SciELO - Scientific Electronic Library Online

vol.40 issue3Peritoneal fluid collection in healthy cattle and evaluation of changes in cell morphology during storage in refrigerated and non-refrigerated samplesAdiposity and weight gain in Mangalarga Marchador horses subjected to hypercaloric diet author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand




Related links


Pesquisa Veterinária Brasileira

Print version ISSN 0100-736XOn-line version ISSN 1678-5150

Pesq. Vet. Bras. vol.40 no.3 Rio de Janeiro Mar. 2020  Epub May 29, 2020 

Livestock Diseases

Detection of the mcr-1 gene in Enteropathogenic Escherichia coli (EPEC) and Shigatoxigenic E. coli (STEC) strains isolated from broilers

Detecção do gene mcr-1 em estirpes de Escherichia coli Enteropatogênicas (EPEC) e Shigatoxigênicas (STEC) isoladas de frangos de corte

Hugo P. Lopes2  *

Gisllany A. Costa2 

Ana C.L.Q. Pinto2 

Leandro S. Machado2 

Nathalie C. Cunha2 

Elmiro R. Nascimento2 

Virginia L.A. Pereira2 

Dayse L.C. Abreu2 

2 Departamento de Saúde Coletiva Veterinária e Saúde Pública, Universidade Federal Fluminense (UFF), Rua Vital Brazil Filho 64, Santa Rosa, Niterói, RJ 24230-340, Brazil.


Enteropathogenic Escherichia coli (EPEC) and Shigatoxigenic E. coli (STEC) strains are among the major pathotypes found in poultry and their products, which are capable of causing human enteric infections. Colistin has been claimed the drug of choice against diseases caused by multidrug-resistant Gram-negative bacteria (MDRGN) in humans. The mcr-1 gene was the first plasmidial gene that has been described to be responsible for colistin resistance and has also been detected in birds and poultry products. Our study aimed to detect the mcr-1 gene in enteropathogenic strains of E. coli in order to evaluate the resistance to colistin in broilers. The material was obtained from 240 cloacal samples and 60 broiler carcasses. The strains were isolated by the conventional bacteriological method and by the virulence genes, which characterize the enteropathogenic strains and resistance, and the samples were detected by polymerase chain reaction (PCR). Of the 213 isolated strains of E. coli, 57 (26.76%) were characterized as atypical EPEC and 35 (16.43%) as STEC. The mcr-1 gene was found in 3.5% (2/57) of the EPEC strains and 5.7% (2/35) of the STEC strains. In this study, it was possible to confirm that the mcr-1 resistance gene is already circulating in the broiler flocks studied and may be associated with the pathogenic strains.

INDEX TERMS: Detection; mcr-1; genes; enteropathogenic; Shigatoxigenic; Escherichia coli; strains; broilers; chicken; EPEC; STEC


Escherichia coli Enteropatogênica (EPEC) e Shigatoxigênica (STEC) estão entres os principais patotipos encontrados em aves e produtos avícolas que são capazes de causar doença entérica no homem. A colistina tem sido preconizada como droga de escolha para o tratamento de doenças causadas por bactérias Gram-negativas multirresistentes em humanos. O gene mcr-1 foi o primeiro gene plasmidial a ser descrito como responsável pela resistência a colistina e tem sido descrito em aves e produtos avícolas. Este estudo tem como objetivo a detecção do gene mcr-1 em estirpes de E. coli enteropatogênicas a fim de avaliar a resistência a colistina em frangos de corte. O material foi obtido a partir de 240 amostras cloacais e 60 carcaças de frango de corte. As estirpes foram isoladas pelo método bacteriológico convencional e os genes de virulência, que caracterizam as estirpes enteropatogênicas, e resistência foram detectados pela reação em cadeia pela polimerase (PCR). Das 213 estirpes de E. coli isoladas, 57 (26,76%) foram caracterizadas como EPEC atípica e 35 (16,43%) como STEC. O gene mcr-1 foi encontrado em 3,5% (2/57) das estirpes EPEC e 5,7% (2/35) das estirpes STEC. Neste estudo foi possível confirmar que o gene de resistência mcr-1 já está em circulação nos lotes de frango de corte estudados e pode estar associado às estirpes patogênicas.

