Characterization of trehalose-6-phosphate synthase and Na⁺/H⁺ antiporter genes in Vuralia turcica and expression analysis under salt and cadmium stresses

Abstract

Vuralia turcica (Fabaceae; Papilionoideae) is a critically endangered endemic plant species in Turkey. This plant grows naturally in saline environments, although the photosynthesis and physiological functions of many plants are affected by salt stress. Molecular control mechanisms and identification of genes involved in these mechanisms constitute the critical field of study in plant science. Trehalose-6-phosphate synthase (TPS) is one of the essential enzyme genes involved in trehalose biosynthesis, which is protective against salt stress. Also, the vacuolar Na⁺/H⁺ antiporter gene (NHX) is known to be useful in salt tolerance. In this study, the TPS and NHX–like genes in V. turcica were partially sequenced using degenerate primers for the first time and submitted to the NCBI database (accession numbers MK120983 and MH757417, respectively). Also, the expression levels of the genes encoding TPS and NHX were investigated. The results indicate that the increase in both the level of applied salt and cadmium is coupled with the increase in the expression level of NHX and TPS genes. However, salt exposure significantly affected the expression level of the NHX gene. The findings suggest that the NHX gene might play a crucial role in the salt tolerance ability of V. turcica.

Key words
Gene profiling; NHX; salt tolerance; TPS

INTRODUCTION

Salt stress is an often encountered problem in agriculture that decreases yield by enabling healthy plant growth (Zhu 2001). Trehalose-6-phosphate synthase (TPS) and vacuolar Na⁺/H⁺ antiporter (NHX) genes are known to be useful against abiotic stress conditions such as salinity and drought.

Trehalose (α-d-glucopyranosyl-1,1-α-d-glucopyranoside) is one of the significant carbohydrate stores in not only plants also in a large variety of microorganisms such as yeast and animals. Various organisms, such as bacteria, fungi, plants, insects, and invertebrates, contain genes that enable them to produce trehalose endogenously (Elbein et al. 2003). Trehalose is a non-reducible disaccharide composed of two glucose units and provides rapid adaptations to an organism under various environmental conditions, and has a significant role in glucose uptake. It also functions as an osmoprotectant (Elbein 1974, Crowe et al. 1984). Trehalose is catalyzed by two enzymes: trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). Currently, there has been a great interest in trehalose metabolism to improve stress-tolerant plants. TPS gene was successfully transferred to tomato, potato, and tobacco plants to obtain stress-tolerant species, especially against drought (Jang et al. 2003, Avonce et al. 2004, Zhang et al. 2005, Kissoudis et al. 2015). Also, there have been several studies conducted on the function of the TPS gene under salt and drought conditions and reported that overexpression of TPS was beneficial on the resistance mechanism (Kwon et al. 2004, Wu et al. 2006).

Sodium ions can cause salt stress in plants. Plants remove excess Na⁺ ions by exclusion or compartmentation in saline soils. Na⁺/H⁺ antiporters, membrane proteins, play an essential role in Na⁺ homeostasis and pH regulation in plant species. Na⁺/H⁺ antiporter genes are also found in animals, yeast, and bacteria (Shi & Zhu 2002, Fukuda et al. 2004). It is known that NHX is responsible for cadmium stress from previous studies (Cong et al. 2013). Cadmium is a non-essential heavy metal and toxic for plants, animals, and also humans due to causing many adverse effects such as oxidative stress and disturbance in metabolism (Adabnejad et al. 2015).

Although the molecular identification and the expression pattern of TPS and NHX genes are very important in terms of salt stress mechanism in Vuralia turcica (Tan et al. 1983) Uysal et al. (2014), to date, these genes have not been investigated. This study aims to identify NHX and TPS genes in V. turcica and to analyze gene expressions of these genes in response to cadmium and salt stresses.

MATERIALS AND METHODS

Plant materials

The leaves of salt (0, 1000, and 2000 ppm) and Cd (0, 5, 25, and 50 ppm) treated plants in the previous research (Tekdal & Cetiner 2018) were used for total RNA isolation. Leaf samples were obtained from the samples collected in the last experiment, treated with liquid nitrogen, and maintained at -80°C (Tekdal & Cetiner 2018).

