SciELO - Scientific Electronic Library Online

 
vol.42 número1Canulação do acesso vascular em pacientes em hemodiálise: abordagem técnicaEficácia, segurança e redução de custos no implante de cateter venoso central de longa permanência em pacientes dialíticos realizado por nefrologista índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

Compartilhar


Brazilian Journal of Nephrology

versão impressa ISSN 0101-2800versão On-line ISSN 2175-8239

Braz. J. Nephrol. vol.42 no.1 São Paulo jan./mar. 2020  Epub 02-Dez-2019

http://dx.doi.org/10.1590/2175-8239-jbn-2019-0051 

Artigos Originais

Expressão de irisina e troponina I em pacientes em diálise submetidos a pré-condicionamento isquêmico remoto: um estudo piloto

Flávia de Sousa Gehrke1  2 
http://orcid.org/0000-0002-2230-8853

Mariana Carvalho Gouveia3 
http://orcid.org/0000-0001-8194-7594

Carla Gabriela Marques Barbosa2 
http://orcid.org/0000-0001-8961-7952

Neif Murad4 
http://orcid.org/0000-0001-6192-9604

Beatriz da Costa Aguiar Alves Reis5 
http://orcid.org/0000-0001-9930-7747

Fernando Luiz Affonso Fonseca5  6 
http://orcid.org/0000-0003-1223-1589

Edimar Cristiano Pereira6 
http://orcid.org/0000-0001-6136-3700

Marcelo Rodrigues Bacci3 
http://orcid.org/0000-0001-8578-8404

1Universidade Paulista, Departamento de Farmácia, São Paulo, SP, Brasil.

2Instituto de Assistência Médica ao Servidor Público Estadual, Programa de Pós-Graduação em Ciências da Saúde, São Paulo, SP, Brasil.

3Centro Universitário em Saúde do ABC, Departamento de Nefrologia, Santo André, SP, Brasil.

4Centro Universitário em Saúde do ABC, Departamento de Cardiologia, Santo André, SP, Brasil.

5Centro Universitário em Saúde do ABC, Laboratório de Análises Clínicas, Santo André, SP, Brasil.

6Universidade Federal de São Paulo, Departamento de Ciências Farmacêuticas, Diadema, SP, Brasil.


RESUMO

Introdução:

A terapia de substituição renal continua associada a altas taxas de hospitalização e baixa qualidade de vida. A morbimortalidade por todas as causas na terapia de substituição renal é superior a 20% ao ano, sendo 44 vezes maior quando a diabetes está presente e mais de 10 vezes a da população em geral. Independentemente do tratamento, a sobrevida em 5 anos é de 40%, superando muitos tipos de câncer. A irisina é um hormônio que converte tecido adiposo branco em tecido adiposo bege, agregando efeitos positivos como o controle de massa gorda, tolerância à glicose, resistência à insulina, prevenção de perda muscular e redução da inflamação sistêmica.

Objetivos:

Determinar os níveis séricos de troponina I em pacientes em hemodiálise submetidos ao pré-condicionamento isquêmico remoto (PCIR) associado à expressão da irisina.

Métodos:

Estudo clínico prospectivo, randomizado, duplo-cego, com pacientes com doença renal crônica submetidos à hemodiálise por um período de 6 meses. Os níveis de troponina I, IL-6, uréia, TNF-α e creatinina foram determinados a partir de amostras de sangue. As expressões de irisina, tioredoxina, Nf-kb, GPX4, selenoproteína e GADPH foram também avaliadas por RT-PCR.

Resultados:

Foram analisadas amostras de 14 pacientes hipertensos, 9 (64,3%) dos quais eram diabéticos tipo 2, com idades entre 44 e 64 anos e 50% de cada gênero. A diferença entre os níveis pré e pós-intervenção de troponina I não foi significativa. Não houve diferenças entre os grupos PCIR e controle, exceto pela IL-6, embora tenha sido observada correlação significativa entre irisina e troponina I.

Conclusão:

O pré-condicionamento isquêmico remoto não modificou a expressão de irisina ou troponina I, independentemente do tempo de coleta.

Palavras-chave: Diálise Renal; Hipertensão; Diabetes Mellitus; Análise Química do Sangue; Troponina I

ABSTRACT

Background:

Renal replacement therapy continues to be related to high hospitalization rates and poor quality of life. All-cause morbidity and mortality in renal replacement therapy in greater than 20% per year, being 44 times greater when diabetes is present, and over 10 times that of the general population. Regardless of treatment, the 5-year survival is 40%, surpassing many types of cancers. Irisin is a hormone that converts white adipose tissue into beige adipose tissue, aggregating positive effects like fat mass control, glucose tolerance, insulin resistance, prevention of muscle loss, and reduction in systemic inflammation.