TERMOS DE INDEZAÇÃO: Detecção; genes; mcr-1; estirpes; Escherichia coli; enteropatogênicas; Shigatoxigênicas; frangos de corte; EPEC; STEC


The Enteropathogenic Escherichia coli (EPEC) and Shigatoxigenic E. coli (STEC) strains are pathogens of public health importance due to their ability to cause enteric diseases in humans (Ifeanyi et al. 2016, Fierz et al. 2017, Torres 2017) these pathogens are isolated from poultry and poultry products (Dutta et al. 2011, Alonso et al. 2012, Samanta et al. 2015, Doregiraee et al. 2016, Badi et al. 2018).

The pathotype of EPEC strains are divided into atypical (EPEC-a) and typical (EPEC-t). Both strains have genes that can cause a characteristic lesion to the intestinal epithelium (eae gene), called “attaching and effacing” (AE lesion), but only EPEC-t contains the plasmid of E. coli adherence factor (EAF) (EPEC adherence factor). The EAF plasmids carry the bfp gene that encodes the production of type IV fimbria called the bundle-forming pilus (BFP), which is responsible for the bacterial adherence to enterocytes (Nataro & Kaper 1998). In fact, the EPEC-a pathotypes host humans and a variety of animals, while EPEC-t occurs primarily in humans, but has also been described in some rare cases in captive-bred monkeys, coyotes, and dogs (Souza et al. 2016). These animals are possible reservoirs and sources of infection for humans and the environment. In humans, in most cases, EPEC-induced diarrhea is self-limiting and is treated with rehydration therapy, but requires the use of antimicrobials in persistent infections (Ifeanyi et al. 2016).

Shiga Toxin (STX) is the main virulence factor for the characterization of the STEC pathotype, and the toxins are divided into groups STX 1 and STX 2 and encoded by the genes stx1 and stx2 , respectively. The STEC strains may present both genes alone or associated with. Patients infected with STX2-producing strains develop more frequently anemia, acute renal failure and thrombocytopenia, characterizing uremic hemolytic syndrome (UHS), than those infected with STX2-producing strains (Nataro & Kaper 1998). Some STEC strains are related to EPEC because they contain the eae gene, which is responsible for producing the AE lesion (Alonso et al. 2012). The presence of the eae gene increases the virulence of STEC strains carrying both the stx1 and stx 2 genes, associated or not (Beutin & Martin 2012). As with EPEC, antibiotic therapy is indicated only in severe cases (Menne et al. 2012). These drugs should be avoided in the diarrheal phase of infection of this pathotype, as they may be responsible for the rupture of the bacterial membrane causing the release of STX, which may aggravate the cases of the disease (Wong et al. 2012).

Colistin antimicrobial, from the group of polymyxins, acts on these pathotypes on the bacterial cell wall (Giske 2015). Due to the emergence of resistance of these pathogenic bacteria to multiple antimicrobials, colistin has reappeared as the last treatment choice (Rolain et al. 2014). Evidence of colistin resistance involving chromosomal genes has been described in other bacteria, mainly Klebsiella pneumoniae (Cannatelli et al. 2013). However, Liu et al. (2016) were the first research team to highlight the role of the mcr-1 plasmid gene that encodes an enzyme that alters bacterial cell wall structure by inhibiting the action of the antibiotic on the cell.

The recommended test for phenotypic characterization of colistin resistance is the broth microdilution test. However, due to this antimicrobial characteristic of adhering to various materials, including plastics, the phenotypic characterization using this technique, as well as the disc diffusion technique, does not guarantee reliable results (Karvanen et al. 2017). Given the consequent difficulty in phenotypic detection in clinical laboratories, the Agência Nacional de Vigilância Sanitária (ANVISA) (Brasil 2016a) recommends the detection of the mcr-1 gene by molecular techniques.

Human contamination by multidrug-resistant (MDR) E. coli strains from poultry products has been confirmed by Johnson et al. (2007). In this context, the presence of the mcr-1 gene becomes relevant due to the possibility of transferring colistin resistance to other bacteria of the human microbiota (Liu et al. 2016). In Brazil, the warning about the presence of these genes in bacteria isolated from animals and their products came from the detection of the mcr-1 gene in E. coli and Salmonella spp., isolated from chickens and swine (Fernandes et al. 2016) and also in humans (Rossi et al. 2017).

