The sequences of mites in the genera Picalgoides and Pandalura were grouped in monophyletic branches, according to the respective genera. The large group of psoroptoidids was divided into two paraphyletic branches. In one of them, the mite A. galli was grouped with three sequences of the genus Pandalura, while the other clade grouped the other representatives of the two subfamilies, Psoroptoidinae, and Pandalurinae. Through using this same simulation method, the topology of the 28S rRNA tree was shown to be similar to that of the 18S rRNA tree, since it monophyletically grouped the sequences of the genus Pandalura. However, the sequence of the mite A. galli was again grouped with the same baseline dichotomy that was observed in the tree obtained through the MP method (Fig. 2).
Phylogenetic trees with 18S and 28S rRNA sequences from Allopsoroptoides galli by the neighbor-joining method.
The phylogenetic tree for the sequence of 18S rRNA of the mite A. galli that was set up using the ML method showed the greatest fidelity to the current taxonomic classification, except once again for the positioning of the sequence of the pyroglyphid mite D. farinae, grouped with the psoroptoidids. In this tree, the representatives of the subfamily Pandalurinae were segregated from the single species of Psoroptoidinae (Hyomesalges) that was included in the multiple alignment, and the mite A. galli was grouped with the species of the genus Pandalura. The tree of the 28S rRNA generated through the same simulation method again grouped the mite D. farinae among the psoroptoidids and did not segregate the species of the genus Hyomesalges as a group paraphyletic to the subfamily Pandalurinae. However, like in the tree simulated for 18S rRNA, the sequence of the tick R. (Boophilus) microplus was positioned externally, as expected. In this tree, the mite A. galli was grouped paraphyletically with the sequence of the genus Temnalges, in a baseline dichotomy with sequences belonging to the genera Picalgoides and Mesalgoides, which belong to the subfamily Pandalurinae (Fig. 3).
Phylogenetic trees with 18S and 28S rRNA sequences from Allopsoroptoides galli by the maximum likelihood method.
The DNA sequences of the species D. farinae and R. (Boophilus) microplus that are available from public databases were correlated at different taxonomic levels to ascertain the robustness of the phylogenetic reconstruction. This was only successful at the highest taxonomic level and, even then, only through use of the NJ and ML methods.
DISCUSSION
Positioning similar to that of mites of the family Pyroglyphidae, paraphyletically to psoroptoidids, was also found by KLIMOV and OCONNOR (2013), both for the 18S marker and for the 28S one. The results obtained from the present study were in line with the findings of those authors, especially regarding trees with sequences from the 28S region, in which Hyomesalges was the psoroptoidid that was grouped paraphyletically closest to the pyroglyphid D. farinae, in comparison with other representatives of the family Psoroptoididae (Mesalgoides, Picalgoides, and Temnalges). It is important in this regard to cite the fact that MIRONOV (2013) reported that the genus Allopsoroptoides was very close to Cygnocoptes, a genus that, when described by FAIN and BOCHKOV in 2003, was classified as belonging to the family Pyroglyphidae.
MIRONOV (2013) argued that there was a need for phylogenetic studies on all species of psoroptoidids, which now number 54 recognized species. That opinion was based on the fact that KLIMOV and OCONNOR (2013) did not prove any paraphyletic relationships regarding the subfamilies Pandalurinae and Psoroptoidinae, in phylogenetic investigations on Astigmata. The results presented here corroborate that opinion, given that they did not prove any such relationship.
Although all the phylogenetic trees obtained, both for the 18S rRNA sequences and for the 28S rRNA sequences, presented high degrees of discordance with the current taxonomy, it was noted that in all the trees relating to 18S sequences the alignment of the mite A. galli was positioned paraphyletically with sequences of the genus Pandalura. However, with 28S sequences, the MP and NJ methods showed that the mite A. galli was grouped with all the other sequences, which were positioned as a large paraphyletic group with mites of the genus Pandalura. This large group was then subdivided into one branch containing the mites A. galli, Hyomesalges, and D. farinae and another containing all the other sequences, with which the first branch was grouped paraphyletically. This result was discordant with the current taxonomy, considering that these are species belonging to the family Psoroptoididae (subfamily Psoroptoidinae) and the family Pyroglyphidae, respectively. On the other hand, the analyses performed using the ML method showed that the mite A. galli was grouped with the genera of the family Pandalurinae: Temnalges, Picalgoides, and Mesalgoides. Phylogenetic trees that were discordant with each other, obtained from multiple alignments of distinct genetic markers similar to those from the present study, were also presented by Knowles and Klimov (2011) and by KLIMOV and OCONNOR (2013).
CONCLUSIONS
In all trees obtained for the 18S rRNA sequence, the alignment of A. galli was close to the sequences of the genus Pandalura, which belongs to the same subfamily Pandalurinae.
