Abstract
OBJECTIVES:
Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro.
METHODS:
We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations.
RESULTS:
No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047). A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009), whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094). In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010). However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories.
CONCLUSION:
The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut-microbiota interactions and in mediating fibrosis. Understanding the effects of several drugs associated with multidrug resistance 1 gene variants may aid in the selection of customized therapeutic regimens.
Multidrug Resistance 1 Gene; Inflammatory Bowel Disease; Crohn's Disease; Brazilian Population; Genotype-Phenotype Associations
INTRODUCTION
Inflammatory bowel diseases (IBDs) comprise Crohn's disease (CD) and ulcerative
colitis (UC) and are characterized by chronic and relapsing intestinal inflammation
due to an inappropriate immune response to the intestinal microbiota in a
genetically predisposed individual (11. Xavier RJ, Podolsky DK. Unravelling the pathogenesis of
inflammatory bowel disease. Nature. 2007;448(7152):427-34,
http://dx.doi.org/10.1038/nature06005.
http://dx.doi.org/10.1038/nature06005...
). The
results obtained from genome-wide association studies have contributed to the
identification of distinct genetic loci implicated in IBD susceptibility, including
pathways involved in pro-inflammatory cell activation (22. Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly MJ,
et al. A genome-wide association study identifies IL23R as an inflammatory bowel
disease gene. Science. 2006;314(5804):1461-3,
http://dx.doi.org/10.1126/science.1135245.
http://dx.doi.org/10.1126/science.113524...
) and autophagy (33. Hampe J, Franke A, Rosenstiel P, Till A, Teuber M, Huse K, et al.
A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility
variant for Crohn disease in ATG16L1. Nat Genet. 2007;39(2):207-11,
http://dx.doi.org/10.1038/ng1954.
http://dx.doi.org/10.1038/ng1954...
).
However, after the discovery of nucleotide-binding oligomerization domain 2/caspase
recruitment domain-containing protein 15 (NOD2/CARD15) as the first
susceptibility gene for CD (44. Hugot JP, Chamaillard M, Zouali H, Lesage S, Cezard JP, Belaiche
J, et al. Association of NOD2 leucine-rich repeat variants with susceptibility
to Crohn's disease. Nature. 2001;411(6837):599-603,
http://dx.doi.org/10.1038/35079107.
http://dx.doi.org/10.1038/35079107...
,55. Ogura Y, Bonen DK, Inohara N, Nicolae DL, Chen FF, Ramos R, et
al. A frameshift mutation in NOD2 associated with susceptibility to Crohn's
disease. Nature. 2001;411(6837):603-6,
http://dx.doi.org/10.1038/35079114.
http://dx.doi.org/10.1038/35079114...
), research on IBD has progressively shifted
toward investigation of the innate immune system and the integrity of the epithelial
barrier.
Among the genes regulating innate immunity is a member of the adenosine
triphosphate-binding cassette superfamily, ABCB1, which is also
known as multidrug resistance 1 (MDR1). MDR1 is
located in an IBD susceptibility locus on chromosome 7q21 (66. Satsangi J, Parkes M, Louis E, Hashimoto L, Kato N, Welsh K, et
al. Two stage genome-wide search in inflammatory bowel disease provides evidence
for susceptibility loci on chromosomes 3, 7 and 12. Nat Genet.
1996;14(2):199-202, http://dx.doi.org/10.1038/ng1096-199.
http://dx.doi.org/10.1038/ng1096-199...
,77. van Heel DA, Fisher SA, Kirby A, Daly MJ, Rioux JD, Lewis CM.
Inflammatory bowel disease susceptibility loci defined by genome scan
meta-analysis of 1952 affected relative pairs. Hum Mol Genet. 2004;13(7):763-70,
http://dx.doi.org/10.1093/hmg/ddh090.
http://dx.doi.org/10.1093/hmg/ddh090...
) and is also
involved in epithelial integrity (88. Van Limbergen J, Russell RK, Nimmo ER, Ho GT, Arnott ID, Wilson
DC, et al. Genetics of the innate immune response in inflammatory bowel disease.
Inflamm Bowel Dis. 2007;13(3):338-55,
http://dx.doi.org/10.1002/ibd.20096.
http://dx.doi.org/10.1002/ibd.20096...
); thus,
this gene has emerged as an interesting candidate for the study of IBD pathogenesis.
Moreover, because the encoded product of the MDR1 gene,
P-glycoprotein 170 (P-gp), is highly expressed on epithelial surfaces such as the
brush borders of enterocytes (99. Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I,
Willingham MC. Cellular localization of the multidrug-resistance gene product
P-glycoprotein in normal human tissues. Proc Natl Acad Sci U S A.
1987;84(21):7735-8, http://dx.doi.org/10.1073/pnas.84.21.7735.
http://dx.doi.org/10.1073/pnas.84.21.773...
), it has been
suggested that this transmembrane efflux pump could participate in the function of
the intestinal barrier, preventing the accumulation of toxins (1010. Marzolini C, Paus E, Buclin T, Kim RB. Polymorphisms in human
MDR1 (P-glycoprotein): recent advances and clinical relevance. Clin Pharmacol
Ther. 2004;75(1):13-33,
http://dx.doi.org/10.1016/j.clpt.2003.09.012.
http://dx.doi.org/10.1016/j.clpt.2003.09...
). In addition, proper P-gp function appears to contribute to
the prevention of colon inflammation because mdr1a-knockout mice develop spontaneous
colitis under specific pathogen-free conditions (1111. Panwala CM, Jones JC, Viney JL. A novel model of inflammatory
bowel disease: mice deficient for the multiple drug resistance gene, mdr1a,
spontaneously develop colitis. J Immunol.
1998;161(10):5733-44.).
Several drugs routinely used in IBD therapy, including corticosteroids (1212. Bourgeois S, Gruol DJ, Newby RF, Rajah FM. Expression of an mdr
gene is associated with a new form of resistance to dexamethasone-induced
apoptosis. Mol Endocrinol. 1993;7(7):840-51.,1313. Ueda K, Okamura N, Hirai M, Tanigawara Y, Saeki T, Kioka N, et
al. Human P-glycoprotein transports cortisol, aldosterone, and dexamethasone,
but not progesterone. J Biol Chem. 1992;267(34):24248-52.)
and immunosuppressants, such as methotrexate (1414. Norris MD, De Graaf D, Haber M, Kavallaris M, Madafiglio J,
Gilbert J, et al. Involvement of MDR1 P-glycoprotein in multifactorial
resistance to methotrexate. Int J Cancer.