Objectives:

To determine the serum levels of troponin I in hemodialysis patients submitted to remote ischemic preconditioning (RIPC) associated with irisin expression.

Methods:

This was a prospective, randomized, double-blind clinical trial with patients with chronic kidney disease submitted to hemodialysis for a 6-month period. Troponin I, IL-6, urea, TNF-α, and creatinine levels were determined from blood samples. The expressions of irisin, thioredoxin, Nf-kb, GPX4, selenoprotein and GADPH were also evaluated by RT-PCR.

Results:

Samples from 14 hypertensive patients were analyzed, 9 (64.3%) of whom were type 2 diabetics, aged 44-64 years, and 50% of each sex. The difference between pre- and post-intervention levels of troponin I was not significant. No differences were verified between the RIPC and control groups, except for IL-6, although a significant correlation was observed between irisin and troponin I.

Conclusion:

Remote ischemic preconditioning did not modify irisin or troponin I expression, independent of the time of collection.

Keywords: Renal Dialysis; Hypertension; Diabetes Mellitus; Blood Chemical Analysis; Troponin I

INTRODUÇÃO

Apesar das recentes melhorias no processo de diálise, a terapia renal substitutiva continua apresentando altas taxas de hospitalização, o que está relacionado à má qualidade de vida. A morbimortalidade por todas as causas na terapia renal substitutiva é superior a 20% ao ano, sendo 44 vezes maior na presença de diabetes está presente e mais de 10 vezes a da população em geral1,2. Independentemente do tratamento, a sobrevida em 5 anos é de 40%, superando a de vários tipos de câncer3,4. Nos pacientes em hemodiálise, a mortalidade cardiovascular é responsável por 40% de todas as mortes, principalmente devido à insuficiência cardíaca, infarto agudo do miocárdio e arritmia cardíaca fatal3,5. Durante o tratamento prolongado, esses pacientes são suscetíveis a alterações morfofuncionais. A quantificação do fluxo sanguíneo do miocárdio (FSM) por tomografia por emissão de pósitrons (PET-TC) durante a hemodiálise de pacientes sem lesão coronariana angiográfica significativa evidencia alterações na contração segmentar do ventrículo esquerdo (VE) que foram correlacionadas com a redução global e segmentar do FSM, promovendo disfunção contrátil6. A redução segmentar do FSMF está associada a áreas circunscritas de necrose, permeabilidade alterada, níveis circulantes elevados de troponina cardíaca (cTnT), juntamente com regiões hipocinéticas do VE detectadas pela ecocardiografia. Episódios isquêmicos recorrentes durante a hemodiálise promovem lesão miocárdica com irreversibilidade funcional6.

A isquemia miocárdica pode ser desencadeada por vários fatores: alta prevalência de ateroma coronariano, hipertrofia ventricular esquerda, hipotensão intradialítica e fluxo coronariano de reserva reduzido (FRR), mesmo na ausência de estenose7,8. A hipertrofia ventricular esquerda (HVE), que geralmente ocorre na insuficiência renal, aumenta a pressão diastólica final no ventrículo, o estresse parietal que compromete o FSM, principalmente no subendocárdio9. O atordoamento miocárdico da disfunção do VE devido à isquemia transitória associada à hemodiálise é frequentemente prolongado, mas reversível6,10. Os episódios isquêmicos decorrentes da hemodiálise desempenham papel importante no desenvolvimento de insuficiência cardíaca e arritmias cardíacas11,12. Assim, reduzir a isquemia após a hemodiálise parece ser uma meta terapêutica desejável13.