Genomic DNA isolation

The MiniPrep DNA isolation method was used in gDNA isolation of V. turcica and was performed according to the protocol proposed by Edwards (1998). The purity of DNAs was achieved by spectrophotometric (NanoDrop ND 100, Wilmington, DE, USA) and electrophoresis (1% agarose) methods. Samples were adjusted with DNase and RNAse-free water at a concentration of 50 ng µl^-1 for further analysis.

Detection of orthologs of TPS and NHX genes and degenerate primers design

Since the sequences of the V. turcica TPS and NHX genes are unknown, the degenerate primer design was first performed. To find the orthologs of TPS and NHX genes, the corresponding gene sequences of the legumes were first selected from the NCBI database (Table I). The known gene fragments (TPS and NHX) of the selected legumes were compared, and degenerate primers were designed for amplification of candidate orthologs from the genomic DNA of V. turcica. Degenerate primers for TPS and NHX were developed based on conserved sequence segments (Figures 1 and 2, respectively) identified using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/) (Sievers et al. 2011). The primers designed for TPS and NHX sequences and selected for qRT-PCR analysis are described in Table II. Primers were designed manually using Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and synthesized by Sentebiolab (https://sentebiolab.com.tr/), Ankara, Turkey.

Figure 1
Multiple alignment of TPS orthologs in relative legume species of V. turcica (Cicer arietinum L., Glycine max (L.) Merr., and Vigna radiata (L.) R. Wilczek; Table I) and designing of degenerate primers based on mostly conserved sequences; arrows, selected forward and reverse primers; ‘*’, Identical amino acid residues; ‘:’ Conserved substitutions; ‘.’ Semi-conserved substitutions.

Figure 2
Multiple alignment of NHX orthologs in relative legume species of V. turcica (Cicer arietinum L., Vigna radiata (L.) R. Wilczek, Galega orientalis Lam., and Lotus tenuis Waldst. & Kit.; Table I) and designing of degenerate primers based on mostly conserved sequences; arrows, selected forward and reverse primers; ‘*’, Identical amino acid residues; ‘:’ Conserved substitutions; ‘.’ Semi-conserved substitutions.

Table I
TPS and NHX gene homologs from NCBI GenBank used for V. turcica putative gene analysis and mRNA sequences comparison.

Family	mRNA	Species	Accession No
Trehalose-6-Phosphate Synthase (TPS)
Fabaceae	Alpha,alpha-trehalose-phosphate synthase [UDP-forming] 1-like (LOC101492749)	Cicer arietinum L.	XM_004515548.2
Fabaceae	Trehalose-6-phosphate synthase gene	Glycine max (L.) Merr.	EU873088.1
Fabaceae	Alpha-trehalose-phosphate synthase [UDP-forming] 6 (LOC106777636)	Vigna radiata var. radiata	XM_014665298.2
Na + /H + antiporter (NHX)
Fabaceae	Na + /H + antiporter (NHX1)	Cicer arietinum L.	HM602043.1
Fabaceae	vacuolar sodium proton antiporter (nhx1)	Vigna radiate (L.) R. Wilczek	JN656211.1
Fabaceae	Na + /H + antiporter (NHX1)	Galega orientalis Lam.	EU340284.1
Fabaceae	NHX1-like protein	Lotus tenuis Waldst. & Kit.	EU727217.1

Table II
The list of the designed degenerate primers, control and housekeeping gene primers employed in this research (F, forward, R, reverse).