1996;65(5):613-9.) and cyclosporin A (1515. Chaudhary PM, Mechetner EB, Roninson IB. Expression and activity
of the multidrug resistance P-glycoprotein in human peripheral blood
lymphocytes. Blood. 1992;80(11):2735-9.), are
also substrates of P-gp. This glycoprotein functions by transporting molecules from
the inner to the outer leaflet of the cell membrane. High expression of the P-gp
protein was demonstrated in the peripheral blood lymphocytes and the enterocytes of
patients with CD and UC who required surgical treatment after the failure of medical
therapy. This result prompted the investigators to hypothesize that the lack of a
response to steroids in IBD could be explained by constitutively high
MDR1 expression (1616. Farrell RJ, Murphy A, Long A, Donnelly S, Cherikuri A,
O'Toole D, et al. High multidrug resistance (P-glycoprotein 170) expression
in inflammatory bowel disease patients who fail medical therapy.
Gastroenterology. 2000;118(2):279-88,
http://dx.doi.org/10.1016/S0016-5085(00)70210-1.
http://dx.doi.org/10.1016/S0016-5085(00)...
). An
increased efflux of steroids, mediated by P-gp, would then result in decreased
concentrations of cytoplasmic steroids in enterocytes, reducing the drugs'
pharmacological effectiveness (1717. Farrell RJ, Kelleher D. Glucocorticoid resistance in
inflammatory bowel disease. J Endocrinol. 2003;178(3):339-46,
http://dx.doi.org/10.1677/joe.0.1780339.
http://dx.doi.org/10.1677/joe.0.1780339...
).
Nevertheless, the biological functions of these gene variants and the question of
whether they can modulate the IBD phenotype are still unclear.
To date, studies on MDR1 gene polymorphisms and their potential association with IBD have provided conflicting results. Furthermore, no studies on MDR1 alleles, MDR1 genotypes and their respective frequencies have been performed in Brazilian patients with IBD. Therefore, in view of the conflicting data and the potential relevance of MDR1 gene polymorphisms to determining specific IBD behaviors, we examined the contributions of the MDR1 polymorphisms C1236T, C3435T and G2677T/A in a southeastern Brazilian population. Additionally, we investigated the relationship between genotype and clinical phenotype in IBD patients from Rio de Janeiro.
MATERIALS AND METHODS
Study population
A total of 206 patients with IBD (comprising 123 patients with CD and 83 patients
with UC) were enrolled in this study from February 2009 to January 2011. The
patients were regularly followed up at the Outpatient Unit for Intestinal
Diseases of the Disciplina de Gastreonterologia e Endoscopia Digestiva of the
Hospital Universitário Pedro Ernesto, Universidade do Estado do Rio de
Janeiro (HUPE/UERJ), and of the Serviço de Gastreonterologia of the
Hospital Universitário Clementino Fraga Filho, Universidade Federal do Rio
de Janeiro (HUCCF/UFRJ). The diagnosis of IBD was based on established
diagnostic criteria, including clinical, imaging, endoscopic and histological
parameters (1818. Van Assche G, Dignass A, Panes J, Beaugerie L, Karagiannis J,
Allez M, et al. The second European evidence-based Consensus on the diagnosis
and management of Crohn's disease: Definitions and diagnosis. J Crohns
Colitis. 2010;4(1):7-27,
http://dx.doi.org/10.1016/j.crohns.2009.12.003.
http://dx.doi.org/10.1016/j.crohns.2009....
). Clinicopathological data
were collected from all patients, including gender, ethnicity, age, age at
diagnosis, disease activity, their history of surgery related to IBD, chronic
steroid use (including steroid-dependent or steroid-refractory disease) and the
presence of side effects of medical treatment. For the patients with CD, the
disease location was characterized as the terminal ileum (L1), colon (L2),
ileocolon (L3) or upper gastrointestinal tract (L4), and the predominant disease
behavior was defined as non-stricturing, non-penetrating (B1); stricturing (B2);
or perforating (B3) according to the Montreal classification (1919. Satsangi J, Silverberg MS, Vermeire S, Colombel JF. The Montreal
classification of inflammatory bowel disease: controversies, consensus, and
implications. Gut. 2006;55(6):749-53,
http://dx.doi.org/10.1136/gut.2005.082909.
http://dx.doi.org/10.1136/gut.2005.08290...
). Perianal disease was considered
separately as an additional feature. CD activity assessment was based on the
Harvey-Bradshaw index (2020. Harvey RF, Bradshaw JM. A simple index of Crohn's-disease
activity. Lancet. 1980;1(8167):514,
http://dx.doi.org/10.1016/S0140-6736(80)92767-1.
http://dx.doi.org/10.1016/S0140-6736(80)...
). For the
patients with UC, disease extension was characterized based on the Montreal
classification, using modified criteria combining ulcerative proctitis and
left-sided UC (E1+E2) and considering extensive UC separately (pancolitis;
E3). Disease activity was also assessed using the Clinical Colitis Activity
Index (2121. Walmsley RS, Ayres RC, Pounder RE, Allan RN. A simple clinical
colitis activity index. Gut. 1998;43(1):29-32,
http://dx.doi.org/10.1136/gut.43.1.29.
http://dx.doi.org/10.1136/gut.43.1.29...
).
DNA extraction and genotyping
Peripheral blood samples were obtained from all of the participants by
venipuncture and collected in EDTA tubes. Genomic DNA was isolated from
peripheral blood leukocytes by proteinase-K/sodium dodecyl sulfate digestion and
phenol-chloroform extraction, as described elsewhere (2222. Miller CA, 3rd, Martinat MA, Hyman LE. Assessment of aryl
hydrocarbon receptor complex interactions using pBEVY plasmids:
expressionvectors with bi-directional promoters for use in Saccharomyces
cerevisiae. Nucleic Acids Res. 1998;26(15):3577-83,
http://dx.doi.org/10.1093/nar/26.15.3577.
http://dx.doi.org/10.1093/nar/26.15.3577...
). The MDR1 polymorphisms most commonly
described in the literature, C1236T, G2677T and C3435T, were detected by
real-time polymerase chain reaction (PCR) followed by direct sequencing.