A irisina é um hormônio identificado nas células musculares de camundongos transgênicos, expresso por Ppargc1a, que codifica o co-ativador-1α do receptor γ ativado pelo proliferador de peroxissomo (PGC-1α). Por sua vez, PGC-1α estimula a expressão gênica da proteína transmembrana fibronectina tipo III contendo a proteína 5 (Fndc5). Quando o Fndc5 sofre clivagem proteolítica, é liberado na corrente sanguínea com um fragmento contendo 112 aminoácidos residuais. Liga-se a receptores não identificados na superfície celular do tecido adiposo14. A irisina converte tecido adiposo branco em tecido adiposo bege, que agrega efeitos positivos como controle da massa gorda, tolerância à glicose, resistência à insulina, prevenção de perda muscular e redução da inflamação sistêmica15,16. A irisina tem potencial terapêutico para prevenir e tratar obesidade e diabetes17. Nos seres humanos, o FNDC5 é fortemente expresso no músculo esquelético, coração, língua e reto. A expressão do FNDC5 diminui no pâncreas, fígado e órgãos envolvidos na homeostase glicolítica18. Em humanos, a expressão de FNDC5 no tecido adiposo é até 200 vezes menor do que no músculo esquelético18,19. Os níveis circulantes são modulados por fatores que incluem dieta, obesidade, exercício, agentes farmacológicos e diferentes condições patológicas. O pré-condicionamento isquêmico remoto (PCIR) é uma intervenção não invasiva e não farmacológica da proteção miocárdica induzida pela interrupção transitória do fluxo sanguíneo em um membro por um manguito de pressão arterial, que demonstra um efeito protetor contra isquemia miocárdica (lesão por reperfusão).18,20,21 O PCIR está associado a uma redução na liberação de troponina I, menor elevação no segmento ST do ECG e menos eventos cardiovasculares adversos após intervenção coronária percutânea (ICP)19,22. Na cirurgia de revascularização do miocárdio, o PCIR demonstrou reduzir significativamente a liberação de troponina cardíaca (cTnT) 6, 12, 24 e 48 h após o procedimento cirúrgico11,23. Este estudo teve como objetivo determinar o comportamento dos níveis séricos de troponina I em pacientes em hemodiálise submetidos ao PCIR associado à expressão da irisina.

MATERIAIS E MÉTODOS

Um estudo clínico prospectivo, randomizado, duplo-cego foi conduzido pelo Laboratório de Análises Clínicas da Faculdade de Medicina do ABC (FMABC), em pacientes com doença renal crônica em hemodiálise por um período de seis meses. Os procedimentos seguiram os princípios da Declaração de Helsinque e foram aprovados pelo Comitê de Ética em Pesquisa da Universidade Paulista (UNIP), sob o protocolo no. 2.424.258. A elegibilidade consistiu em pacientes submetidos à terapia ambulatorial em hemodiálise, com idade igual ou superior a 18 anos, e diagnosticados com insuficiência renal crônica de acordo com a Iniciativa para Doenças Renais para Resultados Globais (KDIGO). Os pacientes que apresentaram neoplasia, infecção e eram HIV + foram excluídos. Amostras de sangue foram coletadas para determinar os níveis de troponina I usando métodos quantitativos de imunocromatografia (Human Quit). A IL-6 e o TNF-α foram analisados usando um método imunoenzimático quimioluminescente (Simens). As quantificações de uréia e creatinina foram realizadas utilizando um método enzimático colorimétrico em um espectrofotômetro totalmente automatizado (COBAS 6000 Roche). Boas práticas em análises clínicas foram seguidas em todas as análises realizadas neste estudo. Para análise da expressão gênica, o RNA foi extraído usando a técnica Trizol®. Um micrograma de cDNA foi convertido usando o kit Invitrogen Reverse Transcriptase Superscript II RNAse, segundo as recomendações do fabricante.

A técnica de qRT-PCR foi aplicada à sequência de cDNA obtida para que a irisina GADPH, tioredoxina, Nf-kb, GPX4 e selenoproteína pudessem ser analisadas da seguinte forma: 1X do tampão 2X SYBR Green PCR Master Mix tampão, 2,0 µL de cDNA e 0,4 mM do RT-PCR Primer Assay resultando em 15 µL do volume final da reação. O volume foi completado com água deionizada. A reação foi realizada em um Cycler 7500 (Applied Biosystems) usando o seguinte programa: 95° C por 10 min; 40 ciclos de 95° C por 15s e 60° C por 60s. A sequência de iniciadores utilizados está apresentada na Tabela 1.

Tabela 1 Sequência de primers 

Gene Sequência
GSH FOW 5'CTACGGACCCATGGAGGAG 3'REV 5'AGGCCATGGGACCTTCCT 3'
SE-P FOW 5'GGTTTGCCTTTTTCCTTCCT 3'REV 5'GCTCCTGGTTGCTGATTCTC 3'
TRX1 FOW 5' GCCATTGGCGATATATTGGA 3'REV 5' CTCTTGACGGAATCGTCCAT 3'
NF-kβ FOW 5' CTCTGTCATTCGTGCTTCC 3'REV 5' CATCCCATGGTGGACTACC 3'
Irisina REV 5' GATCCAGCCATCAAGGACAT 3'REV 5'TTGTCCAAGCTAGCATTTCTGA 3'
GAPDH FOW 5'CTGTGAGGTAGGTGCAAATGC 3'REV 5'GCCCACTTCACCGTACTAACCA 3

