SciELO - Scientific Electronic Library Online

 
vol.38CONSUMPTION OF ULTRA-PROCESSED FOODS BY CHILDREN UNDER 24 MONTHS OF AGE AND ASSOCIATED FACTORSEXCESS WEIGHT AND GASTROINTESTINAL SYMPTOMS IN A GROUP OF AUTISTIC CHILDREN author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Revista Paulista de Pediatria

Print version ISSN 0103-0582On-line version ISSN 1984-0462

Rev. paul. pediatr. vol.38  São Paulo  2020  Epub Feb 14, 2020

https://doi.org/10.1590/1984-0462/2020/38/2018351 

ARTIGO ORIGINAL

IDENTIFICAÇÃO DE MUTAÇÕES NO GENE DA PAH EM PACIENTES COM FENILCETONÚRIA DO ESTADO DE MATO GROSSO

Roseli Divino Costaa  * 
http://orcid.org/0000-0002-3605-5818

Bianca Borsatto Galeraa 
http://orcid.org/0000-0002-4662-3567

Bianca Costa Rezendea 
http://orcid.org/0000-0003-4318-0112

Amanda Cristina Venâncioa 
http://orcid.org/0000-0003-4951-7871

Marcial Francis Galeraa 
http://orcid.org/0000-0002-1624-7572

aUniversidade Federal de Mato Grosso, Cuiabá, MT, Brasil.


RESUMO

Objetivo:

Identificar mutações da fenilalanina hidroxilase (PAH) em pacientes com PKU (fenilcetonúria) do Serviço de Triagem Neonatal em Mato Grosso.

Métodos:

Estudo de corte transversal. Amostra composta de 19 pacientes com PKU através do exame de triagem neonatal biológica. Análise molecular: a) extração de DNA pela metodologia “salting out”. B) detecção de mutações IVS10nt-11G>A, V388M, R261Q, R261X, R252W e R408W pela técnica de polimorfismo de comprimento de fragmento de restrição (RFLP).

Resultados:

Dois alelos foram identificados em quatro pacientes (21,1%), um alelo em cinco pacientes (26,2%) e nenhum nos dez pacientes restantes (52,6%). Um total de 13/38 alelos foram identificados, correspondendo a 34,2% dos alelos PAH presentes. A variante mais prevalente foi a V388M (13,2% dos alelos), seguida de R261Q (10,1%) e IVS10nt-11G>A (7,9%). Três variantes (R261X, R252W e R408W) não foram encontradas. Os tipos de mutações mais frequentes foram: troca de sentido em oito alelos (18,4%) e emenda em quatro alelos (10,5%). O modelo proposto por Guldberg para determinar uma correlação genótipo/fenótipo foi aplicado para quatro pacientes clássicos de PKU, com duas mutações identificadas. Em três, o fenótipo previsto de PKU moderada/moderada ou moderada não coincidiu com o diagnóstico real. A predição coincidiu com o diagnóstico de um paciente PKU clássico. A incidência de PKU estimada para Mato Grosso, Brasil foi de 1:33.342 nascidos vivos para o período de 2003 a 2015.

Conclusões:

Foram encontradas apenas as mutações IVS10nt-11G>A, V388M, R261Q nas amostras analisadas. A correlação genótipo/fenótipo ocorreu em quatro (5,3%) pacientes.

Palavras-chave: Fenilcetonúria; Mutações; Triagem neonatal

ABSTRACT

Objective:

To identify phenylalanine hydroxylase (PAH) mutations in patients with phenylketonuria (PKU) from the Newborn Screening Service in Mato Grosso, Midwest Brazil.

Methods:

This is a cross-sectional descriptive study. The sample consisted of 19 PKU patients diagnosed by newborn screening. Molecular analysis: DNA extraction using the “salting-out” method. Detection of IVS10nt-11G>A, V388M, R261Q, R261X, R252W, and R408W mutations by the restriction fragment length polymorphism (RFLP) technique.