Specific primers were used for each region of interest (corresponding to exons
12, 21 and 26 of the MDR1 gene). The primers used were as
follows: C1236T sense, 5′ CCTATATCCTGTGTCTGTG 3′; C1236T anti-sense, 5′
CTGTGGGGTCATAGAGCCTC
3′; G2677T sense, 5′ AGCAGGAGTTGTTGAAATGAA 3′; G2677T anti-sense,
5′ AGAGCATAGTAAGCAGTAGG 3′; C3435T sense, 5′
CGAGCACACCTGGGCATC
3′; and C3435T anti-sense, 5′ GAGGCTGCCACATGCTCCCA 3′. The genotype frequencies of
the MDR1 polymorphisms were specifically analyzed in the study
population of CD and UC patients.
Briefly, PCR was performed using the Rotor-Gene Q 2plex HRM (Qiagen, Limburg, Netherlands) with two channels (green and yellow). The reactions were performed in a buffer containing 0.75 mM MgCl2, 0.2 mM dNTPs and 1.0 U of Platinum Taq DNA polymerase (all from Invitrogen, Life Technologies, Carlsbad, CA, USA); 20 pmol of each primer; 200 ng of genomic DNA; and sterile, ultra-pure water, to a final volume of 50 μL. For amplification, the DNA was first denatured for 5 minutes at 94°C, and 35 cycles consisting of three steps were then performed: denaturation for 30 seconds at 92°C, annealing for 30 seconds at 60°C (exons 12 and 21) or 58°C (exon 26) and extension for 1 minute at 72°C. Subsequently, a final cycle of 10 minutes at 72°C was performed. The PCR products were then purified with the Illustra GFX™ PCR DNA and Gel Band Purification Kit according to the manufacturer's protocol (GE Healthcare, Buckinghamshire, UK).
The sequencing reactions were performed using the ET Dye Terminator Cycle Sequencing Kit (GE Healthcare) according to the manufacturer's protocol. The primers used were the same as those employed in the PCR (Table 1). For each product, eight sequencing reactions were performed: four with sense oligonucleotides and four with anti-sense oligonucleotides. The sequencing reactions were then analyzed using the MegaBACE 1000 automatic sequencer (GE Healthcare), and the sequences were analyzed using Chromas software (http://www.technelysium.com.au/chromas.html, accessed on March 19th, 2011) (Figure 1).
Electropherogram 1236. The wild-type sequence agggCc (left) and the polymorphism in which cytosine is exchanged for thymine (agggTc) (right) (A). Electropherogram showing a polymorphism (C1236T) with overlapping cytosine and thymine curves, indicating a heterozygous individual (B).
Statistical analyses
Tests for Hardy-Weinberg equilibrium were performed using Genepop software (Genepop web version 3.1). The 5% significance level for one degree of freedom is 3.84, and because the qui-square value was less than this, the null hypothesis that the population was in Hardy-Weinberg equilibrium was not rejected.
For all other data evaluation, we used SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). The distribution of individual characteristics was evaluated by simple descriptive statistics. Differences among the distributions of selected variables were evaluated using the chi-square test for categorical data. All tests were two-tailed, and p-values of less than 0.05 were considered statistically significant. Genotype-phenotype associations were assessed using odds ratios (ORs) calculated for the minor allele at each single-nucleotide polymorphism (SNP). Multiple logistic regression models were also used to explore the effect of genotype on the phenotypic variables, with phenotype status as the dependent variable.
Ethical considerations
This study was approved by the Ethical Committees of the University Hospital Pedro Ernesto, Universidade do Estado do Rio de Janeiro, and of the University Hospital Clementino Fraga Filho, Universidade Federal do Rio de Janeiro. Informed consent was obtained from all subjects. The study protocol was in accordance with the ethical principles for medical research involving human subjects described in the Declaration of Helsinki.
RESULTS
The CD group consisted of 49 men and 74 women with a mean age of 39.8 years (range: 11-80 years). In total, 51 were classified as white, whereas 72 were classified as non-white. The mean duration of CD was 8.8 years (range: 0.5-41 years). The UC group consisted of 40 men and 43 women with a mean age of 45.6 years (range: 21-73 years). Of these individuals, 31 were classified as white, and 52 were classified as as non-white. The mean duration of UC was 7.5 years (range: 0.2-27 years).
The distributions of the selected MDR1 gene polymorphisms (C1236T, G2677T/A and C3435T) are shown in Table 1 and demonstrate that the respective allele frequencies were in Hardy-Weinberg equilibrium in the study population.
Subsequently, we investigated the distribution of each polymorphic genotype in the CD and UC patient groups (Table 2). The MDR1 G2677T/A and C3435T genotypes were similar between CD and UC patients (p = 0.477 and p = 0.712, respectively). However, the homozygous C1236T genotype was significantly more prevalent among CD patients compared with UC patients (p = 0.047).
The association of the different polymorphic genotypes with the phenotypic characteristics of CD and UC was also investigated. Tables 3, 4 and 5 show the genotype frequencies of the SNPs in different subgroups of patients with CD. A significant positive association was found between the MDR1 homozygous C3435T polymorphism and the stricturing form of CD (p = 0.009). Interestingly, a tendency toward a negative association with the penetrating form of the disease was identified for the same SNP (p = 0.094). Among the 35 patients who had stricturing disease, 11 had the homozygous C3435T polymorphism, whereas among the 44 patients with penetrating disease, only three presented this genotype. Furthermore, the homozygous C3435T polymorphism was associated with chronic steroid use (steroid-dependent/refractory) (p = 0.010) (Table 5). A significant association with disease behavior was also found between the MDR1 heterozygous G2677T/A polymorphism and the non-stricturing, non-penetrating form of CD (p = 0.033; Table 4). In contrast, no significant associations were found between the MDR1 C1236T polymorphism and specific CD subphenotypes (Table 3). Furthermore, no significant association was found between the MDR1 gene polymorphisms and UC subphenotypic categories (Supplementary Tables S1, S2 and S3).
DISCUSSION
In this study, we present information on the genotype frequencies of the MDR1 C1236T, G2677T/A and C3435T polymorphisms in patients with CD or UC as well as potential determination of the phenotypic features of IBD, in a southeastern Brazilian population from Rio de Janeiro. In particular, we found that the C1236T polymorphism was significantly more common in CD patients than in UC patients. Regarding CD phenotypes, a significant association was detected between the MDR1 C3435T polymorphism and the stricturing form of the disease. In addition, a positive association between the C3435T polymorphism and the chronic use of steroids was identified in CD patients. We also found positive and negative trends regarding specific phenotypes and both heterozygous and homozygous polymorphisms, suggesting that MDR1 gene variants may determine both susceptibility to and protection against CD.