O grupo intervenção foi submetido ao PCIR no braço direito, utilizando um esfigmomanômetro a 200 mmHg por 5 minutos, seguido de 5 minutos de desinsuflação, repetidos três vezes por um total de 30 minutos, durante três sessões consecutivas de hemodiálise. O grupo controle não foi submetido a nenhuma intervenção adicional. As amostras de sangue foram coletadas antes do início da primeira e terceira sessões semanais. O nitrogênio da uréia no sangue (BUN) foi medido para calcular o pool único Kt/v, e irisina e troponina I para avaliar o comprometimento cardíaco devido à hemodiálise. O desfecho primário foi mortalidade, enquanto os desfechos secundários foram infarto agudo do miocárdio, acidente vascular cerebral e evento tromboembólico. Os níveis séricos de TNF-α, selenoproteína, tioredoxina e NFκB indicaram um perfil inflamatório. Amostras de urina foram coletadas para determinar a proporção de albumina/creatinina e proteína beta-traço (BTP) da primeira micção. A taxa de filtração glomerular estimada (TFGe) foi calculada usando a equação do estudo Modification of Diet in Renal Disease Study para adultos.

ANÁLISE ESTATÍSTICA

As variáveis qualitativas são apresentadas em frequência absoluta e relativa. O teste de Shapiro-Wilk foi utilizado para determinar variáveis quantitativas mostrando distribuição não normal dos dados (p < 0,05), e são apresentadas como valores medianos, percentis 25 e 75 e intervalo de confiança de 95%. O teste-t de Student e o teste de Wilcoxon foram utilizados para analisar a expressão intergrupos e intragrupo dos biomarcadores pré e pós-intervenção. O teste de Spearman foi utilizado para analisar a correlação entre os biomarcadores. O Stata versão 11.0 foi utilizado para todas as análises.

RESULTADOS

Este estudo incluiu 14 pacientes hipertensos de igual número de cada gênero, 9 (64,3%) dos quais eram diabéticos tipo 2 (DM2), com idades entre 44 e 64 anos. Houve três óbitos por eventos não cardiovasculares, um no grupo intervenção e dois no grupo controle (Tabela 2). A diferença entre os níveis de troponina I pré e pós-intervenção (PCIR) não foi significativa (p = 0,28). Não foi observada diferença significativa entre os pontos pré e pós-coleta para biomarcadores individuais. Além disso, não foi observada diferença entre os grupos PCIR e controle, exceto para IL-6 (p = 0,039), ao analisar os pontos de coleta e a presença ou ausência de PCIR (Tabela 3). O teste de correlação de Spearman indicou associação significativa (p = 0,56) entre irisina e troponina I (tabela 4).

Tabela 2 Características demográficas dos pacientes 

Variáveis Pacientes (n = 14)
Gênero (masculino) 7 (50%)
Hipertensão 14 (100%)
Óbito 3 (21,4%)
Diabetes 9 (64,3%)
Idade* 52 (44 - 64)

*Valores expressos como media e 95% IC.

Tabela 3 Associação entre os biomarcadores do grupo com e sem pré-condicionamento isquêmico remoto (PCIR) 

Biomarcadores HD sem PCIR HD com PCIR p*
Média (95%IC)
Δ Uréia 64,00 (43,00; 107,80) 61,00 (21,90; 115,80) 0,051
Δ Troponina I -0,01 (-0,03; 0,05) 0,00 (-0,01; 0,01) 0,361
Δ TNF-α -0,30 (-3,51; 2,76) 0,55 (-2,69; 9,61) 0,606
Δ IL6 -0,05 (-12,11; 2,54) 5,50 (-1,15; 9,39) 0,039
Δ Irisina 2,29 (-9,90; 14,47) -1,40 (-14,61; 38,72) 0,698
Δ Tioredoxina -1,53 (-23,80; 42,14) -0,08; (-3,86; 7,53) 0,439
Δ NF-Kβ -0,66 (-31,81; 42,99) 0,15 (-4,53; 6,95) 0,796
Δ GPX4 1,06 (-2,52; 6,76) 1,26 (-2,55; 12,86) 0,796
Δ Selenoproteína 5,14 (-10,29; 39,05) 0,61 (-12,89; 14,90) 0,439

*Mann-Whitney's; 95%IC: 95% intervalo de confiança.