The objective of this study was to evaluate the presence of the mcr-1 gene in E. coli strains of EPEC and STEC pathotypes isolated from commercial broilers.

Materials and Methods

The experimental protocol of this study followed the Ethical Principles in Animal Experimentation of the “Sociedade Brasileira de Ciência em Animais de Laboratório ” (SBCAL) and obtained the approval of the Animal Use Ethics Committee (AUEC) of the Universidade Federal Fluminense (UFF), under no. 697.

Material collection. The samples analyzed were obtained from six slaughterhouses supervised by the State Inspection Service (SIE), in the eastern and southern regions of the state of Rio de Janeiro.

In the reception area of each slaughterhouse, 40 broiler chickens were selected to collect cloacal material. The material was collected as the aid of swabs, which were placed in groups of four swabs in tubes containing Cary Blair (OXOID®) medium, in a total of 10 tubes per batch. From the same batch, ten carcasses were randomly selected and removed from noria after dripping and individually wrapped in sterile bags. All samples were transported in recycled ice isotherms.

Conventional bacteriological isolation. In the laboratory, each pool of swab was washed and grown in tubes containing 10mL peptone saline (SSP) and 400mL of this solution added to the bags. Ten milliliters (10mL) from each carcass was removed and transferred to sterile tubes. All samples were incubated for 24h at 37°C according to the method recommended by the United States Department of Agriculture (USDA 1998).

After this period, all samples were seeded on MacConkey agar (HIMEDIA®) with subsequent incubation for 24h at 37°C. From each culture, three colonies with Escherichia coli compatible characteristics were selected for biochemical characterization using Triple Sugar Iron (TSI) (PRODIMOL®), Sulphide Indole Motility (SIM) (HIMEDIA®), Methyl Red Broth media (MR) and Voges Proskauer (VP) (MICRO MED®) and Citrate Agar (HIMEDIA®) (MacFaddin 2000).

PCR. All E. coli positive samples were subjected to DNA extraction by the thermal method (Andreatti Filho et al. 2011) and subsequently sent to the polymerase chain reaction (PCR) analysis for the detection of the virulence genes eae, stx1, stx2, and bfp, using gene-specific primer pairs (Table 1).

Table 1. Primer oligonucleotide sequence and size of PCR products obtained for detection of virulence genes of Enteropathogenic Escherichia coli (EPEC) and Shigatoxigenic E. coli (STEC) pathotypes and colistin resistance gene in broiler chickens 

Primer oligonucleotides Sequences Size of PCR products References
eae-F 5’ GACCCGGCACAAGCA TAAGC 3’ 384pb Dutta et al. (2011)
stx1 -F 5’ ATA AATCGCCATTCGTTGACTAC 3’ 180pb Dutta et al. (2011)
stx2 -F 5’ GGCACTGTCTGAAACTGCTCC 3’ 255pb Dutta et al. (2011)
Bfp-F 5’ GGAAGTCAAATTCATGGGGGTAT 3’ 300pb Vidal. (2005)
mcr1 5’ CGGTCAGTCCGTTTGTTC 3’ 309pb Liu et al. (2016)

For the amplification reaction of the eae gene, 1X Buffer 10X was added to each 100ng of DNA extracted in the previous step; 1.5mM MgCl2, 0.2mM dNTP, 0.4μM of each primer (Table 1), 1U Taq Polymerase; totaling the final volume of 25μL.

In the reaction for detection of stx-1 and stx-2 genes, 1X of 10X Buffer was added to each 100ng of extracted DNA, 2mM MgCl2, 0.4mM dNTP, 0.4μM of each specific primer (Table 1), 1U Taq Polymerase; totaling the final volume of 25μL.

For the bpf gene amplification reaction, every 100ng of DNA extracted in the previous step was added 1X 10X Buffer, 1.5mM MgCl2, 0.2mM dNTP, 0.4 of each primer (Table 1), 1U Taq Polymerase; totaling the final volume of 25μL.