Target	Name	Sequence (5´-3´)	Definition	Product size (bp)
NHX	NHX-F NHX-R	GGTGTTGTGAATGATGCTAC GAACTCTSAGTCACATTATG	NHX-F/sense primer NHX-R/antisens primer	300
TPS	TPS-F TPS-R	GGGGWKRAKGAKWTWGAGG GTGTGRAARCCDAYYAAATC	TPS-F/sense primer TPS-R/antisens primer	471
18S rRNA	18S-F 18S-R	TACCGTCCTAGTCTCAACCATAA CAGAAGTGAACCTTTTCTTC	18S-F/sense primer 18S-R/antisens primer	Reference Song (2005)
TPS-1 (sequence specific primer)	TPS-1-F TPS-1-R	CAGATACTTCTTGAGTCC AGCTTGCCACAGAGACCG	TPS-1-F/sense primer TPS-1-R/antisens primer	155
NHX-1 (sequence specific primer)	NHX-1-F NHX-1-R	GCTTAATTCCAGGCACTC GAGACATAACAATCCCAC	NHX-1-F/sense primer NHX-1-R/antisense primer	204

PCR reaction and agarose gel electrophoresis

To obtain the amplification product using the designed primers, gradient PCR was performed to determine the optimal temperatures at which the primers were bound to DNA. The best DNA binding temperature of each primer applied with gradient PCR was determined according to the cleanest banding condition in 2% agarose gel. PCR amplifications were performed in a reaction volume of 25 µL reaction mixture containing 5 ng DNA, 0.8 µM of each primer (forward and reverse), 0.2 mM dNTP (Fermentas, #R0192), 0.125 unit Taq DNA Polymerase (Fermentas, #EP0402), 1X Taq DNA Polymerase buffer (Fermentas, 00061586), including 2.5 mM MgCl₂ (Fermentas, 00061590). The cycling parameters were as follows: 10 min at 95°C for initial denaturation and 35 cycles of 30 seconds each at 95°C (melting) and 30 seconds at a temperature specific for every primer pair - 48°C for TPS and 53°C for NHX primers – (annealing) and 1 min at 72°C (extension). These cycles were then followed by a final extension step at 72°C for 7 min. 10 µl of PCR products obtained from the designed degenerate primer analyzes were withdrawn, and 2 µl loading buffer (40% sucrose, 10 mM EDTA, 25% bromophenol blue) was added. The prepared mixture was studied in 2% agarose gel by adding 0.5x TBE (Trism Base, Boric Acid, EDTA) buffer. The gel was stained with 0.1% ethidium bromide solution. The presence of amplification products was determined by photographing under UV light (302 nm) on a Biorad Imager (Bio-Rad Laboratories, Segrate (Milan). The amplified and expected size PCR products were purified from the gel using the Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, USA) according to the protocol recommended by the manufacturer.

DNA sequencing and BLAST analysis

The sequencing service was commercially provided by Medsantek Ankara, Turkey (http://www.medsantek.com.tr/). The raw sequence data transmitted from Medsantek were manually checked, and the forward and reverse complemented sequences were aligned using the Pairwise Sequence Alignment (Nucleotide) (http://www.ebi.ac.uk/Tools/psa/emboss_needle/nucleotide.html) constructed by EMBL-EBI. The resulting consensus sequence was searched via the GenBank database at the National Center for Biotechnology Information (NCBI), Bethesda, USA, using the BLAST (Basic Local Alignment Search Tool; http://blast.ncbi.nlm.nih.gov/Blast.cgi) search program (Altschul et al. 1990) to determine similar sequences. The identified V. turcica TPS and NHX partial sequences were recorded in the NCBI GenBank using the Sequin program (https://www.ncbi.nlm.nih.gov/Sequin/).

RNA extraction and cDNA synthesis

Total RNAs were isolated from frozen leaf samples (~500 mg) by peqGOLD TriFast™ reagent (VWR International, LLC), following the manufacturer’s instructions. Isolated RNAs were quantified by measuring the absorbance of samples at 260 nm using a NanoDrop spectrophotometer (ND-1000) and were checked on 2% (w/v) agarose gel in terms of the integrity. RNA samples were kept at -80°C until the usage. cDNA was synthesized by reverse transcription from 2 µg RNA with a commercial kit and oligo-dT primers (SensiFast^TM cDNA Synthesis Kit (Bioline, A Meridian Life Science), following the manufacturer’s instructions.