Results:

Two mutant alleles were identified in four patients (21.1%), one allele in five patients (26.2%), and none in the remaining ten patients (52.6%). A total of 13/38 alleles were detected, corresponding to 34.2% of the PAH alleles present. The most prevalent variant was V388M (13.2% of the alleles), followed by R261Q (10.1%) and IVS10nt-11G>A (7.9%). Three variants (R261X, R252W, and R408W) were not found. The most frequent mutation types were: missense mutation in eight alleles (18.4%) and splicing in four alleles (10.5%). The model proposed by Guldberg to determine a genotype/phenotype correlation was applied to four classical PKU patients with two identified mutations. In three of them, the predicted moderate/moderate or moderate PKU phenotype did not coincide with the actual diagnosis. The prediction coincided with the diagnosis of one classic PKU patient. The estimated incidence of PKU for Mato Grosso, Brazil, was 1:33,342 live births from 2003 to 2015.

Conclusion:

The only mutations found in the analyzed samples were the IVS10nt-11G>A, V388M, and R261Q. The genotype/phenotype correlation only occurred in four (5.3%) patients.

Keywords: Phenylketonuria; Mutations; Neonatal screening

INTRODUÇÃO

A fenilcetonúria (PKU, OMIM 261600)1 é um erro inato do metabolismo com uma herança autossômica recessiva, causada predominantemente por mutações no gene da fenilalanina hidroxilase (phenylalanine hydroxylase - PAH). Mutações no gene PAH prejudicam a função da enzima hepática EC 1.14.16.1 que catalisa a conversão de aminoácidos essenciais da L-fenilalanina (L-Phe) em L-tirosina (L-Tyr), um precursor dos neurotransmissores (dopamina, noradrenalina e adrenalina) e melanina.2 O gene PAH está localizado no cromossomo 12 (12q23.2), medindo cerca de 90 kbp de comprimento. O gene contém 13 éxons, codificando um polipeptídeo de 452 aminoácidos e formando um transcrito de leitura de 1359 pares de bases. Até hoje, mais de 800 mutações foram descritas no gene PAH.3

A PKU ocorre em todos os grupos étnicos e, devido à grande variabilidade genética, a prevalência pode diferir; as maiores taxas de nascimentos vivos foram encontradas na Irlanda (1: 4.500) e Turquia (1: 2.600), e as mais baixas na Finlândia, Japão e Tailândia (1:200.000, 1:143.000 e 1:212.000 nascidos vivos).4 No Brasil, a incidência varia muito: Sergipe (1:8.690), São Paulo (1:19.409), Tocantins (1:28.309), Santa Catarina (1:28.862).5 Em 2012, a prevalência em 18 estados brasileiros foi de 1:24.780 nascidos vivos.6 Segundo Stranieri,7 a prevalência de PKU no Mato Grosso foi de 1:33.068 nascidos vivos em 2009.

Estudos demonstraram variabilidade substancial nas mutações do gene PAH, que ainda não são totalmente conhecidas no Brasil. A distribuição de mutações no gene PAH entre a população brasileira é altamente inconsistente, de acordo com os poucos estudos realizados sobre o assunto. A mutação IVS10nt-11G>A é a mais frequente em estudos realizados em Ribeirão Preto/São Paulo8 (17,4%), enquanto uma investigação incluindo amostras de vários estados do Nordeste do Brasil mostra uma taxa de incidência de 22,1%, e um estudo de caso em Alagoas, 53%.8,9,10 A mutação I65T foi altamente prevalente no Rio Grande do Sul (19,5%), taxa semelhante à observada em Campinas (17,5%), São Paulo (sudeste do Brasil).11,12 Em Minas Gerais, também na região sudeste do Brasil, a mutação mais frequente foi a V388M, encontrada em 21,2% dos alelos.13 V388M (12,7%), R261Q (11,8%) e IVS10-11G> A (10,3%) foram as mutações mais frequentemente encontradas no Estado do Rio de Janeiro.14

A PKU não tratada está associada à incapacidade intelectual progressiva, acompanhada de vários sintomas adicionais, que podem incluir erupção eczematosa, autismo, convulsões e déficits motores. Problemas de desenvolvimento, comportamento aberrante e sintomas psiquiátricos geralmente se tornam aparentes à medida que a criança cresce.15 O tratamento padrão para PKU compreende duas estratégias conjuntas principais: uma dieta restrita a fenilalanina e o uso de fórmula metabólica rica em aminoácidos, livre de fenilalanina.16 Assim, a identificação dessas mutações por estudo molecular é utilizada como ferramenta para um diagnóstico preciso da PKU, orientando a equipe multidisciplinar para um acompanhamento mais eficiente do paciente.