Amplification was performed in a thermal cycler (Programmable Thermal, Controller-PTC-100). After prior denaturation at 94°C for 5 minutes, 30 cycles of 94°C for 45 seconds, 59°C for 45 seconds, 72°C for one minute and a final extension at 72°C for 6 minutes were used (Dutta et al. 2011).

For the amplification reaction of the mcr-1 gene were added to each 2.0μL of DNA, extracted in the previous step, 1X of 10X Buffer, 1.5mM MgCl2, 0.2mM dNTP, 0.2mM of each primer (Table 1), 1U Taq Polymerase; totaling the final volume of 25μL.

Amplification was performed in a thermal cycler under the following conditions: 94°C for 15 minutes; followed by 25 cycles with denaturation at 94°C for 30 seconds; annealing of the primers at 58°C for one minute and 30 seconds and extension at 72°C for one minute. After these cycles, a final step of 72°C was followed for 10 minutes and the samples were kept for 30 minutes at a temperature of 4°C.

The PCR products were submitted to 1.5% agarose gel electrophoresis and observed in a transilluminator under ultraviolet light.

Statistical analysis. Fisher’s exact test, with a significance level of 0.05, was used to evaluate the frequency association between EPEC and STEC strains and the presence of the mcr-1 gene in cloaca and carcass.

Results and Discussion

A total of 213 strains of Escherichia coli were isolated from the analyzed samples, being 107 isolated from carcasses and 106 isolated from cloacas.

EPEC and STEC characterization

Of the total strains isolated, 26.8% (57/213) were characterized as EPEC harboring only the eae gene. Of these, 53% (30/57) were isolated from the cloacas and 47% (27/57) from carcasses. None of the EPEC strains harbored the bfp gene and were therefore characterized as EPEC-a (Girón et al. 1993, Gomes & Trabulsi 2008), which was expected since only humans have been identified as EPEC-t hosts (Kaper et al. 2004) (Table 2). Probably the strains found in the study have reduced dissemination capacity in the poultry environment due to the absence of the bfp gene, also responsible for the adhesion of the bacteria at the binding site (Nataro & Kaper 1998).

Table 2. Frequency of virulence genes (eae, bfp, stx1 , stx2 ) and colistin resistance gene (mcr-1) in strains of Enteropathogenic Escherichia coli (EPEC) and Shigatoxigenic E. coli (STEC) pathotypes isolated from broiler chickens 

Virulence genes eae 57 (100%) -
bfp 0 0
stx1 0 2 (5.6%)
stx2 0 2 (5.6%)
stx1 + stx2 0 7 (20%)
stx1 + eae 0 23 (66%)
stx2 + eae 0 1 (2.8%)
stx1 + stx2 + eae 0 0
TOTAL 57 (100%) 35 (100%)
Resistance gene mcr-1 2/57 (3.5%) 2/35 (5.7%)

The EPEC-a strains have been detected in birds reared in the conventional system and its products (Dutta et al. 2011, Alonso et al. 2012, Samanta et al. 2015, Doregiraee et al. 2016, Badi et al. 2018), as occurred in the present study.

Of the isolated strains, 16.4% (35/213) were characterized as STEC, being 54% (19/35) isolated from carcasses, and 46% (16/35) of the cloacas. The presence of both stx1 and stx2 genes characterizes the strains of the STEC pathotype, and genes may be present alone or associated, including the eae gene (Gomes & Trabulsi 2008).

Of the isolated STEC strains, 66% (23/35) presented the stx1 gene associated with the eae gene, 20% (7/35) presented the stx1 gene associated with the stx2, 5.6% (2/35) presented only the stx1 gene, 5.6% (2/35) presented the stx2 gene and only 2.8% (1/35) the stx2 gene associated with eae gene. No single strain had the stx1 and stx2 genes associated with the eae gene (Table 2). Among the STEC strains, the stx 1 gene in association with the eae gene is more frequent than reported by Dutta et al. (2011) and Samanta et al. (2015), demonstrating that these genes are in greater circulation in the STEC of birds and products studied. Although stx2 gene is associated with higher virulence of STEC strains, the association of stx1 gene with eae gene has been responsible for increased virulence of STEC strains (Beutin & Martin 2012).

