Aflatoxins produced by Aspergillus nomius ASR3, a pathogen isolated from the leaf-cutter ant Atta sexdens rubropilosa

ABSTRACT

Aspergillus spp. cause economic impacts due to aflatoxins production. Although the toxicity of aflatoxins is already known, little information about their ecological roles is available. Here we investigated the compounds produced by Aspergillus nomius ASR3 directly from a dead leaf-cutter queen ant Atta sexdens rubropilosa and the fungal axenic culture. Chemical analyses were carried out by high-resolution mass spectrometry and tandem mass spectrometry techniques. Aflatoxins B1 and G1 were detected in both the axenic culture and in the dead leaf-cutter queen ant. The presence of these mycotoxins in the dead leaf-cutter queen ant suggests that these compounds can be related to the insect pathogenicity of A. nomius against A. sexdens rubropilosa.

Keywords:
Aflatoxins; Aspergillus nomius; Leaf-cutter ants; Mass spectrometry; Chemical ecology

Introductory remarks

Fungus-farming ants cultivate a symbiont fungus as their primary food source. A group of fungus-farming ants started to feed the symbiont fungus with plant material in about 8–12 million years ago and they are known as leaf-cutter ants (Schultz and Brady, 2008). Leaf-cutter ants of the genera Atta and Acromyrmex cultivate the fungus Leucoagaricus gongylophorus (Licht et al., 2014) and are considered as dominant herbivores of the New World tropics (Schultz and Brady, 2008). An adult colony of Atta spp. can have millions of ants, which collect large amounts of plant material to feed their mutualistic fungus (Hölldobler and Wilson, 1990). Leaf-cutter ants are important for the ecosystem equilibrium in temperate areas of America and can also cause agricultural losses when they collect plant material from crops (Weber, 1966).

A new leaf-cutter ant colony starts with a queen ant that is fecundated during the nuptial flight. Most of the queen ants are predated and a small number succeed in starting a new colony (Weber, 1966). Leaf-cutter ants are associated with antibiotic-producing bacteria to protect their colonies (Santos et al., 2004; Haeder et al., 2009; Seipke et al., 2011; Schoenian et al., 2011). Fungus-farming ants possess evolved glands to feed symbiont bacteria hosted on their exoskeleton and, in turn, bacteria produce antimicrobial compounds (Currie et al., 2006). Ant-symbiont bacteria are considered a promising source of antibiotics, the natural products dentigerumycin and selvamicin are novel antifungal agents produced by ant-symbiont bacteria (Oh et al., 2009; Van Arnam et al., 2016).

Fungal pathogens also play a role in this multilateral symbiotic system. The well-known specialized fungal garden pathogen Escovopsis spp. can destroy colonies of fungus-farming ants (Currie et al., 1999). Other fungi from the genera Aspergillus, Fusarium, and Trichoderma, can also parasite leaf-cutter ants colonies (Poulsen et al., 2006; Pagnocca et al., 2012). Aspergillus nomius, for instance, produces insecticidal natural products such as nominine and aspernomine (Gloer et al., 1989; Staub et al., 1992). The main goal of this work was to identify the major secondary metabolites produced by A. nomius ASR3 after its proliferation in an Atta sexdens rubropilosa queen ant.

Materials and methods

Fungal spores were collected from the body of an A. sexdens rubropilosa queen infested by a greenish-yellow fungus and were inoculated on Petri plates containing PDA medium. The plates were incubated at 30 ºC until fungal growth and sporulation. Spores of the isolated fungus were preserved at -80 ºC in cryotubes containing a 20% glycerol aqueous solution. The fungal strain ASR3 was identified by sequencing the ITS (internal transcribed spacer) region using the primers ITS-1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS-4 (5′TCCTCCGCTTATTGATATGC3′). The species (GenBank accession number KY986877) was identified by comparison (BLAST search) with sequences deposited at NCBI.

Spores of ASR3 were inoculated on 80 mm Petri dishes containing 25 ml of PDA medium. The fungal culture and the control (PDA only) were incubated for 14 days at 30 ºC. After this period, the culture medium of each plate was collected and extracted with 60 ml of ethyl acetate. The infested queen ant was also extracted with ethyl acetate. Finally, the extracts were filtered and evaporated to dryness.