The quantitative real-time PCR analysis

Quantitative Real-Time (qRT) PCR was performed on 30 ng of cDNA using SensiFAST™ SYBR® No-ROX Kit (Bioline) and analyzed by a LightCycler® 480 Instrument (Roche Diagnostics, Mannheim, Germany). The results were then normalized to the expression of the 18S rRNA of Fabaceae (Song 2005) as a housekeeping gene. Target gene expression was analyzed with a mathematical method proposed by Pfaffl (2001).

RESULTS

The salt and Cd stress tests on V. turcica were established by applying different concentrations of NaCl (0, 1000, and 2000 ppm) and Cd (0, 5, 25, and 50 ppm) (Tekdal & Cetiner 2018). In this study, leaf samples of piyan plants, which were applied to salt and Cd stresses (target groups) and not applied to any stress (control group), were obtained from the study implemented by Tekdal & Cetiner (2018). Genomic DNAs that were needed for TPS and NHX gene identification were isolated from the leaves of NaCl- and Cd-treated V. turcica (target) and non-treated V. turcica (control) successfully. The quality of isolated gDNAs and RNAs was in good quality, with a 260/280 ratio of 1.8-2.0, and their integrity was determined using agarose gel electrophoresis (Figure S1 - Supplementary Material).

To determine the effect of salt and Cd on the expression pattern of the TPS and NHX genes, total RNAs from leaves of NaCl- and Cd-treated plants were extracted and analyzed using agarose gel electrophoresis (Figure S2).

In this study, gDNAs were used as the template for PCR-based amplification using degenerate primers designed to TPS and NHX genes using conserved regions of TPS and NHX mRNAs available in the GenBank database (Table I). As a result of PCR analysis using degenerate primers, multiple bands were produced when used designed TPS primers, whereas single bands were obtained when used designed NHX primers (Figure 3). Multiple bands production is possibly related to amplifying unrelated sequences. The bands were expected sizes were extracted from the gel and purified for sequencing.

Figure 3
2% agarose gel electrophoresis results of PCR analysis of isolated leaf samples of V. turcica using degenerate NHX (left) and TPS (right) primers; K: control; T1: 1000 ppm NaCl treated leaves; T2: 2000 ppm NaCl treated leaves; Cd1: 5 ppm Cd treated leaves; Cd2: 25 ppm Cd treated leaves; Cd3: 50 ppm Cd treated leaves, M: 50 bp DNA ladder.

To identify the putative orthologues of TPS and NHX in V. turcica, isolated and purified PCR products were directly sequenced by the Sanger method. The sequences obtained through PCR were verified to be 230 bp in length for the NHX gene and 237 bp in length for the TPS gene and were deposited in the NCBI GenBank database with the following accession numbers: MH757417.1 and MK120983.1, respectively. The result of the BLAST search against the GenBank nucleotide database indicated that V. turcica and Arachis ipaensis Krapov. & W.C. Greg. shared the maximum identity (92%) at the nucleotide level in terms of the TPS gene, whereas and the identity between V. turcica and Cajanus cajan (L.) Millsp. was very high in terms of the NHX gene (Table III). Conceptual translation of the ORFs of the identified TPS sequence of V. turcica yielded an amino acid sequence of 79 aa (Figure 4), and the NHX sequence produced an amino acid sequence of 69 aa (Figure 5).

Figure 4
Translation of the ORFs of the identified TPS sequence of V. turcica.

Figure 5
Translation of the ORFs of the identified NHX sequence of V. turcica.