There was a significant difference (p=0.0099), by Fisher’s test, between the presence of EPEC and STEC strains presented in this study, being isolated a higher percentage of EPEC-a pathotype strains (26.8%) in relation to STEC (16.4%), corroborating with Alonso et al. (2012) who observed 3.9% and 3.3% percentages of EPEC-a and STEC in carcasses and 11.9% and 0.1% of these same pathotypes in cloacas, respectively. Regardless of the detected pathotype, both are of great public health importance because they are responsible for human enteric diseases (Blanco et al. 2006, Rasko et al. 2011, Canizalez-Roman et al. 2016).

Detection of the mcr-1 gene. Of the strains isolated, 9/213 presented the mcr-1 gene by PCR, 6/9 from carcasses, and 3/9 from the cloacas. There was no statistical difference between the percentage of strains carrying the mcr-1 carcass or the cloaca gene (p=0.4984). Fernandes et al. (2016) and Irrgang et al. (2016) reaffirmed the circulation of the mcr-1 gene in percentages from 0 to 5.3% in live and broiler chicken meat.

Although the first description of the mcr-1 gene was in 2015 in China by Liu et al. (2016), this gene was detected in isolated E. coli strains in Germany in 2010 (Irrgang et al. 2016). Current work corroborated this study by describing the circulation of this gene in several countries to date (Fernandes et al. 2016, Trung et al. 2017, Clemente et al. 2019, Dominguez et al. 2019). Therefore, it is likely that the selective pressure of gene-bound that confers colistin resistance occurred even before its prohibition on animal production in some countries such as Brazil (Brasil 2016b).

Detection of the mcr-1 gene in poultry and carcasses in the present study is of concern because sensitive strains present in humans may become resistant if plasmid transfers from strains containing the mcr-1 gene from birds and products by manipulation or ingestion. Liu et al. (2016), suggested that the origin of plasmid from the mcr-1 gene favors gene transfer to sensitive bacteria from the environmental microbiota, farm animals and humans; this fact may lead to increased resistance of these strains to colistin.

EPEC and STEC strains with the mcr-1 gene. In this study, it was found that the mcr-1 gene was present in 3.5% (2/57) of EPEC strains and 5.7% (2/35) of STEC strains (Table 2). The presence of the mcr-1 gene in these strains is of concern because it is pathogenic to humans, posing a public health risk. The use of antimicrobials to treat infections caused by the EPEC and STEC pathotypes is recommended only in severe cases (Wong et al. 2012, Ifeanyi et al. 2016). As colistin has been cited as a last resort for the treatment of multidrug-resistant bacteria, resistance to this antimicrobial is very important, as it may be a limiting factor for the successful treatment of infections.


It was possible to detect the presence of EPEC and STEC strains and to confirm that the mcr-1 gene is circulating in these strains in live broilers and carcasses, representing a potential public health risk. This study seems to be the first report of the circulation of the mcr-1 resistance gene in the state of Rio de Janeiro.


To the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Brazil, for the Master’s Scholarship.


Alonso M.Z., Lucchesi P.M.A., Rodríguez E.M., Parma A.E. & Padola N.L. 2012. Enteropathogenic (EPEC) and Shigatoxigenic Escherichia coli (STEC) in broiler chickens and derived products at different retail stores. Food Control 23(2):351-355. <> [ Links ]

Andreatti Filho R.L., Gonçalves G.A.M., Okamoto A.S. & Lima E.T. 2011. Comparação de métodos para extração de dna na reação em cadeia da polimerase para detecção de Salmonella Enterica sorovar Enteritidis em produtos avícolas. Ciênc. Anim. Bras. 12(1):115-119. <> [ Links ]

Badi S., Cremonesi P., Abbassi M.S., Ibrahim C., Snoussi M., Bignoli G., Luini M., Castiglioni B. & Hassen A. 2018. Antibiotic resistance phenotypes and virulence-associated genes in Escherichia coli isolated from animals and animal food products in Tunisia. FEMS Microbiol. Lett. 365(10). <> <PMid:29635468> [ Links ]