Regarding the 28s rRNA sequence, when the MP and NJ methods were used, there was a closer alignment with Hyomesalges and D. farine, and the ML method grouped A. galli with the genera of the subfamily Pandalurinae: Temnalges, Picalgoides, and Mesalgoides.
The generation of new DNA sequences, from other alleles, is essential to provide the necessary data for molecular analyses so that it is possible to increase the accuracy and robustness of the phylogenetic positioning of A galli.
ACKNOWLEDGEMENTS
Not applicable.
-
FUNDINGThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
-
ETHICAL APPROVAL
Comissão de Ética no Uso de Animais – Instituto Biológico No. 183/22.
AVAILABILITY OF DATA AND MATERIAL
Data sharing is not applicable to this article as no datasets were generated or analyzed during the current study.
REFERENCES
-
DABERT, J.; MIRONOV, S.V. Origin and evolution of feather mites (Astigmata). In: BRUIN, J.; VAN DER GEEST, L.P.S.; SABELIS, M.W. (eds.). Ecology and Evolution of the Acari. Dordrecht: Springer, 1999. Series Entomologica, v.55. p.89-103. https://doi.org/10.1007/978-94-017-1343-6_5
» https://doi.org/10.1007/978-94-017-1343-6_5 - DUBININ, V.B. Feather mites (Analgesoidea). Part III. Family Pterolichidae. Fauna USSR, v.6, n.7, p.1-813, 1956.
-
FAIN, A.; BOCHKOV, A.V. Observations on the Pyroglyphidae (Acari: Astigmata) with description of a new genus and species from Cygnus melanocoryphus (Molina) (Aves: Anatidae). International Journal of Acarology, v.29, n.2, p.123-126, 2003. https://doi.org/10.1080/01647950308683649
» https://doi.org/10.1080/01647950308683649 - GAUD, J. Acariens plumicoles (Analgesoidea) parasites des oiseaux du Maroc. II. Analgidae. Bulletin dela Société de Sciences Naturelles et Physiques du Maroc, v.38, p. 27-49, 1958.
-
HERNANDES, F.A.; PEDROSO, L.G.A.; MIRONOV, S.V. From cuckoos to chickens: a caught-in-the-act case of host shift in feather mites (Arachnida: Acari: Psoroptoididae). Parasitology Research, v.113, n.12, p.4355-4361, 2014. https://doi.org/10.1007/s00436-014-4110-7
» https://doi.org/10.1007/s00436-014-4110-7 -
KLIMOV, P.B.; OCONNOR, B. Origin and higher-level relationships of psoroptidian mites (Acari: Astigmata: Psoroptidia): Evidence from three nuclear genes. Molecular Phylogenetics and Evolution, v.47, n.3, p.1135-1156, 2008. https://doi.org/10.1016/j.ympev.2007.12.025
» https://doi.org/10.1016/j.ympev.2007.12.025 -
KLIMOV, P.B.; OCONNOR, B. Is permanent parasitism reversible?—Critical evidence from early evolution of house dust mites. Systematic Biology, v.62, n.3, p.411-423, 2013. https://doi.org/10.1093/sysbio/syt008
» https://doi.org/10.1093/sysbio/syt008 -
KNOWLES, L.L.; KLIMOV, P.B. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae). Parasitology, v.138, n.13, p.1750-1759, 2011. https://doi.org/10.1017/S003118201100031X
» https://doi.org/10.1017/S003118201100031X -
MIRONOV, S.V. Allopsoroptoides galli n. g., n. sp., a new genus and species of feather mites (Acari: Analgoidea: Psoroptoididae) causing mange in commercially raised domestic chicken in Brazil. Systematic Parasitology, v.85, n.3, p.201-212, 2013. https://doi.org/10.1007/s11230-013-9422-y
» https://doi.org/10.1007/s11230-013-9422-y -
PROCTOR, H.C. Feather mites (Acari: Astigmata): ecology, behavior, and evolution. Annual Review of Entomology, v.48, n.1, p.185-209, 2003. https://doi.org/10.1146/annurev.ento.48.091801.112725
» https://doi.org/10.1146/annurev.ento.48.091801.112725 - TROUESSART, E.L. Revision des genres de la sous-famille de Analgesidae ou Sarcoptides plumicoles. Bulletin de la Societe Zoologique de France, v.40, p.207-223, 1915.
-
TUCCI, E.C.; SOARES, N.M.; FACCINI, J.L.H.; VILAS BOAS, D. Additional information about a mange outbreak by Allopsoroptoides galli (Acari: Psoroptoididae) in commercial laying hens in the state of São Paulo, Brazil. Pesquisa Veterinária Brasileira, v.34, n.8, p.760-762, 2014. https://doi.org/10.1590/S0100-736X2014000800009
» https://doi.org/10.1590/S0100-736X2014000800009
Edited by
-
Associate Editor: Silvia Galleti https://orcid.org/0000-0002-0745-5716
Source: Elaborated by the authors.
Source: Elaborated by the authors.
Source: Elaborated by the authors.