Table III
Sequence similarities according to The BLAST search against NCBI database based on identified partial sequences in V. turcica.

mRNA	Species	Accession No	Similarity (%)
TPS
alpha,alpha-trehalose-phosphate synthase [UDP-forming]	Arachis ipaensis Krapov. & W.C. Greg.	AYW34350.1	92
alpha,alpha-trehalose-phosphate synthase [UDP-forming]	Prunus avium (L.) L.	XP_021821062.1	90
trehalose-6-phosphate synthase	Ricinus communis L.	EEF34829.1	87
NHX
sodium/hydrogen exchanger 1-like	Cajanus cajan (L.) Millsp.	XP_020226542.1	81
Sodium/hydrogen exchanger 1	Cajanus cajan (L.) Millsp.	KYP74393.1	81
Sodium/hydrogen exchanger 2, partial	Mucuna pruriens (L.) DC.	RDX62800.1	78

To understand whether Cd exposure influences salt tolerance ability, NHX and TPS expressions in Cd-treated plants were examined. In low Cd concentration (5 ppm), the transcript level of TPS gradually increased, and the expression level of TPS increased by >5-fold in medium Cd concentration (25 ppm). In a high concentration of NaCl (2000 ppm) and Cd (50 ppm), NHX expression level and salt tolerance ability increased.

DISCUSSION

Abiotic stress factors affect crop production negatively in Turkey as well as all over the world. Plants activate stress-related genes against such stress conditions. Therefore, elucidating the molecular control mechanisms developed by plants against stress conditions will contribute to plant development. Salt stress is one of the abiotic stress factors and has a significant effect on product yield. Therefore, it is crucial to elucidate the molecular control steps of tolerance mechanisms in plants that can quickly develop in soils with high salt content. V. turcica (piyan) is an essential source of a gene that is in danger of extinction. As a result of the studies carried out with this plant, it was determined that the plant could develop in soils with high salt content.

As a result of studying with plants exposed to high temperature and drought, trehalose, a nonreducible disaccharide, was found to be effective in salt tolerance (Garg et al. 2002). TPS is the most well-known enzyme gene that plays a role in the biosynthesis of trehalose, which is protective against salt stress (Carcia et al. 1997). Many studies indicate an increase in the expression of the TPS gene in stressed plants (Almeida et al. 2005, Zhang et al. 2005, Kosmas et al. 2006, Lunn 2007). The vacuolar Na⁺/H⁺ antiporter gene has been reported to be effective in salt tolerance in many plants (Arabidopsis thaliana (L.) Heynh. (Apse et al. 1999); Lycopersicon esculentum Mill. (Zhang & Blumwald 2001); Brassica napus L. (Zhang et al. 2001); Oryza sativa L. (Fukuda et al. 2011)). In salt stress study with V. turcica, it was determined that the salt tolerance of the species was found as a result of phenological and physiological studies (Tekdal & Cetiner 2018). Within the scope of the present study, the partial sequences of the TPS and NHX genes were characterized. Salt tolerance ability of plants can be affected by increasing the osmolyte production or stress proteins (Zhu 2001). In a previous study, the NHX gene of A. thaliana enhanced salt tolerance ability of wheat and tomato (Zhang et al. 2001, Xue et al. 2004). Expression levels of NHX and TPS in response to NaCl and Cd were evaluated by qRT-PCR (Figure 6). Likewise, as a result of PCR study with primers designed for TPS and NHX genes and cDNAs of samples subjected to salt stress, the expression level of the NHX gene was higher than that of the TPS gene. Under salt stress, NHX and TPS gene expressions were examined in V. turcica leaf tissues, and there was no significant change in TPS gene expression. It was thought that the difference in the expression of the TPS gene could be seen by prolonging the stress period applied or by examining the root tissues. According to the literature, it was found that the TPS gene was overexpressed in transgenic plants resistant to salt stress; Ginkgo biloba L. (Wu et al. 2006), rice (Garg et al. 2002, Jang et al. 2003), tobacco (Almeida et al. 2005, Zhang et al. 2005). The expression of NHX was high by applying 50 ppm Cd. It is, therefore, likely that the NHX gene was most active in V. turcica exposed to high Cd concentration (50 ppm).

Figure 6
Effect of NaCl and Cd on TPS and NHX expression in V. turcica leaves. Data normalized to 18S rRNA are expressed as mean relative Ct(Cp) values of three independent experiments. Gene expression was quantified by qRT-PCR in V. turcica leaves treated for 1 month with NaCl (1000 and 2000 ppm) and Cd (5, 25, and 50 ppm). Untreated leaves were taken as controls.