O objetivo deste estudo foi verificar as bases moleculares responsáveis pela PKU, bem como estabelecer a correlação genótipo/fenótipo em indivíduos acompanhados pelo Serviço de Referência em Triagem Neonatal do Hospital Universitário Júlio Müller/Universidade Federal de Mato Grosso (Hospital Universitário Júlio Müller/Universidade Federal do Mato Grosso - HUJM/UFMT) em Mato Grosso (MT).

MÉTODO

Trata-se de um estudo transversal. A população estudada foi composta por pacientes diagnosticados com PKU durante a triagem neonatal no Serviço de Referência em Triagem Neonatal de Mato Grosso (SRTN/MT) no HUJM. O Comitê de Ética em Pesquisa com Seres Humanos da HUJM aprovou esta pesquisa sob o número 1.486.868, no dia 4 de abril de 2016.

O Programa Nacional de Triagem Neonatal - PNTN, criado pelo Ministério da Saúde/Secretaria de Saúde - Regulamento GM/MS nº 822, de 06/06/2001-, visa garantir não apenas a triagem ou seja, rastrear doenças incluídas no Programa Nacional, mas também permitir que as crianças diagnosticadas com uma dessas doenças recebam tratamento adequado em um estágio inicial, oferecendo uma oportunidade para uma intervenção adequada que possa reduzir a morbimortalidade. O Ministério da Saúde (MS) autorizou o Estado de Mato Grosso em 2001, e a UFMT foi registrada em 2002, através do HUJM, como SRTN sob o Regulamento SAS/MS nº 684, no dia 4 de outubro de 2002. Em 2002, o serviço começou a trabalhar na Fase I com hipotireoidismo congênito (HC) e fenilcetonúria (PKU). Desde 2014, a SRTN trabalha na fase IV do programa (Regulamento nº 488, 17 de junho de 2014).

As variáveis nominais analisadas foram idade, sexo, consanguinidade e recorrência familiar, além das seguintes variáveis epidemiológicas: incidência de PKU na MT e frequência de genótipos e fenótipos. Uma versão modificada da técnica “­salting-out” foi usada para extrair o ADN.17 A técnica descrita por Saik et al.18 foi utilizado para realizar a reação em cadeia da polimerase (RCP). Investigamos as mutações mais frequentemente encontradas em estudos realizados no Brasil: IVS10nt-11G>A, V388M (exão 11-primers 5’TGAGAGAAGGGGCACAAATG3’D, 5’GCCAACCACCCACAGATGAG3’R), R261Q, R261X, R252W (exão 7-primers 5’GGTGATGATTATAGAGTTGAGTCAGTTGAGTCAGT (exão 12 - 5’ATGCCACTGAGAACTCTCTT3’D, 5’GATTACTGAGAAACCGAGTGGCCT3’R)10 através da técnica de polimorfismo de comprimento de fragmento de restrição (restriction fragment length polymorphism - RFLP). Foram utilizados oligonucleotídeos do GBT Oligos - Certificado de Análise de Síntese de Oligonucleotídeos Personalizado, fornecido por Ludwig Biotec® (Alvorada-RS/Brasil).

O Master Mix de PCR (Ludwig Biotec®; Alvorada-RS/Brasil) foi utilizado de acordo com o folheto informativo, e a concentração de DNA foi de 100ng/µL. A RCP foi realizada nas seguintes condições: desnaturação inicial a 94°C por cinco a seis minutos, seguida de 35 ciclos de desnaturação a 95°C por 30 segundos, recozimento a 59°C por um minuto, extensão a 72°C por 30 segundos e uma extensão final a 72°C por cinco minutos. No caso do exão 11, a temperatura de recozimento foi de 61°C. Para a fase de digestão, foram utilizadas 5 U de endonucleases para todas as mutações, e a incubação foi realizada durante a noite a 37°C (Tabela 1). Uma eletroforese em gel de agarose a 2% foi usada e visualizada diretamente no transiluminador Molecular Imager ChemiDocTM XRS e no Image LabTM software, ambos da Bio-Rad® (Hercules, Califórnia, EUA).

Tabela 1 Tamanho do produto de PCR em pares de bases para os exões 7, 11 e 12 do gene da fenilalanina hidroxilase, mutação, endonuclease usada e fragmentos gerados em pares de bases. 