Beutin L. & Martin A. 2012. Outbreak of Shiga toxin-producing Escherichia coli (STEC) O104:H4 infection in Germany causes a paradigm shift with regard to human pathogenicity of STEC strains. J. Food Protect. 75(2):408-418. <> <PMid:22289607> [ Links ]

Blanco M., Blanco J.E., Dahbi G., Mora A., Alonso M.P., Varela G., Gadela M.P., Schelotto F. & González E.A. 2006. Typing of intimin (eae) genes from enteropathogenic Escherichia coli (EPEC) isolated from children with diarrhoea in Montevideo, Uruguay: identification of two novel intimin variants (mB and jR/b2B). J. Med. Microbiol. 55(Pt 9):1165-1174. <> <PMid:16914645> [ Links ]

Brasil 2016a. Detecção do gene responsável pela resistência à polimixina mediada por plasmídeos (mcr-1) no Brasil. Comunicado de risco nº 01/2016, Gerência de Vigilância e Monitoramento em Serviços de Saúde (GVIMS), Gerência Geral de Tecnologia em Serviços de Saúde (GGTES), Agência Nacional de Vigilâcia Sanitária (ANVISA), Brasília, DF. Available at <Available at > Accessed on May 22, 2018. [ Links ]

Brasil 2016b. Uso de substância antimicrobiana em rações animais é proibido. Instrução normativa nº 45 de 22 de novembro de 2016, Diário Oficial da União 229:6, Ministério Da Agricultura, Pecuária e Abastecimento, Brasília, DF. Available at <Available at > Accessed on Feb. 22, 2019. [ Links ]

Canizalez-Roman A., Flores-Villaseñor H.M., Gonzalez-Nuñez E., Velazquez-Roman J., Vidal J.E., Muro-Amador S., Alapizco-Castro G., Díaz-Quiñonez J.A. & León-Sicairos N. 2016. Surveillance of diarrheagenic Escherichia coli strains isolated from diarrhea cases from children, adults and elderly at northwest of Mexico. Front. Microbiol. 7:1-11. <> <PMid:27965648> [ Links ]

Cannatelli A., D’Andrea M.M., Giani T., Di Pilato V., Arena F., Ambretti S., Gaibani P. & Rossolini G.M. 2013. In vivo emergence of colistin resistance in Klebsiella pneumoniae producing KPC-type carbapenemases mediated by insertional inactivation of the PhoQ/PhoP mgrB regulator. Antimicrob. Agents Chemother. 57(11):5521-5526. <> <PMid:23979739> [ Links ]

Clemente L., Manageiro V., Correia I., Amaro A., Albuquerque T., Themudo P., Ferreira E. & Caniça M. 2019. Revealing mcr-1-positive ESBL-producing Escherichia coli strains among Enterobacteriaceae from food-producing animals (bovine, swine and poultry) and meat (bovine and swine), Portugal, 2010-2015. Int. J. Food Microbiol. 296:37-42. <> <PMid:30844701> [ Links ]

Dominguez J.E., Faccone D., Tijet N., Gomez S., Corso A., Fernández-Miyakawa M.E. & Melano R.G. 2019. Characterization of Escherichia coli carrying mcr-1-plasmids recovered from food animals from Argentina. Front. Cell. Infect. Microbioly. 9:41. <> <PMid:30895173> [ Links ]

Doregiraee F., Alebouyeh M., Fasaei N.B., Charkhkar S., Tajedin E. & Zali M.R. 2016. Isolation of atypical enteropathogenic and Shiga toxin encodingEscherichia coli strains from poultry in Tehran, Iran. Gastroenterol. Hepatol. Bed Bench 9(1):53-57. <PMid:26744615> [ Links ]

Dutta T.K., Roychoudhury P., Bandyopadhyay S., Wani S.A. & Hussain I. 2011. Detection and characterization of Shiga toxin producing Escherichia coli (STEC) and enteropathogenic Escherichia coli (EPEC) in poultry birds with diarrhoea. Indian J. Med. Res. 133(5):541-545. <PMid:21623041> [ Links ]