Various MDR1 gene polymorphisms have been reported thus far, and the
C3435T polymorphism has been the most well studied in IBD. Similar to the results of
the current study, associations between MDR1 gene polymorphisms
have been reported in refractory CD and, to a lesser extent, in UC in a Slovenian
population (2323. Potocnik U, Ferkolj I, Glavac D, Dean M. Polymorphisms in
multidrug resistance 1 (MDR1) gene are associated with refractory Crohn disease
and ulcerative colitis. Genes Immun. 2004;5(7):530-9,
http://dx.doi.org/10.1038/sj.gene.6364123.
http://dx.doi.org/10.1038/sj.gene.636412...
). In another study performed
in a large cohort in the United States, investigators observed a significant
association between CD and a missense polymorphism in exon 21 (G2677T/C;
Ala893Ser/Thr), which was thought to be related to altered transporter and/or gene
expression activity (2424. Brant SR, Panhuysen CI, Nicolae D, Reddy DM, Bonen DK,
Karaliukas R, et al. MDR1 Ala893 polymorphism is associated with inflammatory
bowel disease. Am J Hum Genet. 2003;73(6):1282-92.). In a case-control
study in Spain, a significant association between the MDR1 C3435T
polymorphism and CD was characterized, in addition to the identification of the CD
susceptibility haplotype 2677T/C3435 (2525. Urcelay E, Mendoza JL, Martin MC, Mas A, Martinez A, Taxonera C,
et al. MDR1 gene: susceptibility in Spanish Crohn's disease and ulcerative
colitis patients. Inflamm Bowel Dis. 2006;12(1):33-7,
http://dx.doi.org/10.1097/01.MIB.0000194184.92671.78.
http://dx.doi.org/10.1097/01.MIB.0000194...
).
Moreover, in an Italian study, investigators found a significant association between
the C3435T SNP and the ileocolonic localization of CD, whereas the same polymorphism
appeared to be negatively associated with a positive family history and arthritis in
CD patients (2626. Ardizzone S, Maconi G, Bianchi V, Russo A, Colombo E, Cassinotti
A, et al. Multidrug resistance 1 gene polymorphism and susceptibility to
inflammatory bowel disease. Inflamm Bowel Dis. 2007;13(5):516-23,
http://dx.doi.org/10.1002/ibd.20108.
http://dx.doi.org/10.1002/ibd.20108...
). In a large case-control
cohort study in the United Kingdom, investigators associated the
MDR1 SNPs C3435T and G2677T/A with an increased risk of
developing UC, including an influence on disease behavior (2727. Onnie CM, Fisher SA, Pattni R, Sanderson J, Forbes A, Lewis CM,
et al. Associations of allelic variants of the multidrug resistance gene (ABCB1
or MDR1) and inflammatory bowel disease and their effects on disease behavior: a
case-control and meta-analysis study. Inflamm Bowel Dis. 2006;12(4):263-71,
http://dx.doi.org/10.1097/01.MIB.0000209791.98866.ba.
http://dx.doi.org/10.1097/01.MIB.0000209...
). In addition, in contrast to the results of the current
study, case-control studies in European cohorts of patients from Germany (2828. Schwab M, Schaeffeler E, Marx C, Fromm MF, Kaskas B, Metzler J,
et al. Association between the C3435T MDR1 gene polymorphism and susceptibility
for ulcerative colitis. Gastroenterology. 2003;124(1):26-33,
http://dx.doi.org/10.1053/gast.2003.50010.
http://dx.doi.org/10.1053/gast.2003.5001...
) and Scotland (2929. Ho GT, Nimmo ER, Tenesa A, Fennell J, Drummond H, Mowat C, et
al. Allelic variations of the multidrug resistance gene determine susceptibility
and disease behavior in ulcerative colitis. Gastroenterology.
2005;128(2):288-96,
http://dx.doi.org/10.1053/j.gastro.2004.11.019.
http://dx.doi.org/10.1053/j.gastro.2004....
) also suggested a potential association between the
MDR1 SNP C3435T and UC. Nevertheless, in another Italian study,
the investigated polymorphisms in the MDR1 gene had no significant
role in disease susceptibility or the response to medical therapy in IBD (3030. Palmieri O, Latiano A, Valvano R, D'Inca R, Vecchi M,
Sturniolo GC, et al. Multidrug resistance 1 gene polymorphisms are not
associated with inflammatory bowel disease and response to therapy in Italian
patients. Aliment Pharmacol Ther. 2005;22(11-12):1129-38,
http://dx.doi.org/10.1111/j.1365-2036.2005.02701.x.
http://dx.doi.org/10.1111/j.1365-2036.20...
).
The discrepancies among these studies may be attributed to not only different study
designs, sample sizes and selection of controls but also the distinct patient
populations. In fact, meta-analyses have been performed to attempt to overcome the
heterogeneity of studies involving MDR1 SNPs. Of note, certain
studies have revealed that the allele frequencies of the three main variants differ
considerably among distinct populations. A significant association of the 3435T
allele with UC was confirmed in a meta-analysis (2727. Onnie CM, Fisher SA, Pattni R, Sanderson J, Forbes A, Lewis CM,
et al. Associations of allelic variants of the multidrug resistance gene (ABCB1
or MDR1) and inflammatory bowel disease and their effects on disease behavior: a
case-control and meta-analysis study. Inflamm Bowel Dis. 2006;12(4):263-71,
http://dx.doi.org/10.1097/01.MIB.0000209791.98866.ba.
http://dx.doi.org/10.1097/01.MIB.0000209...
), and in another study, the 3435T allele and the 3435TT genotype were
demonstrated to be significantly associated with UC, but not with CD (3131. Annese V, Valvano MR, Palmieri O, Latiano A, Bossa F, Andriulli
A. Multidrug resistance 1 gene in inflammatory bowel disease: a meta-analysis.
World J Gastroenterol. 2006;12(23):3636-44.). Differences in the C3435T SNP allele
frequency have also been detected, with an increased frequency of the C allele (wild
type) in African populations compared with Caucasian and Asian populations (3232. Schaeffeler E, Eichelbaum M, Brinkmann U, Penger A, Asante-Poku
S, Zanger UM, et al. Frequency of C3435T polymorphism of MDR1 gene in African
people. Lancet. 2001;358(9279):383-4,
http://dx.doi.org/10.1016/S0140-6736(01)05579-9.
http://dx.doi.org/10.1016/S0140-6736(01)...