Exão Produto RCP Mutações Endonuclease Fragmento(s) após digestão - selvagem Fragmento(s) (pb) após digestão - mutado
7 263 R261Q a HinfI 116/147 263
R252W a Aval 86/177 263
R261X b DdelI 263 115/148
11 301 V388M a BsaAI 114/187 301
IVS10nt-11G>A b DdelI 301 78/223
12 238 R408W b Styl 238 97/141

adestrói o site de restrição; bcria o site de restrição.

Para estabelecer uma correlação entre genótipo e fenótipo em pacientes com PKU, Guldberg et al.19 criaram um modelo no qual a soma dos valores arbitrários (VA) para cada mutação identificada definiria o fenótipo clínico, conforme mostrado na Tabela 1. Assim, os casos clínicos seriam classificados como PKU clássica, PKU moderada, PKU leve e hiperfenilalaninemia (HPA) não-PKU, de acordo com esses valores.

As frequências foram calculadas como números absolutos e porcentagens.

RESULTADOS

O presente estudo avaliou um total de 19 pacientes de 15 famílias. O acompanhamento foi realizado na clínica SRTN/MT do HUJM/UFMT. Os pacientes foram distribuídos nas seguintes faixas etárias: crianças de 0 a 10 anos (57,9%), 11 a 20 (36,8%) e> 20 (5,3%). Os homens somaram 63,2% dos pacientes, dos quais 15,8% apresentaram consanguinidade e 21% eram irmãos.

O SRTN/MT diagnosticou 15 casos de PKU - um caso em cada um dos anos de 2003, 2005, 2006, 2009, 2013 e 2014; dois casos em cada um dos anos de 2008, 2010, 2011; e três casos em 2012. Três pacientes foram transferidos para o Mato Grosso de outros SRTN, e um paciente morreu.

Entre os 19 pacientes participantes do estudo, quatro (21,1%) tiveram seus dois alelos mutantes identificados. Cinco pacientes (26,3%) tiveram apenas um alelo identificado e dez pacientes (52,6%) permaneceram sem mutações identificadas. O estudo das 6 mutações descritas permitiu detectar 13/38 alelos, correspondendo a 34,2% dos alelos PKU da amostra. A mutação mais prevalente foi V388M (13,2% dos alelos), seguida por R261Q (10,1%) e IVS10nt-11-G> A (7,9%). As mutações R261X, R252W e R408W não foram identificadas. As mutações mais frequentes foram mutações missense, encontradas em oito pacientes (18,4%), e splicing, encontradas em quatro pacientes (10,52%), conforme apresentado na Tabela 2 e na Figura 1.

Tabela 2 Genótipos identificados em pacientes com fenilcetonúria do Serviço de Referência em Triagem Neonatal do Estado de Mato Grosso. 

Pacientes Genótipos Exão Mutação Frequência
01 IVS10n-t11G>A 11 Splice 1
03 V388M 11 Missense 2
06 R261Q 7 Missense 1
07 R261Q 7 Missense 1
08 R261Q 7 Missense 1
08 V388M 11 Missense 1
11 IVS10nt-11G>A 11 Splice 1
12 R261Q 7 Missense 1
12 IVS10nt-11G>A 11 Splice 1
13 V388M 11 Missense 1
13 IVS10nt-11G>A 11 Splice 1
14 V388M 11 Missense 1

Figura 1 Polimorfismo do comprimento dos fragmentos de restrição. 

A correlação genótipo/fenótipo foi baseada no estudo multicêntrico sobre a deficiência de fenilalanina hidroxilase realizada por Guldberg et al. em 1998.19 Essa correlação foi estabelecida a partir das atividades residuais previstas induzidas por cada mutação. Os VA foram determinados para cada mutação, com base em suas características: VA = 1 - mutação clássica da PKU; VA=2 - mutação moderada da PKU; VA= 4 - mutação leve da PKU; e VA=8--não-PKU. A identificação das duas mutações produziu dois VA, e sua soma definiria o fenótipo previsto por Guldberg et al., criando quatro variantes clínicas: PKU clássica, PKU moderada, PKU leve e HPA não-PKU, como mostrado em Tabela 1.12 Utilizamos o primeiro teste realizado na triagem de recém-nascidos para aplicar a classificação proposta por Guldberg et al., conforme visto em Tabela 3.19

Tabela 3 Correlação genótipo/fenótipo. 