Fernandes M.R., Moura Q., Sartori L., Silva K.C., Cunha M.P., Esposito F., Lopes R., Otutumi L.K., Gonçalves D.D., Dropa M., Matté M.H., Monte D.F., Landgraf M., Francisco G.R., Bueno M.F., Oliveira Garcia D., Knöbl T., Moreno A.M. & Lincopan N. 2016. Silent dissemination of colistin-resistant Escherichia coli in South America could contribute to the global spread of the mcr-1 gene. Euro Surveill. 21(17). <> <PMid:27168587> [ Links ]

Fierz L., Cernela N., Hauser E., Nüesch-Inderbinen M. & Stephan R. 2017. Characteristics of Shigatoxin-producing Escherichia coli strains isolated during 2010-2014 from human infections in Switzerland. Front. Microbiol. 8:1471. <> <PMid:28824596> [ Links ]

Girón J.A., Ho A.S.Y., & Schoolnik G.K. 1993. Characterization of fimbriae produced by enteropathogenic Escherichia coli. J. Bacteriol. 175(22):7391-7403. <> <PMid:7901197> [ Links ]

Giske C.G. 2015. Contemporary resistance trends and mechanisms for the old antibiotics colistin, temocillin, fosfomycin, mecillinam and nitrofurantoin. Clin. Microbiol. Infect. 21(10):899-905. <> <PMid:26027916> [ Links ]

Gomes T.A.T. & Trabulsi L.R. 2008. Escherichia coli Enteropatogênica (EPEC), p.281-287. In: Trabulsi L.R. & Alterthum F. (Eds), Microbiologia. 5ª ed. Ed. Atheneu, São Paulo. [ Links ]

Ifeanyi C.I.C., Ikeneche N.F., Bassey B.E., Morabito S., Graziani C. & Caprioli A. 2016. Molecular and phenotypic typing of enteropathogenic Escherichia coli isolated in childhood acute diarrhea in Abuja, Nigeria. J. Infect. Dev. Ctries 11(7):527-535. <> <PMid:31071061> [ Links ]

Irrgang A., Roschanski N., Tenhagen B., Grobbel M., Skladnikiewicz-Ziemer T., Thomas K., Roesler U. & Käsbohrer A. 2016 Prevalence of mcr-1 in E. coli from livestock and food in Germany, 2010-2015. PLoS One 11(7): e0159863. <> <PMid:27454527> [ Links ]

Johnson J.R., Sannes M.R., Croy C., Johnston B, Clabots C, Kuskowski M.A., Bender J., Smith K.E., Winokur P.L. & Belongia E.A. 2007. Antimicrobial drug-resistant Escherichia coli from humans and poultry products, Minnesota and Wisconsin, 2002-2004. Emerg. Infect. Dis. 13(6):838-846. <> <PMid:17553221> [ Links ]

Kaper J.B., Nataro J.P. & Mobley H.L.T. 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2(2):123-140. <> <PMid:15040260> [ Links ]

Karvanen M., Malmberg C., Lagerback P., Friberg L.E., & Cars O. 2017. Colistin is extensively lost during standard in vitro experimental conditions. Antimicrob. Agents Chemother. 61(11):e00857-17. <> <PMid:28893773> [ Links ]

Liu Y.Y., Wang Y., Walsh T.R., Yi L.X., Zhang R., Spencer J., Doi Y., Tian G., Dong B., Huang X., Yu L.F., Gu D., Ren H., Chen X., Lv L., He D., Zhou H., Liang Z., Liu J.H. & Shen J. 2016. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect. Dis. 16(2):161-168. <> <PMid:26603172> [ Links ]

Macfaddin J.F. 2000. Biochemical Tests for Identification of Medical Bacteria. 3rd ed. Lippincott Williams and Wilkins, Baltimore. [ Links ]