). In an Asiatic study, investigators found
distinct haplotype profiles and linkage disequilibrium at the MDR1
gene locus in all three ethnic groups enrolled in the study (3333. Tang K, Ngoi SM, Gwee PC, Chua JM, Lee EJ, Chong SS, et al.
Distinct haplotype profiles and strong linkage disequilibrium at the MDR1
multidrug transporter gene locus in three ethnic Asian populations.
Pharmacogenetics. 2002;12(6):437-50,
http://dx.doi.org/10.1097/00008571-200208000-00004.
http://dx.doi.org/10.1097/00008571-20020...
). In a recent study that was also performed in Rio de
Janeiro, Brazil, matching the recruitment area and ethnicity of our IBD patients,
278 healthy individuals were analyzed regarding the genotype and allele frequencies
of MDR1 gene polymorphisms. The investigators found a peculiar
variant distribution, with significant differences between C1236C and C3435T and
also between C1236C and C3435C, which differed from the results obtained for several
other ethnic groups (3434. Scheiner MA, Damasceno AM, Maia RC. ABCB1 single nucleotide
polymorphisms in the Brazilian population. Mol Biol Rep.
2009;37(1):111-8.). In this context, it
must be emphasized that data from potential source populations, such as Europeans or
Africans, cannot be deemed representative of the Brazilian genotype and allele
frequencies due to the marked heterogeneity and the extensive admixture of the
Brazilian population (3535. Alves-Silva J, da Silva Santos M, Guimaraes PE, Ferreira AC,
Bandelt HJ, Pena SD, et al. The ancestry of Brazilian mtDNA lineages.
Am J Hum Genet. 2000;67(2):444-61.,3636. Parra FC, Amado RC, Lambertucci JR, Rocha J, Antunes CM, Pena
SD. Color and genomic ancestry in Brazilians. Proc Natl Acad
Sci U S A. 2003;100(1):177-82,
http://dx.doi.org/10.1073/pnas.0126614100.
http://dx.doi.org/10.1073/pnas.012661410...
). Taken together with the results of our
study, these observations highlight the critical importance of analyzing
MDR1 gene polymorphisms in Brazilians, and particularly in
Brazilian IBD patients.
Potential genotype-phenotype associations related to the MDR1 gene
have been investigated, with contradictory results. In the present study, we report
positive associations between the C3435T polymorphism and both the chronic use of
steroids and disease activity in CD patients. Similar to our results, an association
between MDR1 variants and corticosteroid dependence was also
reported in children with CD in Canadian tertiary centers (3737. Krupoves A, Mack D, Seidman E, Deslandres C, Amre D.
Associations between variants in the ABCB1 (MDR1) gene and corticosteroid
dependence in children with Crohn's disease. Inflamm Bowel Dis.
2011;17(11):2308-17, http://dx.doi.org/10.1002/ibd.21608.
http://dx.doi.org/10.1002/ibd.21608...
). In a British study on IBD, the 2677T allele was increased
in UC cases, and the TT genotype was strongly associated with disease severity and
the use of steroids in UC (2727. Onnie CM, Fisher SA, Pattni R, Sanderson J, Forbes A, Lewis CM,
et al. Associations of allelic variants of the multidrug resistance gene (ABCB1
or MDR1) and inflammatory bowel disease and their effects on disease behavior: a
case-control and meta-analysis study. Inflamm Bowel Dis. 2006;12(4):263-71,
http://dx.doi.org/10.1097/01.MIB.0000209791.98866.ba.
http://dx.doi.org/10.1097/01.MIB.0000209...
). In contrast,
in a large cohort of IBD patients using steroids, both the C3435T and the G2677T/A
polymorphisms were evaluated, but no significant differences were found within
subgroups or among subgroups. Additionally, MDR1 genotypes were not
found to influence the response to therapy (3030. Palmieri O, Latiano A, Valvano R, D'Inca R, Vecchi M,
Sturniolo GC, et al. Multidrug resistance 1 gene polymorphisms are not
associated with inflammatory bowel disease and response to therapy in Italian
patients. Aliment Pharmacol Ther. 2005;22(11-12):1129-38,
http://dx.doi.org/10.1111/j.1365-2036.2005.02701.x.
http://dx.doi.org/10.1111/j.1365-2036.20...
). In another study, the expression and function of
MDR1 in intraepithelial, lamina propria and peripheral blood
lymphocytes were decreased in UC patients compared with CD patients and healthy
controls (3838. Yacyshyn B, Maksymowych W, Bowen-Yacyshyn MB. Differences in
P-glycoprotein-170 expression and activity between Crohn's disease and
ulcerative colitis. Hum Immunol. 1999;60(8):677-87,
http://dx.doi.org/10.1016/S0198-8859(99)00036-1.
http://dx.doi.org/10.1016/S0198-8859(99)...
). In accordance with this
finding, the tissue expression of a number of detoxification genes and ABC
transporters, including MDR1, was shown to be markedly
downregulated in UC patients, supporting the notion that a defective mucosal
detoxification system could predispose a patient to intestinal inflammation (3939. Langmann T, Moehle C, Mauerer R, Scharl M, Liebisch G, Zahn A,
et al. Loss of detoxification in inflammatory bowel disease: dysregulation of
pregnane X receptor target genes. Gastroenterology. 2004;127(1):26-40,
http://dx.doi.org/10.1053/j.gastro.2004.04.019.
http://dx.doi.org/10.1053/j.gastro.2004....
). Indeed, the effects of corticosteroids and
other medications used in IBD on MDR1 expression have not been
fully established, and the question of whether the difference in P-gp expression
reflects a primary defect or occurs secondary to therapy, influencing the response
to treatment, remains to be clarified.
The stricturing form of CD, also known as the fibrostenotic form of CD, has been
previously associated with NOD2 variants and small bowel
involvement in patients with CD (4040. Abreu MT, Taylor KD, Lin YC, Hang T, Gaiennie J, Landers CJ, et
al. Mutations in NOD2 are associated with fibrostenosing disease in patients
with Crohn's disease. Gastroenterology. 2002;123(3):679-88,
http://dx.doi.org/10.1053/gast.2002.35393.
http://dx.doi.org/10.1053/gast.2002.3539...
).