Genótipo Fenótipo previsto Fenótipo observado
V388M PKU moderada/leve PKU clássica
R261Q / V388M PKU moderada/leve PKU clássica
R261Q / IVS10nt-11G> A PKU moderada/clássica PKU clássica
V388M / IVS10nt-11G> A PKU moderada PKU clássica

A incidência de PKU no período de 2003 a 2015 foi de 1:33.342 nascidos vivos na população estudada, segundo amostras coletadas no SRTN. A cobertura média do programa no Mato Grosso de 2003 a 2015 foi de 75,2%, considerando 664.943 nascimentos no mesmo período. Também no mesmo período, cinco pacientes foram transferidos de outros estados brasileiros.

DISCUSSÃO

A mutação mais encontrada foi o V388M, localizado no exão 11, códon 1162 (c.1162G> A) do gene PAH, no domínio catalítico, consistindo na substituição do aminoácido Valine (Val) pela metionina (Met).20,21 A mutação V388M foi descrita pela primeira vez em um paciente japonês, é comum na Península Ibérica e tem uma frequência relativamente alta em São Paulo e Chile.20 Está associado a um fenótipo grave e pode resultar da oxidação da metionina em sulfóxido de metionina. Essa modificação pode perturbar a superfície da proteína na interface entre subunidades e resultar na desestabilização do conjunto de tetrâmeros PAH.21 A mutação V388M foi a mais prevalente em nosso estudo, semelhante aos resultados obtidos no estado do Rio de Janeiro,14 , mas diferente dos dados encontrados em estudos realizados em Ribeirão Preto/São Paulo8 e no Sul do Brasil,11 onde a maior prevalência ocorreu no exão 7.

A mutação R261Q, localizada no exão 7, consiste em substituir o aminoácido Arginina (Arg) por Glutamina (Glu) no códon 782 (c.782G> A) do gene PAH, no domínio catalítico. Essa mutação pode ser encontrada em vários estudos publicados no Brasil, como os realizados em Ribeirão Preto/São Paulo em 2001 (12,2%), Rio Grande do Sul e Santa Catarina em 2003 (9,8%), Minas Gerais (16,0%), o Nordeste, onde participaram vários estados (8,7%), e Alagoas (35,0%), mas não foi identificado na pesquisa realizada em Campinas/São Paulo em 2008. Por outro lado, o R261Q foi a segunda (11,8%) mutação mais prevalente no estado do Rio de Janeiro.8,9,10,11,12,13,14 Em um estudo realizado nas províncias de Qazvin e Zanjan no Irã em 2015, o V388M foi a segunda mutação mais frequente. Essa mutação também é comum no Mediterrâneo e no sul da Europa, mas tem uma baixa incidência na Espanha.22

A maioria dos pacientes da pesquisa era do sexo masculino (57,9%), semelhante ao estudo publicado em Alagoas.10 A faixa etária prevalente foi de 3 a 10 anos, já prevista, por serem pacientes com SRTN. Pacientes com idade> 15 foram transferidos de outros estados. A consanguinidade, presente em 15,8% dos pacientes, é uma tendência social profundamente enraizada em um quinto da população mundial que vive no Oriente Médio, a Ásia Ocidental e o Norte da África, bem como entre os migrantes desses países que residem na América do Norte, Europa e Austrália.23 No Brasil, foi realizado um estudo epidemiológico transversal, utilizando o método dos Informantes-Chave, em cinco distritos do Rio Grande do Norte, no Nordeste do Brasil, onde as frequências de casamentos consanguíneos variaram entre 9 e 32%. Em média, 25% dos casais consanguíneos e 12% dos não consanguíneos tiveram um ou mais filhos com deficiência. A alta prevalência de pessoas com deficiência no nordeste brasileiro pode estar associada à tradição de casamentos consanguíneos nessas populações, e algumas dessas deficiências podem resultar de doenças genéticas.24 A consanguinidade pode ser medida pelo coeficiente de endogamia (F). Nosso estudo mostrou casamentos entre tios e sobrinhas de segundo grau e primos de terceiro grau. O F das crianças foi 1/8 e 1/16, respectivamente.25

Neste estudo, a presença das variantes mais frequentes foi avaliada de acordo com estudos publicados no Brasil, mas apenas 32% dos alelos mutados foram detectados.