Menne J., Nitschke M., Stingele R., Abu-Tair M., Beneke J., Bramstedt J., Bremer P.J., Brunkhorst R., Busch V., Dengler R.,Deuschl G., Fellermann K., Fickenscher H., Gerigk C., Goettsche A., Greeve J., Hafer C., Hagenmüller F., Haller H., Herget-Rosenthal S., Hertenstein B., Hofmann C., Lang M., Kielstein T.J., Klostermeier U.C., Knobloch J., Kuehbacher M., Kunzendorf U., Lehnert H., Manns P.M., Menne F.T., Meyer N.T., Michael C., Münte T., Neumann-Grutzeck C., Nuernberger J., Pavenstaedt H., Ramazan L., Renders L., Repenthin J., Ries W., Rohr A., Christian R.L., Samuelsson O., Sayk F., Schmidt W.M.B., Schnatter S., Schöcklmann H., Schreiber S., von Seydewitz UC., Steinhoff J., Stracke S., Suerbaum S., van de Loo A., Vischedyk M., Weissenborn K., Wellhöner P., Wiesner M., Zeissig S., Büning J., Schiffer M. & Kuehbacher T. 2012. Validation of treatment strategies for enterohaemorrhagicEscherichia coliO104:H4 induced haemolytic uraemic syndrome: case-control study. BMJ 345:e4565. <> <PMid:22815429> [ Links ]

Nataro J.P. & Kaper J.B. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11(1):142-201. <PMid:9457432> [ Links ]

Rasko D.A., Webster D.R., Sahl J.W., Bashir A., Boisen N., Scheutz F. & Waldor M.K. 2011. Origins of theE. colistrain causing an outbreak of hemolytic-uremic syndrome in Germany. N. Engl. J. Med. 365(8):709-717. <> <PMid:21793740> [ Links ]

Rolain J.M, Abiola O.O. & Morand S. 2014. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria. Front. Microbiol. 5:1-18. <> <PMid:25505462> [ Links ]

Rossi F., Girardello R., Morais C., Cury A. P., Martins L. F., Silva A. M., Abdala E., Setubal J.C. & Duarte A.J.S. 2017. Plasmid-mediated mcr-1 in carbapenem-susceptible Escherichia coli ST156 causing a blood infection: an unnoticeable spread of colistin resistance in Brazil? Clinics, São Paulo, 72(10):642-644. <> <PMid:29160428> [ Links ]

Samanta I., Joardar S.N., Das P.K. & Sar T.K. 2015. Comparative possession of Shiga toxin, intimin, enterohaemolysin and major extended spectrum beta lactamase (ESBL) genes in Escherichia coli isolated from backyard and farmed poultry. Iran J. Vet. Res. 16(1):90-93. <PMid:27175158> [ Links ]

Souza C.O., Melo T.R.B., Melo C.S.B., Menezes E. M., Carvalho A. C. & Monteiro L.C.R. 2016. Escherichia coli enteropatogênica: uma categoria diarreiogênica versátil. Revta Pan-Amaz. Saúde 7(2):79-91. <> [ Links ]

Torres A.G. 2017. Escherichia coli diseases in Latin America: a ‘one health’ multidisciplinary approach. Pathog. Dis. 75(2):1-7. <> <PMid:28158404> [ Links ]

Trung N.V., Matamoros S., Carrique-Mas J.J., Nghia N.H., Nhung N.T., Chieu T.T.B., Mai H.H., Rooijen W., Campbell J., Wagenaar J.A., Hardon A., Mai N.T.N., Hieu T.Q., Thwaites G., Jong M.D., Schultsz C. & Hoa N.T. 2017. Zoonotic transmission of mcr-1 colistin resistance gene from small-scale poultry farms, Vietnam. Emerg. Infect. Dis. 23(3):529-532. <> <PMid:28221105> [ Links ]

USDA 1998. Isolation and identification of Salmonella from meat, poultry, pasteurized egg, and siluriformes (Fish) products and carcass and environmental sponges. Method number 4. 09, Microbiology Laboratory GuideBook, Food Safety and Inspection Service 3rd ed. Available at <Available at > Accessed on May 10, 2018. [ Links ]

Wong C.S., Mooney J.C., Brandt J.R., Staples A.O., Jelacic S., Boster D.R., Watkins S.L. & Tarr P.I. 2012. Risk factors for the hemolytic uremic syndrome in children infected with Escherichia coli O157:H7: a multivariable analysis. Clin. Infect. Dis. 55(1):33-41. <> <PMid:22431799> [ Links ]

Received: July 22, 2019; Accepted: October 01, 2019

*Corresponding author:

Conflict of interest statement.- The authors have no competing interests.

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License