The crude extracts and authentic Sigma–Aldrich standards of aflatoxins B1 and G1 solutions in methanol/water (1:1 v/v) were analyzed by direct infusion into the electrospray (ESI) source of the micrOTOF Q II-ESI-TOF mass spectrometer (Bruker Daltonics). Formic acid was added in the samples before the ESI-MS acquisitions to improve the protonation. The data acquisition was performed at the positive ion-monitoring mode and the MS/MS spectra were obtained by collision of the selected ions with nitrogen gas. A solution of trifluoroacetic acid (TFA-Na+) at 10 mg ml^-1 was used for internal calibration, the capillary voltage was set for 3.5 kV and the drying temperature was 180 ºC.

Results and discussion

The fungus ASR3 was isolated from a queen of the leaf-cutter ant A. sexdens rubropilosa, which had died after the nuptial flight and its body was infested by a greenish-yellow fungus (Fig. 1). The isolated fungus was identified as A. nomius by a BLAST search of the ITS sequence from ASR3 strain, which revealed 99% of identity match with ITS sequence for A. nomius MW16 (GenBank accession number KF312149.1). This species has been described as pathogenic for social insects such as leaf-cutting ants (Poulsen et al., 2006) and termites (Chouvenc et al., 2012); however the compounds involved in the pathogenesis remain underexplored.

Fig. 1
Atta sexdens rubropilosa queen infested by Aspergillus nomius (A), and Aspergillus nomius ASR3 isolated from the ant (B).

In order to identify the compounds possibly involved in the toxicity of A. nomius ASR3 against A. sexdens rubropilosa, the fungus was grown axenically in PDA Petri dishes and extracted with ethyl acetate; the dead queen ant was also directly extracted with ethyl acetate. The crude extracts were then analyzed by ESI-HRMS and ESI-MS/MS with no previous separation or other sample preparation. The major ions at m/z 335.0530 and m/z 351.0454 were present in both extracts, but absent in PDA control medium extract (Fig. 2). The high-resolution mass analysis suggested their identities as aflatoxin B1 (1) (C₁₇H₁₃O₆ ⁺, error 1.6 ppm) and aflatoxin G1 (2) (C₁₇H₁₃O₇ ⁺, error 1.5 ppm; Table 1). The fragmentations patterns at ESI-MS/MS for these ions were consistent with the literature data for 1 and 2 (Cavaliere et al., 2007; Sirhan et al., 2013; Tóth et al., 2013) and matched with authentic standards (Fig. S2-S5). These fragmentations involve losses of CO, CO₂, H₂O, and methyl radicals, which are common eliminations for lactones and aromatic methoxyl group (Crotti et al., 2009; Vessecchi et al., 2011; Demarque et al., 2016)

Fig. 2
ESI-HRMS spectra of ethyl acetate extracts of A. sexdens queen (A) and A. nomius ASR3 cultivated in PDA medium (B). The red arrows indicate the aflatoxins ions.

Table 1
Compounds produced by Aspergillus nomius identified using ESI-HRMS and ESI-MS/MS.

Compound	Axenic fungal culture			Queen ant		Fragment ions (m/z)a
	Molecular formula	[M+H]+ (error (ppm))		Molecular formula	[M+H]+ (error (ppm))
Aflatoxin B1	C17H12O6	313.0712 (1.6)		C17H12O6	313.0711 (1.3)	298, 285, 270, 257, 241
Aflatoxin G1	C17H12O7	329.0661 (1.5)		C17H12O7	329.0658 (0.6)	311, 283, 243, 215

• ^a
  Fragment ions are common for aflatoxins produced by A. nomius ASR3 and authentic standards. Protonated aflatoxins ions were observed after the addition of formic acid in the samples.