Um estudo realizado entre 2009 e 2014, com famílias recrutadas em uma clínica de aconselhamento genético na China, selecionou 118 fetos de 112 famílias. Os autores identificaram 63 tipos de mutações, dentre as quais a R243Q foi a mais frequente. Dos fetos analisados, 64 recém-nascidos tiveram um parto normal, 31 resultaram em aborto e 23 mulheres ainda estavam grávidas ao final deste estudo. A mutação mais prevalente nos casos de aborto foi R243Q (16,12%), seguida por R413P e EXE-96A> G (9,7%) e R261Q (8,1%); nosso estudo não analisou a mutação R243Q. A porcentagem de abortos atribuídos à mutação IVS10nt-11G>A foi de 1,61%.26 No entanto, a mutação IVS10nt-11G>A está presente em nosso estudo, provando que qualquer casal com PKU deve ter uma gravidez planejada com acompanhamento genético.

A mutação IVS10nt-11G>A é um tipo de mutação nula localizada no exão 11 na região intragênica no códon 1066 (c.1066-11G> A) no domínio catalítico do gene PAH. Estava presente neste trabalho (7,9%), enquanto em Alagoas, Ribeirão Preto (São Paulo) e Região Nordeste, a mutação foi a mais prevalente. No Rio de Janeiro, foi a terceira mutação mais prevalente (10,3%), sendo a mais frequente em Portugal e ao longo da costa do Mediterrâneo, o que sugere fortemente uma rota de migração Leste-Oeste, mesmo antes da viagem transoceânica.9 No entanto, um estudo realizado com a população iraniana em 2015 não encontrou a mesma mutação.

De acordo com o PAHdb,26 as mutações missense são as mais comumente encontradas (60,1%), com as mutações de exclusão ocupando o segundo lugar (10,52%). Nosso estudo também mostrou mutações missense como as mais frequentes (18,4%), mas a segunda posição foi realizada por mutações splice (13,4%).

A correlação genótipo/fenótipo seguiu um modelo proposto por Guldberg et al. em 1998,19 que identificaram duas mutações em quatro pacientes (21,1%) de uma amostra que incluiu 19 indivíduos. Quatro pacientes apresentaram um fenótipo clássico de PKU, mas em três deles o fenótipo real não concordava com o que havia sido previsto, que era PKU moderada/leve ou moderada. Assim, a concordância entre o fenótipo esperado e o real ocorreu em 1/19 pacientes (5,3%).19

Em Alagoas, a correlação genótipo/fenótipo foi realizada em 14 indivíduos de uma amostra de 15 pacientes. Nove pacientes apresentaram um genótipo diferente do esperado - em vez de PKU moderada/leve, eles tinham PKU clássica, semelhante ao nosso estudo. No Nordeste, 42,7% (38/89) dos indivíduos apresentaram PKU leve ou moderada, estabelecendo correlação entre o previsto e o observado.9-10

Um estudo molecular da deficiência de fenilalanina-hidroxilase responsiva à tetra-hidrobiopterina (BH4) verificou que a BH-4-responsiva a PAH foi recentemente descrita como uma variante da deficiência de PAH causada por mutações específicas no gene PAH. Estudos sugerem que a resposta BH4 pode ser prevista a partir dos genótipos correspondentes. Dados dos testes de carga de BH4 indicaram uma incidência de BH4 em> 40% da população geral de PKU e> 80% dos pacientes com PKU leve. Nosso estudo encontrou as mutações R261Q e V388M, que respondem a BH4. Em relação ao IVS10nt-11G>A, seu uso ainda não está claro.27

