SciELO - Scientific Electronic Library Online

 
vol.54 número2Resultados preliminares da utilização de cultivos de anéis de traquéia para o estudo de estirpes brasileiras do vírus da bronquite infecciosa das galinhasFormas de exploração do rebanho caprino no Estado do Rio de Janeiro, 1998/2000 índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

  • Artigo em XML
  • Como citar este artigo
  • SciELO Analytics
  • Curriculum ScienTI
  • Tradução automática

Indicadores

Links relacionados

Compartilhar


Arquivo Brasileiro de Medicina Veterinária e Zootecnia

versão impressa ISSN 0102-0935versão On-line ISSN 1678-4162

Arq. Bras. Med. Vet. Zootec. v.54 n.2 Belo Horizonte abr. 2002

http://dx.doi.org/10.1590/S0102-09352002000200014 

COMUNICAÇÃO

[Communication]

 

Detecção de herpesvírus bovino 5 (BoHV-5) em bovinos do Sudeste Brasileiro

[Detection of bovine herpesvirus type 5 (BoHV-5) in cattle in Southeast Brazil]

 

L.I. Gomes1, M.A. Rocha2, E.A. Costa2, Z.I.P. Lobato2, L.C.N. Mendes3, A.S. Borges3, R.C. Leite2, E.F. Barbosa-Stancioli1*

1Instituto de Ciências Biológicas da Universidade Federal de Minas Gerais
Caixa Postal 486
31270-901 - Belo Horizonte, MG
2Escola de Veterinária da UFMG
3Departamento de Clínica, Cirurgia e Reprodução Animal da UNESP - Campus Araçatuba

 

Recebido para publicação em 27 de dezembro de 2001.
Recebido para publicação, após modificações, em 8 de fevereiro de 2002.
*Autor para correspondência
E-mail: edelfb@mono.icb.ufmg.br

 

 

O herpesvírus bovino 5 (BoHV-5), família Herpesviridae, subfamília Alphaherpesvirinae, é o agente etiológico de uma meningoencefalite nos bovinos. Essa enfermidade é de curso geralmente fatal e afeta principalmente animais jovens (Lovato, 1998; Roehe et al., 1998). Infecções pelo BoHV-5 já foram descritas em vários países. No Brasil, foram relatados surtos nos estados do Rio Grande do Sul (Méndez et al., 1987;Weiblen et al., 1989; Riet-Correa et al., 1989; Schild et al., 1994) e Mato Grosso do Sul (Salvador et al., 1998). O diagnóstico da infecção por BoHV-5 baseia-se nos achados clínico-epidemiológicos e de necropsia e histopatologia, confirmado pelo isolamento e identificação do vírus (Salvador et al., 1998). Outras enfermidades que acometem o sistema nervoso central (SNC) de bovinos como a raiva, a listeriose, a poliencefalomalácia e a encefalopatia espongiforme bovina apresentam sintomatologia clínica bastante semelhante. A raiva bovina, amplamente disseminada no Brasil, tem sido considerada a suspeita clínica primária em casos de encefalite bovina em várias regiões do país. O diagnóstico diferencial é muito importante para a correta interpretação clínica e do diagnóstico.

O presente trabalho relata a investigação laboratorial e a detecção do BoHV-5 por meio de um sistema de PCR nested para detecção específica do BoHV-5 (Botelho, 2000), utilizando-se a seqüência codificadora da glicoproteína G (Engelhardt & Keil, 1996). Foram avaliadas 19 amostras de SNC de bovinos que morreram com sintomatologia nervosa e com suspeita clínica primária para raiva, de uma mesma região geográfica do Estado de Minas Gerais em agosto de 2000. As amostras mineiras foram testadas por imunofluorescência indireta para raiva, todas com resultado negativo. Foram também analisadas três amostras parafinadas de SNC de bovinos, provenientes de dois municípios próximos, localizados no Estado de São Paulo e coletadas em 1993 e 1996. Essas amostras, previamente analisadas por histopatologia, apresentaram diagnóstico de meningoencefalite não supurativa multifocal