Aflatoxins are mycotoxins generally produced by Aspergillus spp. that have been described as toxic to humans, animals and insects (Matsumura and Knight, 1967; Kirk, 1971; Gacem and Hadj-Khelil, 2016). The carcinogenic effects of aflatoxins B1 and G1 are due to the CYP450 activation of the double bond in the ring A to an active epoxide, which covalently binds to the DNA (Niu et al., 2008). However, despite the knowledge about the production and biological activity of aflatoxins, little is known about the ecological functions of these natural products. It has been shown that some insects such as the earworm Helicoverpa zea are able to detoxify aflatoxins (Niu et al., 2009), while aflatoxins impair the proper development of other insects (Matsumura and Knight, 1967; Gunst et al., 1982). The high toxicity of aflatoxins and the detection in the dead leaf-cutter queen ant, suggest that these compounds may be involved with the pathogenicity of A. nomius ASR3 for the leaf-cutter ants A. sexdens rubropilosa.

Acknowledgments

The authors thank São Paulo Research Foundation (FAPESP grants 2012/24204-1, 2012/22487-6, 2013/50954-0 and 2013/04092-7), CAPES and CNPq for funding and research support.

Appendix A Supplementary data

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bjp.2017.05.001.

References

• Cavaliere, C., Foglia, P., Guarino, C., Nazzari, M., Samperi, R., Laganà, A., 2007. Determination of aflatoxins in olive oil by liquid chromatography–tandem mass spectrometry. Anal. Chim. Acta 596, 141-148.
• Chouvenc, T., Efstathion, C.A., Elliott, M.L., Su, N.Y., 2012. Resource competition between two fungal parasites in subterranean termites. Naturwissenschaften 99, 949-958.
• Crotti, A.E.M., Bronze-Uhle, E.S., Nascimento, P.G.B.D., Donate, P.M., Galembeck, S.E., Vessecchi, R., Lopes, N.P., 2009. Gas-phase fragmentation of γ-lactone derivatives by electrospray ionization tandem mass spectrometry. J. Mass Spectrom. 44, 1733-1741.
• Currie, C.R., Mueller, U.G., Malloch, D., 1999. The agricultural pathology of ant fungus gardens. Proc. Natl. Acad. Sci. U. S. A. 96, 7998-8002.
• Currie, C.R., Poulsen, M., Mendenhall, J., Boomsma, J.J., Billen, J., 2006. Coevolved crypts and exocrine glands support mutualistic bacteria in fungus-growing ants. Science 311, 81-83.
• Demarque, D.P., Crotti, A.E.M., Vessecchi, R., Lopes, J.L.C., Lopes, N.P., 2016. Fragmentation reactions using electrospray ionization mass spectrometry: an important tool for the structural elucidation and characterization of synthetic and natural products. Nat. Prod. Rep. 33, 432-455.
• Gacem, M.A., Hadj-Khelil, A.O.E., 2016. Toxicology, biosynthesis, bio-control of aflatoxin and new methods of detection. Asian Pac. J. Trop. Biomed. 6, 808-814.
• Gloer, J.B., Rinderknecht, B.L., Wicklow, D.T., Dowd, P.F., 1989. Nominine: a new insecticidal indole diterpene from the sclerotia of Aspergillus nomius J. Org. Chem. 54, 2530-2532.
• Gunst, K., Chinnici, J.P., Llewellyn, G.C., 1982. Effects of aflatoxin B1, aflatoxin B2, aflatoxin G1, and sterigmatocystin on viability, rates of development, and body length in two strains of Drosophila melanogaster (Diptera). J. Invertebr. Pathol. 39, 388-394.
• Haeder, S., Wirth, R., Herz, H., Spiteller, D., 2009. Candicidin-producing Streptomyces support leaf-cutting ants to protect their fungus garden against the pathogenic fungus Escovopsis Proc. Natl. Acad. Sci. U. S. A. 106, 4742-4746.
• Hölldobler, B., Wilson, E.O., 1990. The Ants. Belknap Press, Cambridge.
• Kirk, H.D., 1971. Effect of aflatoxin B1 on development of Drosophila melanogaster (Diptera). J. Invertebr. Pathol. 18, 313-315.
• Licht, H.H., Boomsma, J.J., Tunlid, A., 2014. Symbiotic adaptations in the fungal cultivar of leaf-cutting ants. Nat. Commun. 5, 5675.
• Matsumura, F., Knight, S.G., 1967. Toxicity and chemosterilizing activity of aflatoxin against insects. J. Econ. Entomol. 60, 871-872.
• Niu, G., Siegel, J., Schuler, M.A., Berenbaum, M.R., 2009. Comparative toxicity of mycotoxins to navel orangeworm (Amyelois transitella) and corn earworm (Helicoverpa zea). J. Chem. Ecol. 35, 951-957.
• Niu, G., Wen, Z., Rupasinghe, S.G., Ren, S.Z., Berenbaum, M.R., Schuler, M.A., 2008. Aflatoxin B1 detoxification by CYP321A1 in Helicoverpa zea Arch. Insect Biochem. Physiol. 69, 32-45.
• Oh, D.C., Poulsen, M., Currie, C.R., Clardy, J., 2009. Dentigerumycin: a bacterial mediator of an ant-fungus symbiosis. Nat. Chem. Biol. 5, 391-393.
• Pagnocca, F.C., Masiulionis, V.E., Rodrigues, A., 2012. Specialized fungal parasites and opportunistic fungi in gardens of attine ants. Psyche (Stuttg), http://dx.doi.org/10.1155/2012/905109
  » http://dx.doi.org/10.1155/2012/905109
• Poulsen, M., Hughes, W.O.H., Boomsma, J.J., 2006. Differential resistance and the importance of antibiotic production in Acromyrmex echinatior leaf-cutting ant castes towards the entomopathogenic fungus Aspergillus nomius Insect. Soc. 53, 349-355.
• Santos, A.V., Dillon, R.J., Dillon, V.M., Reynolds, S.E., Samuels, R.I., 2004. Occurrence of the antibiotic producing bacterium Burkholderia sp. in colonies of the leaf-cutting ant Atta sexdens rubropilosa FEMS Microbiol. Lett. 239, 319-323.
• Schoenian, I., Spiteller, M., Ghaste, M., Wirth, R., Herz, H., Spiteller, D., 2011. Chemical basis of the synergism and antagonism in microbial communities in the nests of leaf-cutting ants. Proc. Natl. Acad. Sci. U. S. A. 108, 1955-1960.
• Schultz, T.R., Brady, S.G., 2008. Major evolutionary transitions in ant agriculture. Proc. Natl. Acad. Sci. U. S. A. 105, 5435-5440.
• Seipke, R.F., Barke, J., Brearley, C., Hill, L., Yu, D.W., Goss, R.J.M., Hutchings, M.I., 2011. A single Streptomyces symbiont makes multiple antifungals to support the fungus farming ant Acromyrmex octospinosus PLoS ONE 6, 1-8.
• Sirhan, A.Y., Tan, G.H., Wong, R.C.S., 2013. Determination of aflatoxins in food using liquid chromatography coupled with electrospray ionization quadrupole time of flight mass spectrometry (LC-ESI-QTOF-MS/MS). Food Control 31, 35-44.
• Staub, G.M., Gloer, J.B., Wicklow, D.T., Dowd, P.F., 1992. Aspernomine: a cytotoxic antiinsectan metabolite with a novel ring system from the sclerotia of Aspergillus nomius J. Am. Chem. Soc. 114, 1015-1017.
• Tóth, K., Nagy, L., Mándi, A., Kuki, Á., Mézes, M., Zsuga, M., Kéki, S., 2013. Collision-induced dissociation of aflatoxins. Rapid Commun. Mass Spectrom. 27, 553-559.
• Van Arnam, E.B., Ruzzini, A.C., Sit, C.S., Horn, H., Pinto-Tomás, A.A., Currie, C.R., Clardy, J., 2016. Selvamicin, an atypical antifungal polyene from two alternative genomic contexts. Proc. Natl. Acad. Sci. U. S. A. 113, 12940-12945.
• Vessecchi, R., Zocolo, G.J., Gouvea, D.R., Huebner, F., Cramer, B., Marchi, M.R.R., Humpf, H.U., Lopes, N.P., 2011. Re-examination of the anion derivatives of isoflavones by radical fragmentation in negative electrospray ionization tandem mass spectrometry: experimental and computational studies. Rapid Commun. Mass Spectrom. 25, 2020-2026.
• Weber, N.A., 1966. Fungus-growing ants. Science 153, 587-604.

Publication Dates

• Publication in this collection
  Jul-Aug 2017

History

• Received
  21 Feb 2017
• Accepted
  15 May 2017