A incidência de PKU neste estudo foi de 1:33.342. Segundo o MS, a cobertura da PNTN no Brasil foi de 84% em 2014. A cobertura do programa de triagem no Mato Grosso ficou abaixo da taxa nacional de 2003 a 2015, mas ressaltamos que os exames realizados no sistema privado de saúde não são relatados ao serviço de triagem. As ações da PNTN/MT representam um avanço notável na prevenção secundária de doenças crônicas, embora a cobertura do estado esteja abaixo dos níveis nacionais. Embora a SRTN tenha limitações, como falta de espaço físico e profissionais qualificados, tanto nas áreas técnicas quanto administrativas, é considerada um bom serviço para a sociedade mato-grossense. Um ponto negativo é a falta de apoio governamental nos níveis nacional e estadual. O MS deve organizar reuniões nacionais, nas quais eles possam discutir os “acertos e erros” de cada estado; também há falta de apoio do governo do estado, uma vez que eles não fornecem treinamento regular para o serviço de saúde credenciado em Mato Grosso. Além disso, os problemas enfrentados pelos distritos resultam de uma alta taxa de rotatividade de funcionários, sem fornecer aos novos funcionários informações sobre como a SRTN está organizada e sua importância. Assim, há um aumento de amostras inadequadas e formas incompletas.

Portanto, é necessário criar estratégias para conscientizar todos os envolvidos, oferecendo programas de educação continuada, padronizando procedimentos técnicos e compreendendo os papéis desempenhados por cada um.

AGRADECIMENTOS

À equipe do Serviço de Referência de Triagem Neonatal do Hospital Universitário Júlio Müller/UFMT pelo apoio no desenvolvimento da pesquisa.

REFERÊNCIAS

1. Online Mendelian Inheritance in Man - OMIM [homepage on the Internet]. US: Online Mendelian Inheritance in Man. [cited 2016 Jan 12]. Available from: Available from: http://www.omim.org/entry/612349?search= PHENYLKETONURIA&highlight=phenylketonuria . [ Links ]

2. Ho G, Christodoulou J. Phenylketonuria: translating research into novel therapies. Transl Pediatr. 2014;3:49-62. https://doi.org/10.3978/j.issn.2224-4336.2014.01.01 [ Links ]

3. Moghadam MR, Shojaei A, Babaei V, Rohani F, Ghazi F. Mutation analysis of phenylalanine hydroxylase gene in Iranian patients with phenylketonuria. Med J Islam Repub Iran. 2018;32:21. https://doi.org/10.14196/mjiri.32.21 [ Links ]

4. Esfahani MS, Vallian S. A comprehensive study of phenylalanine hydroxylase gene mutations in the Iranian phenylketonuria patients. Eur J Med Genet. 2019;62:103559. https://doi.org/10.1016/j.ejmg.2018.10.011 [ Links ]

5. Marqui AB. Overview of neonatal screening for phenylketonuria in Brazil. Medicina (Ribeirao Preto Online). 2016;49:517-25. http://dx.doi.org/10.11606/issn.2176-7262.v49i6p517-525 [ Links ]

6. Brazil - Ministério da Saúde. Fenilcetonúria. Protocolo clínico e diretrizes terapêuticas. Brasília: Ministério da Saúde; 2013. [ Links ]

7. Straneiri I, Takano OA. Evaluation of the Neonatal Screening Program for congenital hypothyroidism and phenylketonuria in the State of Mato Grosso, Brazil. Arq Bras Endocrinol Metab. 2009;53:446-52. https://doi.org/10.1590/S0004-27302009000400010 [ Links ]

8. Acosta A, Silva Junior W, Carvalho T, Gomes M, Zago M. Mutations of the phenylalanine hydroxylase (PAH) gene in Brazilian patients with phenylketonuria. Hum Mutat. 2001;17:122-30. https://doi.org/10.1002/1098-1004(200102)17:2%3C122::AID-HUMU4%3E3.0.CO;2-C [ Links ]

9. Boa Sorte TR. Estudo de bases moleculares de fenilcetonúria no nordeste do Brasil [PhD thesis] Salvador (BA): Fundação Oswaldo Cruz, Centro de Pesquisas Gonçalo Moniz; 2010. [ Links ]

10. Santos ES, Rocha MA, Oliveira HM, Costa D, Amorim T, Acosta AX. Genetic and clinical characterization of patients with phenylketonuria in Alagoas state, Brazil. Sci Med. 2012;22:64-70. [ Links ]

11. Silva LC, Carvalho TS, Silva FB, Morari L, Fachel AA, Pires R, et al. Molecular characterization of phenylketonuria in south Brazil. Mol Genet Metab. 2003;79:17-24. [ Links ]

12. Pollice EL. Caracterização molecular da fenilcetonúria em pacientes da região de Campinas [PhD thesis] Campinas (SP): UNICAMP; 2008. [ Links ]