As amostras congeladas foram enviadas para pesquisa do BoHV-5 após quatro meses de estocagem (-20ºC). Cerca de dois gramas de cada amostra foram triturados com areia estéril e tratados por 24 horas a 4ºC com tampão salina contendo fosfato (PBS), pH 8.0, acrescido de 500UI/ml de penicilina, 500mg/ml de estreptomicina e 2,5mg/ml de anfotericina B. Após centrifugação, o sobrenadante foi conservado a –80ºC. Cerca de 100ml do sobrenadante foi filtrado em coluna de cromatografia Sephacril S400 (Pharmacia, Sweeden) como descrito por Santurde et al. (1996), e submetido à extração do DNA viral por fervura, utilizando-se resina Chelex 100 (BioRad, USA) (Walsh et al., 1991). O DNA das amostras parafinadas foi extraído segundo Ben-Ezra et al. (1991) com pequenas modificações. O material foi estocado a 4ºC até o momento do uso.

O isolado brasileiro de BoHV-5, EVI-88 (título 106,25 TCID50/50ml), foi utilizado como amostra de referência. Essa amostra foi cultivada em células Madin-Darby Bovine Kidney (MDBK). 

A PCR externa gerou um produto de 1297pb (senso: gctgttttggggcgccccgcg, anti-senso gtaggggaaactgcgggcaga) e a PCR interna 222pb (senso: tacggactgccggattaaca, anti-senso: gtcaccactaccaccgccgccaacat). Na reação utilizou-se 1% de glicerol, 1% de DMSO, 1,5mM de MgCl2, 100mM de dNTPs, 10pM de cada iniciador e 1ml da solução de DNA extraído. As temperaturas de ligação do iniciador ao alvo foram de  61ºC (reação externa) ou 57ºC (reação interna). O amplicon foi analisado em poliacrilamida 6% e o gel foi corado pela prata como descrito por Dias Neto et al. (1996).

Para a avaliação da especificidade do produto amplificado, amplicons de três amostras foram corridos em gel de agarose e a banda correspondente a 222pb foi excisada e purificada (WIZARDâ PCR Preps DNA Purification System) (Promega, USA). Seguiu-se o sequenciamento das amostras e a análise (programa BLASTN- NCBI - http://www.ncbi.nlm.ni h.gov). As seqüências foram depositadas no GenBank (NCBI, Bethesda, MD). O alinhamento foi feito com o programa Clustal W (http://clustalw.genome.ad.jp/) com seqüências de BoHV-5 e BoHV-1.  Para a construção da árvore filogenética, utilizou-se o programa Treecon® 3.1 para Windows (Van der Peer & Wachter, 1994).

O BoHV-5 foi detectado em três das 19 amostras de SNC e duas das três amostras parafinadas com positividade total de 22,7% (5/22). O produto de 222pb amplificado a partir de três amostras (uma congelada e duas parafinadas) foi clonado e seqüenciado. As seqüências foram depositadas no GenBank sob os números de acesso AF366571, AF298174 e AF298175. O alinhamento das seqüências obtidas neste trabalho com amostras de herpesvírus bovino 1 (X99754/BoHV-1.1; Z98199/BoHV-1.1; AJ004801/BoHV-1.1 e Z23068/BoHV-1.2) e amostras de BoHV-5 (X99755, AF250038, AF330158 e AF330157) mostrou homologia aproximada de  80% e 91%, respectivamente. A árvore filogenética das amostras mostrou a formação de dois "clusters" distintos, um entre as seqüências de BoHV-5 e outro entre as seqüências de BoHV-1, ambos com alto valor de bootstrap (dados não mostrados).