However, another study demonstrated that the fibrostenotic phenotype of CD was
significantly associated with NOD2 gene variants and also with a
high titer of antibodies against oligomannan, OmpC, I2 and Cbir, regardless of
disease location (4141. Ippoliti A, Devlin S, Mei L, Yang H, Papadakis KA, Vasiliauskas
EA, et al. Combination of innate and adaptive immune alterations increased the
likelihood of fibrostenosis in Crohn's disease. Inflamm Bowel Dis.
2010;16(8):1279-85, http://dx.doi.org/10.1002/ibd.21196.
http://dx.doi.org/10.1002/ibd.21196...
). These results support
the notion that altered innate immunity may synergize with a loss of tolerance to
microbial antigens and with the adaptive immune response, thus favoring a specific
CD phenotype. In contrast to studies reported thus far on MDR1 gene
polymorphisms in IBD, another novel genotype-phenotype association found in our
study was the significant positive association between the C3435T SNP and the
stricturing form of CD. Although the mechanism by which an MDR1 SNP
can determine a specific phenotype has yet to be determined, certain evidence
indicates that MDR1 participates in a complex biological network
with multiple physiologically relevant mediators and pathways, including
pro-inflammatory cytokines (4242. Evseenko DA, Paxton JW, Keelan JA. Independent regulation of
apical and basolateral drug transporter expression and function in placental
trophoblasts by cytokines, steroids, and growth factors. Drug Metab Dispos.
2007;35(4):595-601, http://dx.doi.org/10.1124/dmd.106.011478.
http://dx.doi.org/10.1124/dmd.106.011478...
),
endotoxin-induced inflammation (4343. Tomita M, Takizawa Y, Kanbayashi A, Murata H, Tanaka A, Nakaike
M, et al. Suppression of efflux transporters in the intestines of
endotoxin-treated rats. Int J Pharm.
2012;428(1-2):33-8.),
transcription factors such as NF-kB (4444. Kuo MT, Liu Z, Wei Y, Lin-Lee YC, Tatebe S, Mills GB, et al.
Induction of human MDR1 gene expression by 2-acetylaminofluorene is mediated by
effectors of the phosphoinositide 3-kinase pathway that activate NF-kappaB
signaling. Oncogene. 2002;21(13):1945-54,
http://dx.doi.org/10.1038/sj.onc.1205117.
http://dx.doi.org/10.1038/sj.onc.1205117...
,4545. Inoue S, Nakase H, Matsuura M, Mikami S, Ueno S, Uza N, et al.
The effect of proteasome inhibitor MG132 on experimental inflammatory bowel
disease. Clin Exp Immunol. 2009;156(1):172-82,
http://dx.doi.org/10.1111/j.1365-2249.2008.03872.x.
http://dx.doi.org/10.1111/j.1365-2249.20...
) and cyclooxygenases (4646. Zrieki A, Farinotti R, Buyse M. Cyclooxygenase-2 inhibitors
prevent trinitrobenzene sulfonic acid-induced P-glycoprotein up-regulation in
vitro and in vivo. Eur J Pharmacol.
2010;636(1-3):189-97.), which can modulate MDR1 expression and
activity at different levels. Hence, these intricate mechanisms reinforce a key role
for P-gp in drug bioavailability and epithelial homeostasis in the context of
inflammation and infection. However, the contribution of the MDR1
gene to the response to medications and possibly to IBD susceptibility or
phenotypes, including the stricturing form of CD, needs further clarification.
In conclusion, the results of this study indicate that the rare homozygous MDR1 gene polymorphism C3435T is associated not only with the stricturing phenotype but also with an inappropriate response to therapy in a population of CD patients from Rio de Janeiro. The relationship with the CD phenotype supports the existence of additional roles for MDR1 in specific mechanisms underlying CD pathogenesis, such as the control of gut-microbiota interactions and the regulation of fibrosis. Furthermore, understanding the effects of several drugs associated with these MDR1 variants may aid in the selection of customized therapeutic regimens.
Acknowledgments
The authors wish to thank the Brazilian research foundations CNPq and FAPERJ for their financial support. All authors approved the final version of this article.
REFERENCES
-
1Xavier RJ, Podolsky DK. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 2007;448(7152):427-34, http://dx.doi.org/10.1038/nature06005.
» http://dx.doi.org/10.1038/nature06005 -
2Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly MJ, et al. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science. 2006;314(5804):1461-3, http://dx.doi.org/10.1126/science.1135245.
» http://dx.doi.org/10.1126/science.1135245 -
3Hampe J, Franke A, Rosenstiel P, Till A, Teuber M, Huse K, et al. A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat Genet. 2007;39(2):207-11, http://dx.doi.org/10.1038/ng1954.
» http://dx.doi.org/10.1038/ng1954 -
4Hugot JP, Chamaillard M, Zouali H, Lesage S, Cezard JP, Belaiche J, et al. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease. Nature. 2001;411(6837):599-603, http://dx.doi.org/10.1038/35079107.
» http://dx.doi.org/10.1038/35079107 -
5Ogura Y, Bonen DK, Inohara N, Nicolae DL, Chen FF, Ramos R, et al. A frameshift mutation in NOD2 associated with susceptibility to Crohn's disease. Nature. 2001;411(6837):603-6, http://dx.doi.org/10.1038/35079114.
» http://dx.doi.org/10.1038/35079114 -
6Satsangi J, Parkes M, Louis E, Hashimoto L, Kato N, Welsh K, et al. Two stage genome-wide search in inflammatory bowel disease provides evidence for susceptibility loci on chromosomes 3, 7 and 12. Nat Genet. 1996;14(2):199-202, http://dx.doi.org/10.1038/ng1096-199.
» http://dx.doi.org/10.1038/ng1096-199 -
7van Heel DA, Fisher SA, Kirby A, Daly MJ, Rioux JD, Lewis CM. Inflammatory bowel disease susceptibility loci defined by genome scan meta-analysis of 1952 affected relative pairs. Hum Mol Genet. 2004;13(7):763-70, http://dx.doi.org/10.1093/hmg/ddh090.
» http://dx.doi.org/10.1093/hmg/ddh090 -
8Van Limbergen J, Russell RK, Nimmo ER, Ho GT, Arnott ID, Wilson DC, et al. Genetics of the innate immune response in inflammatory bowel disease. Inflamm Bowel Dis. 2007;13(3):338-55, http://dx.doi.org/10.1002/ibd.20096.
» http://dx.doi.org/10.1002/ibd.20096 -
9Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I, Willingham MC. Cellular localization of the multidrug-resistance gene product P-glycoprotein in normal human tissues. Proc Natl Acad Sci U S A. 1987;84(21):7735-8, http://dx.doi.org/10.1073/pnas.84.21.7735.