Tabela 4 Correlação entre biomarcadores séricos 

Biomarcadores Irisina Tioredoxina NF-Kβ GPX4 Selenoproteína
Spearman's rho p Spearman's rho p Spearman's rho p Spearman's rho p Spearman's rho p
Uréia 0,147 0,615 -0,007 0,982 0,323 0,260 0,213 0,464 0,222 0,446
Troponina I -0,171 0,558 0,082 0,780 0,284 0,325 -0,246 0,396 0,-242 0,405
TNF-α 0,123 0,674 -0,247 0,395 -0,163 0,578 0,223 0,445 0,478 0,084
IL6 0,393 0,164 -0,108 0,714 0,090 0,759 -0,503 0,067 0,125 0,670

DISCUSSÃO

Este estudo teve como objetivo estabelecer a relação entre a expressão da irisina e os níveis de troponina I em pacientes em hemodiálise submetidos ao PCIR. A correlação negativa entre essas variáveis está em desacordo com a literatura atual. Cães hiperglicêmicos submetidos a dextrose intravenosa ou diabetes induzido quimicamente apresentaram aumento na extensão do infarto do miocárdio, além de anular a proteção resultante do pré-condicionamento31. Esses achados confirmam evidências pré-clínicas e clínicas que elucidam a interação adversa entre hiperglicemia e vias cardioprotetoras. Pesquisas realizadas em ratos, coelhos, cães, ovelhas e humanos tiveram resultados muito semelhantes25,26-28. Essas informações podem explicar a falta de correlação encontrada, pois nossa amostra foi composta por diabéticos (64,3%) e hipertensos (100%), em contraste com a literatura, que consiste em 40% de diabéticos29 e 32% de indivíduos hipertensos30. Dados separados provavelmente ocorreram devido ao pequeno tamanho da amostra.

Em ratos diabéticos, o efeito cardioprotetor do PCIR foi restaurado, aumentando o número de ciclos para obter o efeito desejado, o que indica que o diabetes aumenta o limiar de pré-condicionamento31. Em um modelo murino de isquemia e reperfusão, foi o número e a duração dos ciclos, e não o número de membros expostos ao PCIR que determinou sua eficácia. A janela de proteção precoce desapareceu entre 1,5 e 2 horas após o término do estímulo32. Em um estudo de 2018, pacientes em hemodiálise submetidos ao PCIR por três sessões sucessivas não obtiveram proteção miocárdica em comparação ao grupo controle33; no entanto, Park et al. alcançou tal proteção após doze sessões34. A inconsistência nesses achados pode ser devida ao número e/ou duração das sessões.

Foi sugerido que a cardioproteção deficiente em diabéticos se deve à função alterada do canal de potássio dependente de ATP (canal KATP) ou à diminuição da fosforilação de importantes quinases sinalizadoras, incluindo Akt (proteína serina/treonina quinase) e glicogênio sintase (GSK -3)35,36. Atualmente, dados prospectivos corroboram o possível papel da inflamação na diabetogênese, o que é consistente com hipóteses anteriores de que o diabetes mellitus tipo 2 pode ser uma manifestação da resposta aguda mediada por citocinas do sistema imunológico inato37. Nesse cenário, foram observadas associações positivas entre IL-6 e PCR, que permaneceram após o ajuste do índice de massa corporal, histórico familiar de diabetes, tabagismo, exercício, uso de álcool e terapia de reposição hormonal. Os riscos relativos multivariados para os quartis mais alto e mais baixo foram 2,3 para IL-6 (IC95%, 0,9-5,6, tendendo para = 0,07) e 4,2 para PCR (IC95% 1,5-12,0, tendendo para = 0,001)38,39.

Em relação à mortalidade no período de seis meses proposto, ocorreram três (21,4%) óbitos não cardiovasculares, um no grupo intervenção e dois no grupo controle. Isso corrobora os dados referentes à duração da hemodiálise que determinaram a relação entre a duração da terapia de hemodiálise e a mortalidade como desfecho primário em 11 países; a taxa de mortalidade (óbitos/100 pacientes-ano) foi de 16,9% (IC95%, 16,2-17,6) por um período de 121-365 dias40. Em todos os países, a mortalidade foi maior no início do estudo em comparação com o período intermediário, mas os períodos intermediário e tardio foram semelhantes. Dentro de cada período, uma mortalidade mais alta ocorreu nos Estados Unidos em comparação com a maioria dos outros países. Assim, internacionalmente, o período inicial de hemodiálise constitui o período de alto risco nos países estudados, e diferenças substanciais na mortalidade foram relatadas entre eles. Concluindo, independentemente do tempo de coleta, o PCIR não modificou os níveis de irisina e troponina I, embora ambos sejam biomarcadores conhecidos.