CONCLUSION

Under salt and cadmium stress conditions, plants tend to change their developmental physiology mostly to overcome stress. NHX and TPS genes are essential for homeostasis in plants. Since there are no studies in the literature on the determination of V. turcica NHX and TPS genes and the elucidation of expression levels of these genes, it is thought that the present study findings will fill an essential gap in the literature. As a result of this study, partial sequences of TPS and NHX genes, which are thought to be useful in the mechanism of tolerance to salt stress in V. turcica, were determined for the first time and introduced into the literature.

ACKNOWLEDGMENTS

This research was supported by the Scientific Research Projects Coordination Unit of Mersin University, Mersin, Turkey, through grant No. 2018-2-AP3-2961.

REFERENCES

• ADABNEJAD H, KAVOUSI HR, HAMIDI H & TAVASSOLIAN I. 2015. Assessment of the vacuolar Na+/H+ antiporter (NHX1) transcriptional changes in Leptochloa fusca L. in response to salt and cadmium stresses. Mol Biol Res Commun 4(3): 133-142.
• ALMEIDA AM, VILLALOBOS E, ARAUJO SS, LEYMAN B, VAN DIJCK P, ALFARO-CARDOSO L, FEVEREIRO PS, TORNE JM & SANTOS DM. 2005. Transformation of tobacco with an Arabidopsis thaliana gene involved in trehalose biosynthesis increases tolerance to several abiotic stresses. Euphytica 146(1-2): 165-176.
• ALTSCHUL SF, GISH W, MILLER W, MYERS EW & LIPMAN D. 1990. Basic local alignment search tool. J Mol Biol 215(3): 403-410.
• APSE MP, AHARON GS, SNEDDEN WA & BLUMWALD E. 1999. Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285(5431): 1256-1258.
• AVONCE N, LEYMAN B, MASCORRO-GALLARDO O, VAN DIJCK P, THEVELEIN JM & ITURRIAGA G. 2004. The Arabidopsis trehalose-6-phosphate synthase AtTPS1 gene is a regulator of glucose, abscisic acid and stress signaling. Plant Physiol 136: 3649-3659.
• CARCIA AB, ENGLER JDA & CERATS T. 1997. Effects of osmoprotectants upon NaCl stress in rice. Plant Physiol 115: 159-169.
• CONG M, LV J, LIU X, ZHAO J & WU H. 2013. Gene expression in Suaeda salsa after cadmium exposure. Springerplus 2: 232.
• CROWE JH, CROWE LM & CHAPMANN D. 1984. Preservation of membranes in anhydrobiotic organisms, the role of trehalose. Science 223(4637): 73-103.
• EDWARDS KJ. 1998. Miniprep Procedures for the Isolation of Plant DNA. In: Karp A, Isaac PG and Ingram DS (Eds). Molecular Tools for Screening Biodiversity. Springer, Dordrecht, p. 22-24.
• ELBEIN AD. 1974. The metabolism of alpha, alpha-trehalose. Adv Carbohydr Chem Biochem 30: 227-256.
• ELBEIN AD, PAN YT, PASTUSZAK I & CARROLL D. 2003. New insights on trehalose: a multifunctional molecule. Glycobiology. 13: 17R-27R.
• FUKUDA A, NAKAMURA A, HARA N, TOKI S & TANAKA Y. 2011. Molecular and functional analyses of rice NHX-type Na+/H+ antiporter genes. Planta 233(1): 175-188.
• FUKUDA A, NAKAMURA A, TAGIRI A, TANAKA H, MIYAO A, HIROCHIKA H & TANAKA Y. 2004. Function, intracellular localization and the importance in salt tolerance of a vacuolar Na+/H+ antiporter from rice. Plant Cell Physiol 45(2): 146-159.
• GARG AK, KIM JK, OWENS TG, RANWALA AP, CHOI YD, KOCHIAN LV & WU RJ. 2002. Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. P Natl Acad Sci USA 99(25): 15898-15903.