» http://dx.doi.org/10.1073/pnas.84.21.7735 -
10Marzolini C, Paus E, Buclin T, Kim RB. Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance. Clin Pharmacol Ther. 2004;75(1):13-33, http://dx.doi.org/10.1016/j.clpt.2003.09.012.
» http://dx.doi.org/10.1016/j.clpt.2003.09.012 -
11Panwala CM, Jones JC, Viney JL. A novel model of inflammatory bowel disease: mice deficient for the multiple drug resistance gene, mdr1a, spontaneously develop colitis. J Immunol. 1998;161(10):5733-44.
-
12Bourgeois S, Gruol DJ, Newby RF, Rajah FM. Expression of an mdr gene is associated with a new form of resistance to dexamethasone-induced apoptosis. Mol Endocrinol. 1993;7(7):840-51.
-
13Ueda K, Okamura N, Hirai M, Tanigawara Y, Saeki T, Kioka N, et al. Human P-glycoprotein transports cortisol, aldosterone, and dexamethasone, but not progesterone. J Biol Chem. 1992;267(34):24248-52.
-
14Norris MD, De Graaf D, Haber M, Kavallaris M, Madafiglio J, Gilbert J, et al. Involvement of MDR1 P-glycoprotein in multifactorial resistance to methotrexate. Int J Cancer. 1996;65(5):613-9.
-
15Chaudhary PM, Mechetner EB, Roninson IB. Expression and activity of the multidrug resistance P-glycoprotein in human peripheral blood lymphocytes. Blood. 1992;80(11):2735-9.
-
16Farrell RJ, Murphy A, Long A, Donnelly S, Cherikuri A, O'Toole D, et al. High multidrug resistance (P-glycoprotein 170) expression in inflammatory bowel disease patients who fail medical therapy. Gastroenterology. 2000;118(2):279-88, http://dx.doi.org/10.1016/S0016-5085(00)70210-1.
» http://dx.doi.org/10.1016/S0016-5085(00)70210-1 -
17Farrell RJ, Kelleher D. Glucocorticoid resistance in inflammatory bowel disease. J Endocrinol. 2003;178(3):339-46, http://dx.doi.org/10.1677/joe.0.1780339.
» http://dx.doi.org/10.1677/joe.0.1780339 -
18Van Assche G, Dignass A, Panes J, Beaugerie L, Karagiannis J, Allez M, et al. The second European evidence-based Consensus on the diagnosis and management of Crohn's disease: Definitions and diagnosis. J Crohns Colitis. 2010;4(1):7-27, http://dx.doi.org/10.1016/j.crohns.2009.12.003.
» http://dx.doi.org/10.1016/j.crohns.2009.12.003 -
19Satsangi J, Silverberg MS, Vermeire S, Colombel JF. The Montreal classification of inflammatory bowel disease: controversies, consensus, and implications. Gut. 2006;55(6):749-53, http://dx.doi.org/10.1136/gut.2005.082909.
» http://dx.doi.org/10.1136/gut.2005.082909 -
20Harvey RF, Bradshaw JM. A simple index of Crohn's-disease activity. Lancet. 1980;1(8167):514, http://dx.doi.org/10.1016/S0140-6736(80)92767-1.
» http://dx.doi.org/10.1016/S0140-6736(80)92767-1 -
21Walmsley RS, Ayres RC, Pounder RE, Allan RN. A simple clinical colitis activity index. Gut. 1998;43(1):29-32, http://dx.doi.org/10.1136/gut.43.1.29.
» http://dx.doi.org/10.1136/gut.43.1.29 -
22Miller CA, 3rd, Martinat MA, Hyman LE. Assessment of aryl hydrocarbon receptor complex interactions using pBEVY plasmids: expressionvectors with bi-directional promoters for use in Saccharomyces cerevisiae. Nucleic Acids Res. 1998;26(15):3577-83, http://dx.doi.org/10.1093/nar/26.15.3577.
» http://dx.doi.org/10.1093/nar/26.15.3577 -
23Potocnik U, Ferkolj I, Glavac D, Dean M. Polymorphisms in multidrug resistance 1 (MDR1) gene are associated with refractory Crohn disease and ulcerative colitis. Genes Immun. 2004;5(7):530-9, http://dx.doi.org/10.1038/sj.gene.6364123.
» http://dx.doi.org/10.1038/sj.gene.6364123 -
24Brant SR, Panhuysen CI, Nicolae D, Reddy DM, Bonen DK, Karaliukas R, et al. MDR1 Ala893 polymorphism is associated with inflammatory bowel disease. Am J Hum Genet. 2003;73(6):1282-92.
-
25Urcelay E, Mendoza JL, Martin MC, Mas A, Martinez A, Taxonera C, et al. MDR1 gene: susceptibility in Spanish Crohn's disease and ulcerative colitis patients. Inflamm Bowel Dis. 2006;12(1):33-7, http://dx.doi.org/10.1097/01.MIB.0000194184.92671.78.
» http://dx.doi.org/10.1097/01.MIB.0000194184.92671.78 -
26Ardizzone S, Maconi G, Bianchi V, Russo A, Colombo E, Cassinotti A, et al. Multidrug resistance 1 gene polymorphism and susceptibility to inflammatory bowel disease. Inflamm Bowel Dis. 2007;13(5):516-23, http://dx.doi.org/10.1002/ibd.20108.
» http://dx.doi.org/10.1002/ibd.20108 -
27Onnie CM, Fisher SA, Pattni R, Sanderson J, Forbes A, Lewis CM, et al. Associations of allelic variants of the multidrug resistance gene (ABCB1 or MDR1) and inflammatory bowel disease and their effects on disease behavior: a case-control and meta-analysis study. Inflamm Bowel Dis. 2006;12(4):263-71, http://dx.doi.org/10.1097/01.MIB.0000209791.98866.ba.
» http://dx.doi.org/10.1097/01.MIB.0000209791.98866.ba -
28Schwab M, Schaeffeler E, Marx C, Fromm MF, Kaskas B, Metzler J, et al. Association between the C3435T MDR1 gene polymorphism and susceptibility for ulcerative colitis. Gastroenterology. 2003;124(1):26-33, http://dx.doi.org/10.1053/gast.2003.50010.