REFERENCES

1 Collins AJ, Foley RN, Chavers B, Gilbertson D, Herzog C, Ishani A, et al. US Renal Data System 2013 Annual Data Report. Am J Kidney Dis [Internet]. 2014 Jan; 63(1 Suppl):A7. Available from: https://doi.org/10.1053/j.ajkd.2013.11.001Links ]

2 Brown JH, Hunt LP, Vites NP, Short CD, Gokal R, Mallick NP. Comparative mortality from cardiovascular disease in patients with chronic renal failure. Nephrol Dial Transplant. 1994;9(8):1136-42. [ Links ]

3 Eknoyan G, Beck GJ, Cheung AK, Daugirdas JT, Greene T, Kusek JW, et al. Effect of dialysis dose and membrane flux in maintenance hemodialysis. N Engl J Med. 2002 Dec 19;347(25):2010-9. [ Links ]

4 Jager DJ, Grootendorst DC, Jager KJ, Van Dijk PC, Tomas LM, Ansell D, et al. Cardiovascular and noncardiovascular mortality among patients starting dialysis. JAMA. 2009 Oct 28;302(16):1782-9. [ Links ]

5 McIntyre CW, Burton JO, Selby NM, Leccisotti L, Korsheed S, Baker CS, et al. Hemodialysis-induced cardiac dysfunction is associated with an acute reduction in global and segmental myocardial blood flow. Clin J Am Soc Nephrol. 2008 Jan;3(1):19-26. [ Links ]

6 Cheung AK, Sarnak MJ, Yan G, Berkoben M, Heyka R, Kaufman A, et al. Cardiac diseases in maintenance hemodialysis patients: Results of the HEMO Study. Kidney Int [Internet]. 2004 Jun; 65(6):2380-9. Available from: https://doi.org/10.1111/j.1523-1755.2004.00657.xLinks ]

7 Ragosta M, Samady H, Isaacs RB, Gimple LW, Sarembock IJ, Powers ER. Coronary flow reserve abnormalities in patients with diabetes mellitus who have end-stage renal disease and normal epicardial coronary arteries. Am Heart J. 2004 Jun;147(6):1017-23. [ Links ]

8 Hasegawa M, Ishii J, Kitagawa F, Kanayama K, Takahashi H, Ozaki Y, et al. Prognostic value of highly sensitive troponin T on cardiac events in patients with chronic kidney disease not on dialysis. Heart Vessels [Internet]. 2013 Jul; 28(4):473-9. Available from: https://doi.org/10.1007/s00380-012-0273-2Links ]

9 Burton JO, Jefferies HJ, Selby NM, McIntyre CW. Hemodialysis induced cardiac injury: determinants and associated outcomes. Clin J Am Soc Nephrol [Internet]. 2009 May; 4(5):914-20. Available from: https://doi.org/10.2215/CJN.03900808Links ]

10 McIntyre CW. Effects of hemodialysis on cardiac function. Kidney Int [Internet]. 2009 Aug 2; 76(4):371-5. Available from: https://doi.org/10.1038/ki.2009.207Links ]

11 Hausenloy DJ, Mwamure PK, Venugopal V, Harris J, Barnard M, Grundy E, et al. Effect of remote ischemic preconditioning on myocardial injury in patients undergoing coronary artery bypass graft surgery: a randomised controlled trial. Lancet. 2007 Aug 18;370(9587):575-9. [ Links ]

12 Park J, Chung HC, Kim MS, Kim SJ, Chang JW, Lee JS. Relationship between extracellular water fraction of total body water estimated by bio-impedance spectroscopy and cardiac troponin T in chronic hemodialysis patients. Blood Purif [Internet]. 2009; 28(1):61-8. Available from: https://doi.org/10.1159/000210663Links ]

13 Otsuka T, Kawada T, Ibuki C, Seino Y. Association between high-sensitivity cardiac troponin T levels and the predicted cardiovascular risk in middle-aged men without overt cardiovascular disease. Am Heart J [Internet]. 2010 Jun; 159(6):972-8. Available from: https://doi.org/10.1016/j.ahj.2010.02.036Links ]

14 Boström P, Wu J, Jedrychowski MP, Korde A, Ye L, Lo JC, et al. A PGC1-a-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature [Internet]. 2012 Jan 11; 481(7382):463-8. Available from: https://doi.org/10.1038/nature10777Links ]

15 Huh JY, Panagiotou G, Mougios V, Brinkoetter M, Vamvini MT, Schneider BE, et al. FNDC5 and irisin in humans: I. Predictors of circulating concentrations in serum and plasma and II mRNA expression and circulating concentrations in response to weight loss and exercise. Metabolism [Internet]. 2012 Dec; 61(12):1725-1738. Available from: https://doi.org/10.1016/j.metabol.2012.09.002Links ]