• JANG IC ET AL. 2003. Expression of a bifunctional fusion of the Escherichia coli genes for trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase in transgenic rice plants increases trehalose accumulation and abiotic stress tolerance without stunting growth. Plant Physiol 131(2): 516-524.
• KISSOUDIS C, CHOWDHURY R, VAN HEUSDEN S, VAN DE WIEL C, FINKERS R, VISSER RGF, BAI Y & VAN DER LINDEN G. 2015. Combined biotic and abiotic stress resistance in tomato. Euphytica 202(2): 317-332.
• KOSMAS SA, ARGYROKASTRITIS A, LOUKAS MG, ELIOPOULOS E, TSAKAS S & KALTSIKES PJ. 2006. Isolation and characterization of drought-related trehalose 6-phosphate-synthase gene from cultivated cotton (Gossypium hirsutum L.). Planta 223(2): 329-339.
• KWON SJ, HWANG EW & KWON HB. 2004. Genetic engineering of drought potato plants by co-introduction of genes encoding trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase of Zygosaccharomyces rouxii. Korean J Genet 26(2): 199-206.
• LUNN JE. 2007. Gene families and evolution of trehalose metabolism in plants. Funct Plant Biol 34: 550-563.
• PFAFFL MW. 2001. A new mathematical model for relative quantification in real-time RT - PCR. Nucleic Acids Res 29(9): e45.
• SHI H & ZHU JK. 2002. Regulation of expression of the vacuolar Na+/H+ antiporter gene AtNHX1 by salt stress and abscisic acid. Plant Mol Biol 50(3): 543-550.
• SIEVERS F ET AL. 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7: 539.
• SONG J. 2005. Genetic diversity and flowering in Clianthus and New Zealand Sophora (Fabaceae) [dissertation]. New Zealand: Massey University.
• TAN K, VURAL M & KÜÇÜKÖDÜK M. 1983. An unusual new Thermopsis from Turkey. Notes Roy Bot Gard Edinburgh 40: 515-518.
• TEKDAL D & CETINER S. 2018. Investigation of the effects of salt (NaCl) stress and cadmium (Cd) toxicity on growth and mineral acquisition of Thermopsis turcica. S Afr J Bot 118: 274-279.
• UYSAL T, ERTUĞRUL K & BOZKURT M. 2014. A new genus segregated from Thermopsis (Fabaceae: Papilionoideae): Vuralia. Plant Syst Evol 300: 1627-1637.
• WU W, PANG Y, SHEN G, LU J, LIN J, WANG J, SUN X & TANG K. 2006. Molecular cloning, characterization and expression of a novel trehalose-6-phosphate synthase homologue from Ginkgo biloba. J Biochem Mol Biol 39(2): 158-166.
• XUE ZY, ZHI DY, XUE GP, ZHANG H, ZHAO YX & XIA GM. 2004. Enhanced salt tolerance of transgenic wheat (Triticum aestivum L.) expressing a vacuolar Na+/H+ antiporter gene with improved grain yields in saline soils in the field and a reduced level of leaf Na+. Plant Sci 167(4): 849-859.
• ZHANG HX & BLUMWALD E. 2001. Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit. Nat Biotechnol 19(8): 765-768.
• ZHANG HX, HODSON JN, WILLIAMS JP & BLUMWALD E. 2001. Engineering salt-tolerant Brassica plants: characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation. P Natl Acad Sci USA 98(22): 12832-12836.
• ZHANG S, YANG B, FENG C & TANG H. 2005. Genetic transformation of tobacco with the trehalose synthase gene from Grifola frondosa Fr. enhances the resistance to drought and salt in tobacco. J Integr Plant Biol 47(5): 579−587.
• ZHU JK. 2001. Plant salt tolerance. Trends Plant Sci 6(2): 66-71.

SUPPLEMENTARY MATERIAL

Figures S1 and S2.

Publication Dates

• Publication in this collection
  30 June 2021
• Date of issue
  2021

History

• Received
  21 Feb 2020
• Accepted
  1 May 2020