A Tab. 1 apresenta os dados referentes às amostras que apresentaram resultado positivo na PCR. As amostras de SNC congeladas eram provenientes de animais com idades distintas, sendo um jovem e dois adultos (oito meses, três e cinco anos). As amostras parafinadas eram provenientes de animais jovens, entre seis e 15 meses. O proprietário da fazenda no município de Birigui - SP (Tab. 1) relatou ainda a morte de outros sete animais de idades variadas, durante o surto da doença. Segundo Lovato (1998) e Roehe et al. (1998) a infecção por BoHV-5 no Brasil afeta principalmente animais jovens. Trabalhando com PCR em amostras parafinadas em estudo retrospectivo, Ely et al. (1996) encontraram 71% de positividade para BoHV-5 (5/7 animais) em animais de dois a quatro anos. Esses dados ressaltam a importância de avaliação da infecção em ampla faixa etária. Dos cinco animais positivos, três pertenciam a rebanhos localizados no Estado de Minas Gerais e dois no Estado de São Paulo, indicando que o vírus está circulando na região Sudeste. Até o presente momento há relatos de animais infectados em rebanhos do Rio Grande do Sul (Salvador et al., 1998) e crescente número de casos de encefalite por BoHV-5 no Estado de Mato Grosso do Sul (região centro-oeste).

 

 

De acordo com dados da Organização Mundial de Saúde e do Centro Pan-Americano de Febre Aftosa (Boletim, 1999), dos 3.433 casos de raiva em bovinos notificados nas Américas no ano de 1999, 3.225 casos (93,9%) ocorreram na América do Sul. O Brasil notificou a grande maioria (81,5%) dos casos e somente 34,5% foram confirmados por diagnóstico laboratorial. O diagnóstico de BoHV-5 em 22,7% de amostras avaliadas de animais sob suspeita clinica primária de raiva comprova a necessidade de se realizar exames laboratoriais para o diagnóstico diferencial das enfermidades que acometem o SNC de bovinos e alertar as autoridades sanitárias para delinear o perfil epidemiológico desta enfermidade no Brasil.

Palavras-chave: Herpesvírus bovino tipo 5, meningoencefalite, PCR nested, raiva

 

ABSTRACT

This paper reports the detection of bovine herpesvirus type 5 (BoHV-5) by a specific nested PCR assay. Samples were collected from the central nervous system (CNS) of cattle from Minas Gerais and São Paulo States, Brazil. All animals died presenting neurological symptoms. Nineteen frozen CNS samples analyzed had been previously tested by fluorescence antibody test for rabies virus and showed negative results. Three paraffin-embedded brain tissue samples were examined by histopatology and the observed alterations suggested nonsuppurative meningoencephalitis. BoHV-5 was detected in five (22.7%) among 22 tested samples. The occurrence of BoHV-5 infection is reported in the Southeast region of Brazil, indicating that epidemiological studies should be carried out.

Keywords: Bovine herpesvirus type 5, meningoencephalitis, nested PCR, rabies

 

 

AGRADECIMENTOS

Agradecemos a Dr. Marília de Oliveira Cavaliere do Instituto Mineiro de Agropecuária (IMA-MG) pelo fornecimento de amostras clínicas e ao Dr. Paulo Roehe (Centro de Pesquisas Veterinárias "Desidério Finamor" / FEPAGRO, Porto Alegre RS), pela cessão da amostra EVI-88 utilizada como padrão de BoHV-5. Este trabalho foi financiado pela Fundação de Amparo a Pesquisa do Estado de Minas Gerais (FAPEMIG).