16 Boström P, Wu J, Jedrychowski MP, Korde A, Ye L, Lo JC, et al. A PGC1-a-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature [Internet]. 2012 Jan 11; 481(7382):463-8. Available from: https://doi.org/10.1038/nature10777Links ]

17 Tsuchiya Y, Ando D, Takamatsu K, Goto K. Resistance exercise induces a greater irisin response than endurance exercise. Metabolism [Internet]. 2015 Sep; 64(9):1042-50. Available from: https://doi.org/10.1016/j.metabol.2015.05.010Links ]

18 Nygaard H, Slettaløkken G, Vegge G, Hollan I, Whist JE, Strand T, et al. Irisin in blood increases transiently after single sessions of intense endurance exercise and heavy strength training. PLoS One [Internet]. 2015 Mar 17; 10(3):e0121367. Available from: https://doi.org/10.1371/journal.pone.012136710:e0121367Links ]

19 Chen N, Li Q, Liu J, Jia S. Irisin, an exercise-induced myokine as a metabolic regulator: an updated narrative review. Diabetes Metab Res Rev [Internet]. 2016 May; 32(1):51-9. Available from: https://doi.org/10.1002/dmrr.2660Links ]

20 Moreno-Navarrete JM, Ortega F, Serrano M, Guerra E, Pardo G, Tinahones F, et al. Irisin is expressed and produced by human muscle and adipose tissue in association with obesity and insulin resistance. J Clin Endocrinol Metab [Internet]. 2013 Apr; 98(4):E769-78. Available from: https://doi.org/10.1210/jc.2012-2749Links ]

21 Kharbanda RK, Nielsen TT, Redington AN. Translation of remote ischemic preconditioning into clinical practice. Lancet [Internet]. 2009 Oct 31; 374(9700):1557-65. Available from: https://doi.org/10.1016/S0140-6736(09)61421-5Links ]

22 Hoole SP, Heck PM, Sharples L, Khan SN, Duehmke R, Densem CG, et al. Cardiac Remote Ischemic Preconditioning in Coronary Stenting (CRISP Stent) Study: a prospective, randomized control trial. Circulation [Internet]. 2009 Feb 2; 119(6):820-7. Available from: https://doi.org/10.1161/CIRCULATIONAHA.108.809723Links ]

23 Hausenloy DJ, Mwamure PK, Venugopal V, Harris J, Barnard M, Grundy E, et al. Effect of remote ischemic preconditioning on myocardial injury in patients undergoing coronary artery bypass graft surgery: a randomized controlled trial. Lancet [Internet]. 2007 Aug 18; 370(9587):575-579. Available from: https://doi.org/10.1016/S0140-6736(07)61296-3Links ]

24 Kersten JR, Schmeling TJ, Orth KG, Pagel PS, Warltier DC. Acute hyperglycemia abolishes ischemic preconditioning in vivo. Am J Physiol. 1998 Aug;275(2 Pt 2):H721-5. [ Links ]

25 Kersten JR, Toller WG, Gross ER, Pagel PS, Warltier DC. Diabetes abolishes ischemic preconditioning: role of glucose, insulin, and osmolality. Am J Physiol Heart Circ Physiol. 2000 Apr;278(4):H1218-24. [ Links ]

26 Tosaki A, Engelman DT, Engelman RM, Das DK. The evolution of diabetic response to ischemia/reperfusion and preconditioning in isolated working rat hearts. Cardiovasc Res. 1996;31:526-536. [ Links ]

27 Wider J, Undyala VVR, Whittaker P, Woods J, Chen X, Przyklenk K. Remote ischemic preconditioning fails to reduce infarct size in the Zucker fatty rat model of type-2 diabetes: role of defective humoral communication. Basic Res Cardiol [Internet]. 2018 May; 113(3):16. Available from: https://doi.org/10.1007/s00395-018-0674-1Links ]

28 Del Valle HF, Lascano EC, Negroni JA, Crottogini AJ. Absence of ischemic preconditioning protection in diabetic sheep hearts: role of sarcolemmal KATP channel dysfunction. Mol Cell Biochem. 2003 Jul;249(1-2):21-30. [ Links ]

29 Moretti C, Cerrato E, Cavallero E, Lin S, Rossi ML, Picchi A, et al. The EUROpean and Chinese cardiac and renal Remote Ischemic Preconditioning Study (EURO-CRIPS CardioGroup I): A randomized controlled trial. Int J Cardiol [Internet]. 2018 Apr 15; 257:1-6. Available from: https://doi.org/10.1016/j.ijcard.2017.12.033Links ]