13. Santos LL, Magalhães MC, Reis AO, Starling AL, Januário JN, Fonseca CG, et al. Frequencies of phenylalanine hydroxylase mutations I65T, R252W, R261Q, R261X, IVS10nt-11, V388M, R408W, Y414C, and IVS12nt1 in Minas Gerais, Brazil. Gent Mol Res. 2006;5:16-23. [ Links ]

14. Vieira Neto E, Laranjeira F, Quelhas D, Ribeiro I, Seabra A, Mineiro N, et al. Mutation analysis of the PAH gene in phenylketonuria patients from Rio de Janeiro, Southeast Brazil. Mol Genet Genomic Med. 2018;6:575-91. https://doi.org/10.1002/mgg3.408 [ Links ]

15. Blau N, Sprosen F, Levy HL. Phenylketonuria. Lancet. 2010;376:1417-27. https://doi.org/10.1016/S0140-6736(10)60961-0 [ Links ]

16. Marqui AT. Phenylketonuria: genetic aspects, diagnosis and treatment. Rev Soc Clin Med. 2017;15:282-8. [ Links ]

17. Lahiri DK, Nurnberger JI. A rapid non-enzymatic method for the preparation of HMV DNA from blood ofr RFLP studies. Nucleic Acids Res. 1991;19:5444. https://doi.org/10.1093/nar/19.19.5444 [ Links ]

18. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 1988;239:487-91. https://doi.org/10.1126/science.2448875 [ Links ]

19. Guldberg P, Rey F, Zschocke J, Romano V, François B, Michiels L, et al. A European multicenter study of phenylalanine hydroxylase deficiency: classification of 105 mutations and a general system for genotype-based prediction of metabolic phenotype. Am J Hum Genet. 1998;63:71-9. https://doi.org/10.1086/301920 [ Links ]

20. Desviat LR, Pérez B, Lucca M, Cornejo V, Schmidt B, Ugarte M. Evidence in Latin America of recurrence of V388M, a phenylketonuria mutation with Hugh in vitro residual activity. Am J Hum Genet. 1995;57:337-42. [ Links ]

21. Réblová K, Kulhánek P, Fajkusová L. Computation study of missense mutations in phenylalanine hydroxylase. J Mol Model. 2015;21:70. https://doi.org/10.1007/s00894-015-2620-6 [ Links ]

22. Biglari A, Saffari F, Rashvand Z, Alizadeh S, Najafipour R, Sahmani M. Mutations of the phenylalanine hydroxylase gene in Iranian patients with phenylketonuria. Springerplus. 2015;4:542. https://doi.org/10.1186/s40064-015-1309-8 [ Links ]

23. Hamamy H. Consanguineous marriages. J Community Genet. 2012;3:185-92. https://doi.org/10.1007/s12687-011-0072-y [ Links ]

24. Santos SC, Melo US, Lopes SS, Weller M, Kok F. A endogamia explicaria a elevada prevalência de deficiências em populações do Nordeste brasileiro? Ciênc Saúde Coletiva. 2013;18:1141-50. http://dx.doi.org/10.1590/S1413-81232013000400027 [ Links ]

25. Nussbaum RL, Mcinnes RR, Willard HF. Thompson & Thompson: Genética médica. 7th ed. Rio de Janeiro: Editora Elsevier; 2007. [ Links ]

26. Liu N, Kong XD, Zhao DH, Wu QH, Li XL, Guo HF, et al. Prenatal diagnosis of Chinese families with phenylketonuria. Genet Mol Res. 2015;14:14615-28. https://doi.org/10.4238/2015.November.18.25 [ Links ]

27. Zurflüh MR, Zschocke J, Lindner M, Feillet F, Chery C, Burlina A, et al. Molecular genetics of tetrahydrobiopterin-responsive phenylalanine hydroxilase deficiency. Hum Mutat. 2008;29:167-75. https://doi.org/10.1002/humu.20637 [ Links ]

Financiamento

O estudo não recebeu financiamento.

Recebido: 06 de Novembro de 2018; Aceito: 21 de Abril de 2019; Publicado: 07 de Fevereiro de 2020

*Autor correspondente. E-mail: roselibiologia@yahoo.com.br (R.D. Costa).

Os autores declaram não haver conflito de interesses.

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License