» http://dx.doi.org/10.1053/gast.2003.50010 -
29Ho GT, Nimmo ER, Tenesa A, Fennell J, Drummond H, Mowat C, et al. Allelic variations of the multidrug resistance gene determine susceptibility and disease behavior in ulcerative colitis. Gastroenterology. 2005;128(2):288-96, http://dx.doi.org/10.1053/j.gastro.2004.11.019.
» http://dx.doi.org/10.1053/j.gastro.2004.11.019 -
30Palmieri O, Latiano A, Valvano R, D'Inca R, Vecchi M, Sturniolo GC, et al. Multidrug resistance 1 gene polymorphisms are not associated with inflammatory bowel disease and response to therapy in Italian patients. Aliment Pharmacol Ther. 2005;22(11-12):1129-38, http://dx.doi.org/10.1111/j.1365-2036.2005.02701.x.
» http://dx.doi.org/10.1111/j.1365-2036.2005.02701.x -
31Annese V, Valvano MR, Palmieri O, Latiano A, Bossa F, Andriulli A. Multidrug resistance 1 gene in inflammatory bowel disease: a meta-analysis. World J Gastroenterol. 2006;12(23):3636-44.
-
32Schaeffeler E, Eichelbaum M, Brinkmann U, Penger A, Asante-Poku S, Zanger UM, et al. Frequency of C3435T polymorphism of MDR1 gene in African people. Lancet. 2001;358(9279):383-4, http://dx.doi.org/10.1016/S0140-6736(01)05579-9.
» http://dx.doi.org/10.1016/S0140-6736(01)05579-9 -
33Tang K, Ngoi SM, Gwee PC, Chua JM, Lee EJ, Chong SS, et al. Distinct haplotype profiles and strong linkage disequilibrium at the MDR1 multidrug transporter gene locus in three ethnic Asian populations. Pharmacogenetics. 2002;12(6):437-50, http://dx.doi.org/10.1097/00008571-200208000-00004.
» http://dx.doi.org/10.1097/00008571-200208000-00004 -
34Scheiner MA, Damasceno AM, Maia RC. ABCB1 single nucleotide polymorphisms in the Brazilian population. Mol Biol Rep. 2009;37(1):111-8.
-
35Alves-Silva J, da Silva Santos M, Guimaraes PE, Ferreira AC, Bandelt HJ, Pena SD, et al. The ancestry of Brazilian mtDNA lineages. Am J Hum Genet. 2000;67(2):444-61.
-
36Parra FC, Amado RC, Lambertucci JR, Rocha J, Antunes CM, Pena SD. Color and genomic ancestry in Brazilians. Proc Natl Acad Sci U S A. 2003;100(1):177-82, http://dx.doi.org/10.1073/pnas.0126614100.
» http://dx.doi.org/10.1073/pnas.0126614100 -
37Krupoves A, Mack D, Seidman E, Deslandres C, Amre D. Associations between variants in the ABCB1 (MDR1) gene and corticosteroid dependence in children with Crohn's disease. Inflamm Bowel Dis. 2011;17(11):2308-17, http://dx.doi.org/10.1002/ibd.21608.
» http://dx.doi.org/10.1002/ibd.21608 -
38Yacyshyn B, Maksymowych W, Bowen-Yacyshyn MB. Differences in P-glycoprotein-170 expression and activity between Crohn's disease and ulcerative colitis. Hum Immunol. 1999;60(8):677-87, http://dx.doi.org/10.1016/S0198-8859(99)00036-1.
» http://dx.doi.org/10.1016/S0198-8859(99)00036-1 -
39Langmann T, Moehle C, Mauerer R, Scharl M, Liebisch G, Zahn A, et al. Loss of detoxification in inflammatory bowel disease: dysregulation of pregnane X receptor target genes. Gastroenterology. 2004;127(1):26-40, http://dx.doi.org/10.1053/j.gastro.2004.04.019.
» http://dx.doi.org/10.1053/j.gastro.2004.04.019 -
40Abreu MT, Taylor KD, Lin YC, Hang T, Gaiennie J, Landers CJ, et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 2002;123(3):679-88, http://dx.doi.org/10.1053/gast.2002.35393.
» http://dx.doi.org/10.1053/gast.2002.35393 -
41Ippoliti A, Devlin S, Mei L, Yang H, Papadakis KA, Vasiliauskas EA, et al. Combination of innate and adaptive immune alterations increased the likelihood of fibrostenosis in Crohn's disease. Inflamm Bowel Dis. 2010;16(8):1279-85, http://dx.doi.org/10.1002/ibd.21196.
» http://dx.doi.org/10.1002/ibd.21196 -
42Evseenko DA, Paxton JW, Keelan JA. Independent regulation of apical and basolateral drug transporter expression and function in placental trophoblasts by cytokines, steroids, and growth factors. Drug Metab Dispos. 2007;35(4):595-601, http://dx.doi.org/10.1124/dmd.106.011478.
» http://dx.doi.org/10.1124/dmd.106.011478 -
43Tomita M, Takizawa Y, Kanbayashi A, Murata H, Tanaka A, Nakaike M, et al. Suppression of efflux transporters in the intestines of endotoxin-treated rats. Int J Pharm. 2012;428(1-2):33-8.
-
44Kuo MT, Liu Z, Wei Y, Lin-Lee YC, Tatebe S, Mills GB, et al. Induction of human MDR1 gene expression by 2-acetylaminofluorene is mediated by effectors of the phosphoinositide 3-kinase pathway that activate NF-kappaB signaling. Oncogene. 2002;21(13):1945-54, http://dx.doi.org/10.1038/sj.onc.1205117.
» http://dx.doi.org/10.1038/sj.onc.1205117 -
45Inoue S, Nakase H, Matsuura M, Mikami S, Ueno S, Uza N, et al. The effect of proteasome inhibitor MG132 on experimental inflammatory bowel disease. Clin Exp Immunol. 2009;156(1):172-82, http://dx.doi.org/10.1111/j.1365-2249.2008.03872.x.
» http://dx.doi.org/10.1111/j.1365-2249.2008.03872.x -
46Zrieki A, Farinotti R, Buyse M. Cyclooxygenase-2 inhibitors prevent trinitrobenzene sulfonic acid-induced P-glycoprotein up-regulation in vitro and in vivo. Eur J Pharmacol. 2010;636(1-3):189-97.
-
No potential conflict of interest was reported.
Publication Dates
-
Publication in this collection
2014
History
-
Received
3 Sept 2013 -
Reviewed
19 Sept 2013 -
Accepted
19 Sept 2013