30 Saran R, Robinson B, Abbott KC, Agodoa LYC, Bhave N, Bragg-Gresham J, et al. US Renal Data System 2016 Annual Data Report: epidemiology of kidney disease in the United States. Am J Kidney Dis [Internet]. 2018 Mar; 71(3 Suppl 1):A7. Available from: https://doi.org/10.1053/j.ajkd.2018.01.002Links ]

31 Tsang A, Hausenloy DJ, Mocanu MM, Carr RD, Yellon DM. Preconditioning the diabetic heart: the importance of Akt phosphorylation. Diabetes [Internet]. 2005 Aug; 54(8):2360-2364. Available from: https://doi.org/10.2337/diabetes.54.8.2360Links ]

32 Johnsen J, Pryds K, Salman R, Løfgren B, Kristiansen SB, Bøtker HE. The remote ischemic preconditioning algorithm: effect of number of cycles, cycle duration and effector organ mass on efficacy of protection. Basic Res Cardiol [Internet] 2016 Mar; 111(2):10. Available from: https://doi.org/10.1007/s00395-016-0529-6Links ]

33 Whittington HJ, Babu GG, Mocanu MM, Yellon DM, Hausenloy DJ. The diabetic heart: too sweet for its own good?. Cardiol Res Pract [Internet]. 2012; 2012:845698. Available from: https://doi.org/10.1155/2012/845698Links ]

34 Bacci MR, Vasconcelos LY, Murad N, Chagas AC, Capuano AC, Alves BC, et al. Remote ischemic preconditioning in myocardial protection in hemodialysis patients. Int J Gen Med [Internet]. 2018 May 8; 11:175-178. Available from: https://doi.org/10.2147/IJGM.S144385Links ]

35 Park J, Ann SH, Chung HC, Lee JS, Kim SJ, Garg S, et al. Remote ischemic preconditioning in hemodialysis: a pilot study. Heart Vessels [Internet]. 2014 Jan; 29(1):58-64. Available from: https://doi.org/10.1007/s00380-013-0329-yLinks ]

36 Miki T, Itoh T, Sunaga D, Miura T. Effects of diabetes on myocardial infarct size and cardio protection by preconditioning and postconditioning. Cardiovasc Diabetol [Internet]. 2012 Jun 13; 11(67):1-13. Available from: https://doi.org/10.1186/1475-2840-11-67Links ]

37 Pickup JC, Crook MA. Is Type II diabetes mellitus a disease of the innate immune system?. Diabetologia. 1998 Oct;41(10):1241-8. [ Links ]

38 Wang X, Bao W, Liu J, Ouyang YY, Wang D, Rong S, et al. Inflammatory Markers and Risk of Type 2 Diabetes A systematic review and meta-analysis. Diabetes Care [Internet]. 2013 Jan; 36(1):166-175. Available from: https://doi.org/10.2337/dc12-0702Links ]

39 Grossmann V, Schmitt VH, Zeller T, Panova-Noeva M, Schulz A, Laubert-Reh D, et al. Profile of the Immune and Inflammatory Response in Individuals With Prediabetes and Type 2 Diabetes. Diabetes Care [Internet]. 2015 Jul; 38(7):1356-1364. Available from: https://doi.org/10.2337/dc14-3008Links ]

40 Robinson BM, Zhang J, Morgenstern H, Bradbury BD, Ng LJ, McCullough KP, et al. World-wide, mortality is a high risk soon after initiation of hemodialysis. Kidney Int [Internet]. 2014 Jan; 85(1):158-65. Available from: https://doi.org/10.1038/ki.2013.252Links ]

Recebido: 13 de Agosto de 2019; Aceito: 20 de Setembro de 2019

Correspondência para: Flávia de Sousa Gehrke. E-mail: flaviagehrke@hotmail.com

CONTRIBUIÇÃO DO AUTOR

FSG: concepção, desenho e interpretação dos dados; redação do artigo, revisão crítica e aprovação da versão a ser publicada.

MCG e CGMB: interpretação dos dados e redação do artigo.

NM, BCAAR e FLAF: redação do artigo, revisão crítica e aprovação da versão a ser publicada.

ECP: revisão crítica e aprovação da versão a ser publicada.

MRB: concepção, redação do artigo, revisão crítica e aprovação da versão a ser publicada.

CONFLITO DE INTERESSE

Os autores declaram não ter conflito de interesses relacionado à publicação deste manuscrito.

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.