 

REFERÊNCIAS

BEN-EZRA, J.; JOHNSON, D.A.; ROSSI, J. et al. Effect of fixation on the amplification of nucleic acids paraffin-embedded material by polymerase chain reaction. J. Histoch. Cytoch., v.39, p.351 - 354, 1991.        [ Links ]

BOLETIM de Vigilância Epidemiológica da Raiva nas Américas. Rio de Janeiro: Centro Panamericano de Febre Aftosa, v.31, p.34, 1999.         [ Links ]

BOTELHO, R.G.A. Desenvolvimento de testes de PCR para BoHV-5 e sua aplicação no diagnóstico de casos clínicos. 2000. 45f. Dissertação (Mestrado em Medicina Veterinária). Universidade Federal de Minas Gerais, Belo Horizonte, MG.        [ Links ]

DIAS NETO, E.; RAHAL, P.; CABALLERO, O.L.S.D. et al. DNA ligation quality control by competitive PCR. Trends Genet., v.12, p.341-342, 1996.         [ Links ]

ELY, R.W.; D'OFFAY, J.M.; RUEFER, A.H. et al. Bovine herpesviral encephalitis: a retrospective study on archived formalin-fixed, paraffin-embedded brain tissue. J. Vet. Diag. Invest., v.8, p.487- 492, 1996.        [ Links ]

ENGELHARDT, T.; KEIL, G.M. Identification and characterization of the bovine herpesvirus 5 US4 gene and gene products. Virology, v.225, p.126-135, 1996.        [ Links ]

LOVATO, L.T. BHV-1 e BHV-5, isolamentos sorologia no Rio Grande do Sul. In: SIMPÓSIO INTERNACIONAL DE HERPESVÍRUS BOVINO E VÍRUS DA DIARRÉIA VIRAL BOVINA, 1998, Santa Maria. Anais..., Santa Maria: UFSM, p.97-101, 1998.         [ Links ]

MENDÉZ, M.C.; RIET-CORREA, F.; SCHILD, A.L. et al. Laboratório Regional de Diagnóstico. Doenças diagnosticadas no ano de 1986. Pelotas: Editora da Universidade, 1987. 30 p.         [ Links ]

RIET-CORREA, F.; SCHILD, A.L.; MENDÉZ, M.C. et al. Meningoencefalite e necrose do córtex cerebral em bovinos causada por herpesvírus bovino-1. Pesq. Vet. Bras., v.9, p.13-16, 1989.        [ Links ]

ROEHE, P.M.; TEIXEIRA, M.B.; ESTEVES, P.A. et al. Situação do BoHV-1 e BHV-5 no Brasil. In: SIMPÓSIO INTERNACIONAL DE HERPESVIRUS BOVINO E VÍRUS DA DIARRÉIA VIRAL BOVINA, 1998, Santa Maria. Anais.... Santa Maria: UFSM, p.89-96, 1998.        [ Links ]

SALVADOR, S.C.; LEMOS, R.A.A.; ROEHE, P.M. Encefalite por HVB tipo 5. IN: LEMOS, R.A.A. Principais enfermidades de bovinos de corte do Mato Grosso do Sul. Campo Grande: Universidade do Mato Grosso do Sul, 1998. p.109-139.        [ Links ]

SANTURDE, G.; da SILVA, N.; VILLARES, R. et al. Rapid and high sensitivity test for direct detection of bovine herpesvirus-1 genome in clinical samples. Vet. Microbiol., v.49, p.81-82, 1996.        [ Links ]

SCHILD, A.L.; RIET-CORREA, F.; PEREIRA, D. B. et al. Doenças diagnosticadas pelo laboratório regional de diagnóstico em 1993. Bol. Lab. Reg. Diag. n.14, p.23-26, 1994.        [ Links ]

VAN DER PEER, Y.; DE WACHTER, R. Treecon for windows: a software package for the construction and drawing of evolutionary trees for the microsoft windows environment. Comput. Applic. Biosci., v.10, p.569 - 570, 1994.        [ Links ]

WALSH, P.S.; METZGER, D.A.; HIGUCHI, R. Chelex 100 as a medium for simple extraction as DNA for PCR-based tying from forensic material. Biotechniques, n.1, p.506-513, 1991.        [ Links ]

WEIBLEIN, R.; LOMBARDO DE BARROS, C.S.; CANABARRO, T.F. et al. Bovine meningoencephalitis from IBR virus. Vet . Rec., v.124, p.666-667, 1989.        [ Links ]

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons