SciELO - Scientific Electronic Library Online

 
vol.47 issue1Spatial distribution of citrus leprosis in the Eastern AmazonEffect of food additives on the antioxidant properties and microbiological quality of red guava juice author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Revista Ciência Agronômica

Print version ISSN 0045-6888On-line version ISSN 1806-6690

Rev. Ciênc. Agron. vol.47 no.1 Fortaleza Jan./Mar. 2016

http://dx.doi.org/10.5935/1806-6690.20160008 

Engenharia de Alimentos

Determinantes de virulência em Enterococcus endógenos de queijo artesanal1

Determinants of virulence in Enterococcus endogenous to artisanal cheese

Bruna Castro Porto2 

Graciela Fujimoto3 

Maria de Fatima Borges2  * 

Laura Maria Bruno2 

Juliane Döering Gasparin Carvalho4 

2Laboratório de Microbiologia de Alimentos, Embrapa Agroindústria Tropical, Fortaleza-CE, Brasil, portocbruna@gmail.com, maria.fatima@embrapa.br, laura.bruno@embrapa.br

3Programa de Pós-Graduação em Tecnologia de Alimentos, Departamento de Tecnologia de Alimentos, Universidade Estadual de Campinas, Campinas- SP, Brasil, gracielafugimoto@gmail.com

4Departamento de Tecnologia de Alimentos, Universidade Federal do Ceará, Fortaleza-CE, Brasil, juliane.gasparin@ufc.br

RESUMO

A presença de Enterococcus spp. em alimentos representa um perigo para a saúde pública, devido a sua frequente associação a várias infecções clínicas. A patogenicidade de Enterococcus é multifatorial, complexa e ocorre a partir de uma sequência de fatores de virulência. O objetivo do estudo foi avaliar a presença de determinantes fenotípicos e genotípicos de virulência em Enterococcus spp. isolados de queijo de Coalho. Um total de 53 cepas de Enterococcus spp. foram analisadas quanto à susceptibilidade a antimicrobianos, produção de hemolisinas, DNAse, termonuclease, gelatinase e o perfil de genes codificadores de virulência. Observou-se que 75,5% das cepas foram resistentes a pelo menos um dos nove antibióticos testados, 26,42% foram resistentes a dois e 3,77% a três antibióticos. A presença de fenótipos de resistência à vancomicina foi constatada em 11,33% das cepas. A atividade hemolítica foi observada em 100% das cepas, a produção de DNAse, em apenas 3,8%, e não houve produção de termonuclease e gelatinase. As cepas resistentes à vancomicina e teicoplanina foram identificadas como E. faecium e Enterococcus spp. O perfil de determinantes genéticos de virulência foi bastante variável e 90% das cepas abrigavam pelo menos um dos nove genes pesquisados. O gene efaA apresentou maior prevalência (70%), seguido do gene ace (50%), gene esp e genegelE (40%).

Palavras-chave: Produtos lácteos; Bactérias ácido láticas; Patogenicidade; Susceptibilidade a antibióticos

ABSTRACT

The presence of Enterococcus spp. in food poses a danger to public health due to its frequent association with various clinical infections. Pathogenicity in Enterococcus is multifactorial and complex, and stems from a sequence of virulence factors. The aim of this study was to evaluate the presence of phenotypic and genotypic determinants of virulence in Enterococcus spp. isolated from curd cheese. A total of 53 strains of Enterococcus spp. were analysed as to their susceptibility to antimicrobial agents, production of hemolysins, DNAse, thermonuclease, and gelatinase, and the profile of virulence-encoding genes. It was found that 75.5% of the strains were resistant to at least one of the nine antibiotics tested, 26.42% were resistant to two, and 3.77% to three antibiotics. The presence of vancomycin-resistance phenotypes was seen in 11.33% of the strains. Haemolytic activity was observed in 100% of strains and DNAse production in only 3.8%. There was no production of thermonuclease or gelatinase. Strains resistant to vancomycin and teicoplanin were identified as E. faecium and Enterococcus spp. The profile of the genetic determinants of virulence was highly variable, and 90% of the strains harboured at least one of the nine genes being studied. The efaA gene showed the highest prevalence (70%), followed by the ace gene (50%), the esp gene and gelE gene (40%).

Key words: Dairy products; Lactic acid bacteria; Pathogenicity; Susceptibility to antibiotics

INTRODUÇÃO

As bactérias ácido láticas estão amplamente distribuídas na natureza e predominam na microbiota de alimentos ricos em carboidratos, proteínas e vitaminas. Os gêneros Lactococcus, Lactobacillus, Streptococcus, Leuconostoc e Enterococcus são comumente encontrados em queijos, principalmente artesanais (DOLCI et al., 2008). No Brasil, os queijos são os produtos que mais apresentam Enterococcus spp. quando comparados a leites, produtos cárneos e vegetais (GOMES et al., 2008).

O gênero Enterococcus pertence à família Enterococcaceae e inclui 52 espécies e duas subespécies (LPSN, 1998), sendo E. faecium e E. faecalis as espécies de maior ocorrência na microbiota natural de vários tipos de queijos (EATON; GASSON, 2001). Seu principal resevatório é o trato gastrointestinal do homem e dos animais, mas também é encontrado no solo e na água. A bactéria chega ao leite e seus derivados a partir de contaminação por material fecal, pele dos animais, água poluída, equipamentos de ordenha e tanques de recepção do leite.

A presença de Enterococcus em alimentos tem sido motivo de preocupação para os órgãos de saúde pública pela sua característica ambígua (MORAES et al., 2012). Apesar de contribuir para o desenvolvimento das características sensoriais (FOULQUIÉ-MORENO et al., 2006) e apresentar potencial para a biopreservação em queijos, por produzir bacteriocinas ativas contra patógenos (SANTOS et al., 2014), podem abrigar vários genes codificadores de fatores de virulência (MORAES et al., 2012).

Dentre os determinantes de virulência associados à patogenicidade destacam-se a resistência a antibióticos, como vancomicina (genes vanA, vanB, vanC) e a produção de proteínas extracelulares como: hemolisina (genes cylA, cylB, cylM, cylL), gelatinase (gene gelE), proteínas de superfície (gene esp), adesinas de parede celular (gene efa), adesinas de colágeno (gene ace), substância de agregação (gene as), DNAse e termonuclease (EATON; GASSON, 2001; FOULQUIÉ-MORENO et al., 2006; JOHANSSON; RASMUSSEN, 2013; MANNU et al., 2003; YOGURTCU; TUNCER, 2013).

Na região Nordeste do Brasil, o queijo de Coalho é mais do que um produto típico, devido a sua relevância econômica e social. É produzido artesanalmente, baseado em técnicas que são transmitidas de geração a geração, envolvendo desde cedo as pessoas na atividade e tornando-as peças fundamentais na renda familiar (MOURA, 2012).

O queijo de Coalho apresenta uma microbiota natural diversificada, com predominância de Enterococcus (SANTOS et al., 2014). No entanto, há poucos dados sobre a sua patogenicidade. Tendo em vista o exposto, o objetivo do presente estudo foi avaliar a presença de determinantes fenotípicos e genotípicos de virulência em Enterococcus spp. isolados de queijo de Coalho.

MATERIAL E MÉTODOS

Microrganismos

O estudo foi realizado com 53 cepas de Enterococcus spp., selecionadas aleatoriamente, da Coleção de Microrganismos de Interesse para a Agroindústria Tropical da Embrapa Agroindústria Tropical. As cepas da coleção foram isoladas a partir de oito marcas de queijo de Coalho artesanal, comercializadas em Fortaleza, provenientes do Vale do Jaguaribe (Jaguaribe, Limoeiro do Norte e Morada Nova) e Sertões Cearenses (Quixadá e Tauá), estado do Ceará. As culturas foram previamente identificadas como Enterococcus spp. pelo sistema de identificação presuntivo API50CHL e API20Strep (BioMériaux, Marcy-l'Etoile, Fance) (SANTOS et al., 2014).

Ativação das culturas

As cepas de Enterococcus spp. armazenadas a -80 ºC foram descongeladas e ativadas em caldo Man, Rogosa e Sharpe - MRS (Becton, Dickinson and Company, Sparks, USA). Após incubação a 35 ºC/24h a cultura foi inoculada em meio Skim Milk (Becton, Dickinson and Company, Sparks, USA) e mantida sob refrigeração (6-8 ºC). Para a realização dos testes, as cepas foram repicadas em caldo MRS e estriadas em ágar MRS (35 ºC/24-48 h) para obtenção de colônias isoladas, as quais foram selecionadas aleatoriamente para a realização dos testes de suscetibilidade a antibióticos e testes bioquímicos. Todos os ensaios foram realizados em três repetições.

Avaliação da sensibilidade in vitro a antibióticos

A sensibilidade das cepas de Enterococcus foi determinada de acordo com a norma de Padronização dos Testes de Sensibilidade a Antimicrobianos por Discodifusão, recomendada pelo Clinical and Laboratory Standards Institute (CLSI, 2003). Foram avaliados nove antibióticos comerciais (Oxoid Limited, Basingstoke, Datford and Perth, UK): ampicilina (10μg), cloranfenicol (30 μg), eritromicina (15μg), estreptomicina (300μg), gentamicina (120μg), norfloxacina (10μg), teicoplanina (30μg), tetraciclina (30μg) e vancomicina (30μg).

Uma colônia de cada cepa foi inoculada em caldo MRS e incubada a 35 °C/18-24 h. A suspensão de células foi ajustada para 108 células mL-1 e semeada em ágar Mueller-Hinton (Becton, Dickinson and Company, Sparks, USA). Após secagem, os discos de antibióticos foram colocados sobre a superfície do ágar e as placas foram incubadas a 35 ºC/16-18 h, exceto a da vancomicina (35 °C/24 h). A sensibilidade das cepas foi determinada pela medida do diâmetro dos halos de inibição em torno dos discos e classificada como sensível, intermediária e resistente com base nos halos de referência para cada antibiótico testado, estabelecidos na Norma de Desempenho para Testes de Sensibilidade Antimicrobiana: 15° Suplemento Informativo, Normas Interpretativas do Teste de CIM (μg mL-1) para Enterococcus spp., conforme recomendado pelo Clinical and Laboratory Standards Institute (CLSI, 2005).

Atividade hemolítica

A produção de hemolisina foi avaliada em ágar infusão de cérebro e coração (Becton, Dickinson and Company, Sparks, USA) suplementado com 5% de dois tipos de sangue. As cepas foram estriadas em placas de ágar sangue de carneiro e placas de ágar sangue de cavalo, e incubadas a 35 ºC/48 h (EATON; GASSON, 2001). A atividade hemolítica foi observada pela formação de halos de α-hemólise (zonas esverdeadas) e β-hemólise (zonas claras) ao redor das estrias/colônias. A ausência de atividade hemolítica foi classificada como γ-hemólise.

Produção de DNAse

Colônias isoladas de cada cepa foram inoculadas em ágar DNAse (Becton, Dickinson and Company, Sparks, USA) e incubadas a 35 ºC/48 h. Após o crescimento foi adicionado 1 mL de HCl 1N sobre as placas e observado o aparecimento de zonas claras ao redor das colônias evidenciando reação positiva (SÁNCHEZ-PORRO et al., 2003).

Produção de termonuclease

A produção de termonuclease foi avaliada de acordo com Hasan et al. (2014) com algumas modificações. Alíquotas (100 μL) de cada cepa foram inoculadas em caldo BHI, incubadas a 35 ºC/24 h e, após o crescimento, submetidas a tratamento térmico (100 ºC/20 min). Em seguida, volumes de 50 μL foram transferidos para cinco poços em ágar DNAse (1 placa para cada cepa), suplementado com 0,83% de azul de toluidina a 1% e incubadas a 35 ºC/24 h. A produção de termonuclease foi constatada pela formação de zonas de coloração rósea ao redor dos poços.

Produção de gelatinase

Colônias isoladas de cada cepa foram inoculadas em tubos com ágar gelatina nutriente (Becton, Dickinson and Company, Sparks, USA), incubadas a 35 ºC/14 dias e refrigeradas a 4 ºC/1 h. A persistência da presença de meio líquido após o período de refrigeração indicou a produção de gelatinase (hidrólise da gelatina) pelas cepas (CRUZ; TORRES, 2014).

Identificação dos isolados

Com base na característica de resistência aos antibióticos vancomicina e teicoplanina foram selecionados 10 isolados de Enterococcus para identificação. O DNA foi extraído conforme descrito por Dogan et al. (2005) e mantido a -20 ºC até o uso. A identificação das espécies E. faecium e E. faecalis foi realizada pela amplificação com os primers Fk1, Fk2, Fae1 e Fae2 (Tabela 1).

Tabela 1 Sequências dos primers e tamanho dos fragmentos dos genes avaliados por PCR 

Gene Marcador Primers Sequencia (5’ - 3’) Tamanho produto (pb) Temp. de anelamento (°C) Referencia
ddlE.faecalis E. faecalis Fk1 ATCAAGTAC AGTTAGTCTT 941 54 Dutka-Malen, Evers e Courvalin (1995)
Fk2 ACGATTCAAAGCTAACTG
ddlE.faecium E. faecium Fae1 GCAAGG CTTCTTAGAGA 550 54 Dutka-Malen; Evers; Courvalin (1995)
Fae2 CATCGTGTA AGCTAACTTC
Ace Adesinas de colageno ACE1 AAAGTAGAATTA GATCCACAC 320 50 Mannu et al. (2003)
ACE2 TCTATCACATT CGGTT GCG
As Substancias de agregajao AS1 CCAGTAATCAGTCCAGAAACAACC 406 58 Mannu et al. (2003)
AS2 TAGCTTTTTTCATTCTTGTGTTTGTT
cylM Citolisinas TE13 CTGATGGAAAGAAGATAGTAT 742 56 Eaton e Gasson (2001)
TE14 TGAGTTGGTCTGATTACATTT
cylB Citolisinas TE15 ATTCCTACCTATGTTCTGTTA 843 54 Eaton e Gasson (2001)
TE16 AATAAACTCTTCTTTTCCAAC
cylA Citolisinas TE17 T GGAT GATAGT GATAGGAAGT 517 56 Eaton e Gasson (2001)
TE18 TCTACAGTAAATCTTTCGTCA
efaA Adesinas de parede celular efaA1 CGTGAGAAAGAAAT GGAGGA 499 60 Mannu et al. (2003)
efaA2 CTACTAACACGTCACGAATG
Esp Proteinas de superficie TE34 TTGCTAATGCTAGTCCACGACC 933 65 Eaton e Gasson (2001)
TE36 GCGTCAACACTTGCATTGCCGAA
gelE Gelatinase TE9 ACCCCGTATCATTGGTTT 419 54 Eaton e Gasson (2001)
TE10 ACGCATTGCTTTTCCATC
vanA Resistencia a vancomicina VA1 CCCCTTTAACGCTAATACGATCAA 1030 52 Mannu et al. (2003)
VA2 CATGAATAGAATAAAAGTTGCAAT

As reações de PCR foram realizadas com 1 μL de DNA molde; 0,2 μM de cada primer; tampão PCR 1X; 2,0 mM de MgCl2; 0,2 mM de cada dNTP; e 1U de Taq DNA polimerase (Invitogen Life Technologies, EUA) em um volume final de 25 μL. As amplificações foram conduzidas em termociclador (Eppendorf 5345) sob as seguintes condições: 1 min a 94 ºC, 30 ciclos de 94 ºC/1 min, 54 ºC/1 min e 72 ºC/1 min, e uma etapa final a 72 ºC/10 min (DUTKA-MALEN; EVERS; COURVALIN, 1995). Os produtos da PCR foram separados em gel de agarose 1,5%, corados com SYBR® Safe (Invitrogen Life Technologies, EUA) por 15 a 20 min e visualizados em transiluminador UV (Kodak D320). As cepas E. faecalis ATCC 7080 e E. faecium ATCC 6569 foram utilizadas como controles positivos.

Pesquisa de genes codificadores de virulência

A presença de genes de virulência (ace, as, cylM, cylB, cylA, efaA, esp, gelE e vanA) foi pesquisada pela amplificação com primers específicos, conforme descrito na Tabela 1. Os seguintes microrganismos de referência foram utilizados como controle positivo: E. faecalis ATCC 29212 para os genes gelE, cylA, cylB, cylM; E.faecium 329/99 (coleção do Laboratório de Higiene - FEA/ Unicamp) para o gene vanA; E. faecalis 594 para o gene esp (MARQUES; SUZART, 2004); E. faecalis 341 para os genes ace e efaA (GOMES et al., 2008) e E. faecalis 574 para o gene as (GOMES et al., 2008).

Para amplificação dos genes ace, as, esp, efaA e vanA, as reações de PCR foram realizadas com 1 μL de DNA molde; 0,2 μM de cada primer; tampão PCR 1X; 2,0 mM de MgCl2; 0,2 mM de cada dNTP e 1U de Taq DNA polimerase (Invitrogen Life Technologies, EUA) em um volume total de 25 μL. O programa de PCR utilizado consistiu das seguintes etapas: etapa inicial de 94 ºC/1 min; 30 ciclos de 1 min a 94 ºC, 1 min à temperatura de anelamento específica para cada par de primer (Tabela 1), 1 min a 72 ºC; e uma etapa final a 72 ºC por 10 min (EATON; GASSON, 2001). Reações de multiplex PCR foram empregadas para amplificação dos pares de genes gelE/cylB e cylA/cylM. Cada reação foi realizada com 1 μL de DNA molde; 0,2 μM de cada primer; tampão PCR 1X; 2,5 mM de MgCl2; 0,2 mM de cada dNTP e 1U de Taq DNA polimerase Platinum (Invitrogen Life Technologies, EUA). As condições da PCR foram constituídas das seguintes etapas: etapa inicial a 94 ºC/3 min; 35 ciclos de 1 min a 94 ºC, 1 min à temperatura de anelamento específica para cada par de primer (Tabela 1), 1 min a 72 ºC; e uma etapa final a 72 ºC por 10 minutos (GOMES et al., 2008).

Os produtos da PCR foram separados em gel de agarose a 1,5%, corados com SYBR® Safe (Invitrogen Life Technologies, EUA) por 15 a 20 min e visualizados através de transiluminador UV (Kodak D320). As cepas que apresentaram os genes codificadores de virulência acima mencionados foram contabilizadas e os resultados expressos em termos percentuais considerando o total das 10 cepas selecionadas.

RESULTADOS E DISCUSSÃO

Susceptibilidade a antibióticos

As cepas apresentaram ampla variação quanto à susceptibilidade aos antibióticos, sendo algumas resistentes a eritromicina, norfloxacina, vancomicina, teicoplanina e tetraciclina (Tabela 2). É preocupante a elevada resistência a eritromicina (60,38%) e norfloxacina (16,98%) (Tabela 3), uma vez que esses antibióticos são largamente utilizados no tratamento de infeções bacterianas. É importante ressaltar que entre as 53 cepas avaliadas, 40 apresentaram resistência a pelo menos um dos antibióticos testados, 14 (cepas 1; 7; 11; 13; 16; 17; 21; 28; 39; 41; 44; 45; 46 e 50) foram resistentes a dois e 2 (cepas 7 e 11) resistentes a três antibióticos (Tabela 3).

Tabela 2 Susceptibilidade antimicrobiana (%) de 53 cepas de Enterococcus isoladas de queijos de Coalho artesanais 

Antibiótico Concentração (μg mL-1) Grau de sensibilidade*
Sensível (%) Intermediária (%) Resistente (%)
Ampicilina 10 100,0 0,0 0,0
Cloranfenicol 30 86,79 13,21 0,0
Eritromicina 15 11,32 28,30 60,38
Estreptomicina 300 100,0 0,0 0,0
Gentamicina 120 100,0 0,0 0,0
Norfloxacina 10 35,85 47,17 16,98
Teicoplanina 30 86,79 3,77 9,44
Tetraciclina 30 92,46 0,0 7,54
Vancomicina 30 84,90 3,77 11,33

*O grau de sensibilidade das cepas foi determinado com base nas Normas de Desempenho para Testes de Sensibilidade Antimicrobiana: 15° Suplemento Informativo, Normas Interpretativas do Teste de CIM (μg/mL-1) para Enterococcus spp. (CLSI, 2005)

Tabela 3 Resistência antimicrobiana de 40 cepas de Enterococcus isoladas de queijos de Coalho artesanais 

Antibióticos Código das cepas N° de cepas resistentes
Eritromicina 1; 3; 4; 5; 7; 8; 9; 11; 13; 15; 16; 17; 21; 22; 23; 24; 25; 27; 28; 29; 30; 32; 33; 34; 35; 32
36; 37; 38; 47; 50; 51 e 52
Norfloxacina 1; 7; 11; 13; 14; 19; 21; 28 e 50 9
Teicoplanina 39; 41; 44; 45 e 46 5
Tetraciclina 7; 11; 16 e 17 4
Vancomicina 10; 39; 41; 44; 45 e 46 6

A resistência de Enterococcus à antibióticos de uso clínico tem sido relatada em cepas isoladas de diferentes tipos de queijos (AHMADOVA et al., 2013; JAMET et al., 2012; MALEK et al., 2012; MORANDI; SILVETTI; BRASCA, 2013; YOGURTCU; TUNCER, 2013). Yogurtcu e Tuncer (2013) avaliaram 47 cepas de Enterococcus isoladas de queijo Turkish Tulum quanto à sensibilidade a antibióticos e observaram que todas as cepas apresentaram sensibilidade a ampicilina, cloranfenicol, penicilina, vancomicina e gentamicina, 8,5% delas foram resistentes a estreptomicina. No Brasil, Riboldi et al. (2009) avaliaram o perfil de resistência antimicrobiana de E. faecalis, E. faecium e Enterococcus spp. isolados de vários alimentos, incluindo queijos, e observaram fenótipos de resistência a tetraciclina, eritromicina, gentamicina, estreptomicina, ampicilina, cloranfenicol e vancomicina.

De acordo com Foulquié-Moreno et al. (2006), os antibióticos mais relevantes no tratamento de infecções causadas por Enterococcus resistentes a múltiplos antibióticos são ampicilina, vancomicina e gentamicina. No presente estudo, todas as cepas avaliadas apresentaram sensibilidade a ampicilina e gentamicina, e seis cepas foram resistentes à vancomicina (Tabela 3). Cepas de Enterococcus que abrigam fenótipos de resistência a antibióticos glicopeptídeos como teicoplanina e vancomicina são considerados patógenos emergentes (JOHANSSON; RASMUSSEN, 2013). Esses dados são um alerta para as indústrias de laticínios e as autoridades de saúde pública, uma vez que os antibióticos representam a última opção terapêutica no tratamento de infecções nosocomiais (infecções hospitalares) causadas por Enterococcus.

Produção de hemolisinas

A produção de hemolisinas foi constatada em 100% (53/53) das cepas de Enterococcus e o tipo de hemólise formado variou em função da origem do sangue utilizado no preparo do meio de cultura (Tabela 4). Em ágar sangue de carneiro a produção de α-hemolisina foi constatada em 13 cepas do total de 53 avaliadas (24,53%), enquanto que no ágar sangue de cavalo esse tipo de hemólise foi observado em apenas 5,66% (3/53) das culturas; a α-hemólise variou de 16,98% (sangue de carneiro) a 18,87% (sangue de cavalo) e a γ-hemólise de 58,49% (sangue de carneiro) a 75,54% (sangue de cavalo) (Tabela 4).

Tabela 4 Avaliação da atividade de hemolisinas em Enterococcus isolados de queijos de Coalho artesanais 

Tipos de hemólise Frequência (%)
Sangue de carneiro Sangue de cavalo
α - hemólise 24,53 (13/53) 5,66 (3/53)
β - hemólise 16,98 (9/53) 18,87 (10/53)
γ - hemólise 58,49 (31/53) 75,47 (40/53)

Moraes et al. (2012) avaliaram a produção de hemolisinas em ágar sangue de cavalo de 43 isolados de Enterococcus provenientes de leite e queijo não pasteurizado, no estado de Minas Gerais, e observaram β- hemólise em 53,5% dos isolados, embora nenhum deles tenha apresentado α-hemólise. Marguet, Vallejo e Olivera (2008) utilizaram sangue humano para avaliar a produção de hemolisinas de 10 cepas de Enterococcus provenientes de queijos produzidos com leite de ovino obtidos de uma queijaria da Patagônia, entretanto, não observaram atividade hemolítica nos isolados estudados.

Produção de DNAse, termonuclease e gelatinase

Todas as cepas de Enterococcus foram submetidas aos testes para avaliação da produção de DNAse, termonuclease e gelatinase, mas foi constatada apenas a atividade de DNAse em 3,8% (2/53) das cepas, não sendo detectada a presença das demais enzimas. Moraes et al. (2012) também avaliaram a produção de gelatinase e DNAse em 43 cepas de Enterococcus e observaram apenas a produção de gelatinase em 45% delas. Gomes et al. (2008) investigaram a produção de gelatinase por Enterococcus isolados de leite cru, leite pasteurizado, queijos, produtos cárneos e vegetais produzidos no Brasil e constataram que 18,2% das cepas avaliadas produziram gelatinase. De acordo com Lopes et al. (2006), que avaliaram a correlação da produção de gelatinase com a manutenção e conservação de cepas de Enterococcus congeladas, o congelamento parece afetar a capacidade de produção de gelatinase por essas cepas, levando a resultados negativos. Apesar de não terem sido observadas as atividades de DNAse, termonuclease e gelatinase na maioria das cepas deste estudo, esse resultado não significa que elas não apresentam o gene codificador dessas enzimas, mas que nas condições dos ensaios, elas não foram detectadas, visto que a expressão de genes é influenciada por fatores ambientais.

Detecção de genes de virulência

Foram selecionadas 10 cepas resistentes à vancomicina e teicoplanina para identificação das espécies. Apenas três bactérias foram identificadas como E. faecium (cepas 12, 40, 41) e as demais não puderam ser identificadas em nível de espécies com os pares de primers empregados, sendo identificadas apenas como Enterococcus spp.

Martín, Garriga e Aymerich (2008) compararam três métodos de identificação de espécies de Enterococcus e observaram que o DNA de algumas espécies não foi amplificado quando se empregou a técnica de PCR Multiplex com os primers descritos por Dutka-Malen, Evers e Courvalin (1995), impossibilitando a identificação. Mac et al. (2003) empregaram a técnica de PCR com primers específicos para identificação de E. faecium e encontraram pontos fracos em relação a especificidade e sensibilidade dos primes ddlE.faecium. Os microrganismos não identificados nesse trabalho serão posteriormente identificados com o emprego de outra técnica molecular, como por exemplo, o sequenciamento.

Após a identificação das espécies, foi investigada a presença de genes codificadores de virulência nas 10 cepas selecionadas (Tabela 5).

Tabela 5 Perfil de genes de virulência em Enterococcus resistentes a antibióticos do grupo dos glicopeptídeos 

Genes de virulência Marcador de virulência ----E. faecium---- ----------------Enterococcus spp.-------------- Cepas
162 190 191 157 160 161 189 194 195 196 (%)
ace Adesinas de colágeno + - - - - - + + + + 50
as Substâncias de agregação - - - - - - - - - - 0
cylA Citolisinas - - - - - - - - - - 0
cylB Citolisinas - - - - - - - - - - 0
cylM Citolisinas - - - - - - - - - - 0
efaA Adesinas de parede celular + + - - - + + + + + 70
esp Proteínas de superfície - - - - - + + + + - 40
gelE Gelatinase - - + + - + + - - - 40
vanA Resistência à vancomicina - - - - - - - - - - 0
N ° de fatores de virulência 2 1 1 1 0 3 4 3 3 2 -

O perfil de determinantes genéticos de virulência das cepas resistentes a antibióticos glicopeptídeos foi variável e a presença de pelo menos um dos genes pesquisados foi detectada em 90% das cepas (Tabela 5). O gene efaA codificador de adesinas de parede celular apresentou maior prevalência, sendo detectado em 70% das cepas, seguido do gene ace codificador de adesinas de colágeno (50%), gene esp codificador de proteínas de superfície (40%) e gene gelE codificador de gelatinase (40%). A resistência à vancomicina está relacionada a sete fenótipos de resistência (VanA, VanB, VanC, VanD, VanE, VanF, VanG e VanH), todos relacionados à operons localizados em plasmídeos ou no cromossoma. O gene vanA avaliado neste estudo está relacionado à resistência dos Enterococcus a altas concentrações de teicoplanina ou vancomicina (64 -100 mg L-1), ou seja, concentrações superiores à contida no disco de antibiótico (30μg/disco). Possivelmente devido a esse fato, não foram detectadas cepas que apresentassem o genótipo de resistência à vancomicina (COURVALIN, 2006).

A investigação da patogenicidade de Enterococcus da microbiota natural de queijos, principalmente os artesanais, é de alta relevância para a segurança microbiológica desse alimento e para a saúde pública, visto que as cepas avaliadas apresentaram vários genes codificadores de virulência.

A predominância dos genes efaA, ace e esp codificadores de adesinas de parede celular, adesinas de colágeno e proteínas de superfície em Enterococcus spp. tem sido constatada tanto em isolados de alimentos quanto de casos clínicos (FRANZ; HOLZAPFEL, 2006; MANNU et al., 2003). A produção de adesinas e de proteínas de superfície contribui para a capacidade de adesão e formação de biofilmes em superfícies abióticas, o que dificulta a inibição e/ou eliminação de cepas potencialmente virulentas das superfícies.

CONCLUSÃO

Enterococcus isolados da microbiota de queijo de Coalho apresentam determinantes fenotípicos de virulência como atividade hemolítica e resistência a antibióticos de uso clínico como eritromicina, norfloxacina, teicoplanina, tetraciclina e vancomicina. O perfil de determinantes genéticos de virulência foi bastante variável e foi constatado que 90% das cepas investigadas abrigavam pelo menos um dos nove genes pesquisados. O gene efaA apresentou maior prevalência, seguido dos genes ace, esp e gelE.

1Pesquisa financiada pelo Conselho Nacional de Desenvolvimento Científico e Tecnológico-CNPq

AGRADECIMENTOS

Os autores agradecem ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) pelo financiamento do projeto 476649/2008-0.

REFERÊNCIAS

AHMADOVA, A. et al. Evaluation of antimicrobial activity, probiotic properties and safety of wild strain Enterococcus faecium AQ71 isolated from Azerbaijani Motal cheese. Food Control, v. 30, n. 2, p. 631-641, 2013. [ Links ]

CLINICAL AND LABORATORY STANDARDS INSTITUTE. Normas de desempenho para testes de sensibilidade antimicrobiana: 15º suplemento informativo. Pennsylvania, 2005. (Document, M100-S15). Disponível em: <http://www.anvisa.gov.br/servicosaude/manuais/clsi/clsi_OPASM100S15.pdf>. Acesso em: 03 jul. 2014. [ Links ]

CLINICAL AND LABORATORY STANDARDS INSTITUTE. Padronização dos testes de sensibilidade a antimicrobianos por disco-difusão: norma aprovada - oitava edição. Pennsylvania, 2003. (CLSI Document, M2-A8). Disponível em: <http://www.anvisa.gov.br/servicosaude/manuais/clsi/clsi_OPASM2-A8.pdf>. Acesso em: 19 ago. 2014. [ Links ]

COURVALIN, P. Vancomycin resistance in Gram-positive cocci. Clinical Infectious Diseases, v. 42, n. 1, p. 25-34, 2006. [ Links ]

CRUZ, T. E. E.; TORRES, J. M. O. Gelatin hydrolysis test protocol. Washington: Microbial Library American Society for Microbiology, 2012. Disponível em: <http://www.microbelibrary.org/library/laboratory-test/3776-gelatin-hydrolysis-test-protocol>. Acesso em: 19 ago. 2014. [ Links ]

DOGAN, B. et al. Distribution of serotypes and antimicrobial resistance genes among Streptococcus agalactiae isolates from bovine and human hosts. Journal of Clinical Microbiology, v. 43, n. 12, p. 5899-5906, 2005. [ Links ]

DOLCI, P. et al. Microbiological characterization of artisanal Raschera PDO cheese: analysis of its indigenous lactic acid bacteria. Food Microbiology, v. 25, n. 2, p. 392-399, 2008. [ Links ]

DUTKA-MALEN, S; EVERS, S; COURVALIN, P. Detection of glycopeptide resistance genotypes and identifications the species level of clinically relevant enterococci by PCR. Journal of Clinical Microbiology, v. 33, n. 1, p. 24-27, 1995. [ Links ]

EATON, T. J.; GASSON, M. J. Molecular screening of Enterococcus virulence determinants and potential genetic exchange between food and medical isolates. Applied and Environmental Microbiology, v. 67, n. 4, p. 1628-1635, 2001. [ Links ]

FOULQUIÉ-MORENO, M. R. et al. The role and application of enterococci in food and health. International Journal of Food Microbiology, v. 106, n. 1, p. 1-24, 2006. [ Links ]

FRANZ, C. M. A. P.; HOLZAPFEL, W. H. Enterococci. In: MOTARJEMI, Y.; ADAMS, M. Emerging foodborne pathogens. New York: CRC Press, 2006. cap. 20, p. 557 - 613. [ Links ]

GOMES, B. C. et al. Prevalence and characterization of Enterococcus spp. isolated from Brazilian foods. Food Microbiology, v. 25, n. 5, p. 668-675, 2008. [ Links ]

HASAN, A. A. et al. Molecular and biochemical identification of coagulase positive Staphylococcus species isolated from human and animal sources in Jordan. International Journal of Medicine and Medical Sciences, v. 47, n. 1, p. 1491-1507, 2014. [ Links ]

JAMET, E. et al. Prevalence and characterization of antibiotic resistant Enterococcus faecalis in French cheeses. Food Microbiology, v. 31, n. 2, p. 191-198, 2012. [ Links ]

JOHANSSON, D; RASMUSSEN, M. Virulence factors in isolates of Enterococcus faecalis from infective endocarditis and from the normal flora. Microbial Pathogenesis, v. 55, p. 28-31, 2013. [ Links ]

LIST OF PROKARYOTIC NAMES WITH STANDING IN NOMENCLATURE. 1998. Disponível em: <http://www.bacterio.net/-allnames.html>. Acesso em: 20 jan. 2015. [ Links ]

LOPES, M. F. S. et al. Activity and expression of a virulence factor, gelatinase, in dairy enterococci. International Journal of Food Microbiology, v. 112, n. 3, p. 208-214, 2006. [ Links ]

MAC, K. et al. Species identification and detection of vancomycin resistance genes in enterococci of animal origin by multiplex PCR. International Journal of Food Microbiology, v. 88, n. 2-3, p. 305-309, 2003. [ Links ]

MALEK, R. et al. Technological and safety properties display biodiversity among enterococci isolated from two Egyptian cheeses, "Ras" and "Domiati". International Journal of Food Microbiology, v. 153, n. 3, p. 314-322, 2012. [ Links ]

MANNU, L. et al. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcusfaecium strains of dairy, animal and clinical origin. International Journal of Food Microbiology, v. 88, n. 2-3, p. 291-304, 2003. [ Links ]

MARGUET, E. R.; VALLEJO, M.; OLIVERA, N. L. Factores de virulencia de cepas de Enterococcus aisladas de quesos ovinos. Acta Bioquímica Clínica Latinoamericana, v. 42, n.4, p. 543-548, 2008. [ Links ]

MARQUES; E. B.; SUZART, S. Occurrence of virulence-associated genes in clinical Enterococcusfaecalis strains isolated in Londrina, Brazil. Journal of Medical Microbiology, v. 53, n. 11, p. 1069-1073, 2004. [ Links ]

MARTÍN, B.; GARRIGA, M.; AYMERICH, M. Identification of Enterococcus species by melting curve analysis of restriction fragments. Journal of Microbiological Methods, v. 75 n. 1, p. 145-147, 2008. [ Links ]

MORAES, P. M. et al. Bacteriocinogenic and virulence potential of Enterococcus isolates obtained from raw milk and cheese. Journal of Applied Microbiology, v. 113, n. 2, p. 318-328, 2012. [ Links ]

MORANDI, S.; SILVETTI, T.; BRASCA, M. Biotechnological and safety characterization of Enterococcus lactis, a recently described species of dairy origin. Antonie Van Leeuwenhoek, v. 103, n.1, p. 239-249, 2013. [ Links ]

MOURA, R. A consolidação do queijo de coalho. Agroindústria Tropical, n. 140, p. 5-12, 2012. [ Links ]

RIBOLDI, G. P. et al. Antimicrobial resistance profile of Enterococcus spp. isolated from food in southern Brazil. Brazilian Journal of Microbiology, v. 40, n. 1, p. 125-128, 2009. [ Links ]

SÁNCHEZ-PORRO, C. et al. Diversity of moderately halophilic bacteria producing extracellular hydrolytic enzymes. Journal Applied Microbiology, v. 94, n. 2, p. 295-300, 2003. [ Links ]

SANTOS, K. M. O. et al. Brazilian artisanal cheeses as a source of beneficial Enterococcusfaecium strains: characterization of the bacteriocinogenic potential. Annals of Microbiology, v. 64, n. 4, p. 1463-1471, 2014. [ Links ]

YOGURTCU, N. N.; TUNCER, Y. Antibiotic susceptibility patterns of Enterococcus strains isolated from Turkish Tulum cheese. International Journal of Dairy Technology, v. 66, n. 2, p. 236-242, 2013. [ Links ]

Recebido: 18 de Março de 2015; Aceito: 08 de Setembro de 2015

* Autor para correspondência

Creative Commons License Este é um artigo publicado em acesso aberto (Open Access) sob a licença Creative Commons Attribution, que permite uso, distribuição e reprodução em qualquer meio, sem restrições desde que o trabalho original seja corretamente citado.