Open-access Toward a phylogenetic reclassification of the subfamily Ambavioideae (Annonaceae): establishment of a new subfamily and a new tribe

ABSTRACT

A molecular phylogeny of the subfamily Ambavioideae (Annonaceae) was reconstructed using up to eight plastid DNA regions (matK, ndhF, and rbcL exons; trnL intron; atpB-rbcL, psbA-trnH, trnL-trnF, and trnS-trnG intergenic spacers). The results indicate that the subfamily is not monophyletic, with the monotypic genus Meiocarpidium resolved as the second diverging lineage of Annonaceae after Anaxagorea (the only genus of Anaxagoreoideae) and as the sister group of a large clade consisting of the rest of Annonaceae. Consequently, a new subfamily, Meiocarpidioideae, is established to accommodate the enigmatic African genus Meiocarpidium. In addition, the subfamily Ambavioideae is redefined to contain two major clades formally recognized as two tribes. The tribe Tetramerantheae consisting of only Tetrameranthus is enlarged to include Ambavia, Cleistopholis, and Mezzettia; and Canangeae, a new tribe comprising Cananga, Cyathocalyx, Drepananthus, and Lettowianthus, are erected. The two tribes are principally distinguishable from each other by differences in monoploid chromosome number, branching architecture, and average pollen size (monads). New relationships were retrieved within Tetramerantheae, with Mezzettia as the sister group of a clade containing Ambavia and Cleistopholis.

Keywords:
Annonaceae; Ambavioideae; Meiocarpidium; molecular phylogeny; systematics; taxonomy

Introduction

Annonaceae, a pantropical family of flowering plants prominent in lowland rainforests, consist of 110 genera (Guo et al. 2017; Chaowasku et al. 2018a; b; Xue et al. 2018) and approximately 2430 species (Chatrou et al. 2018). The family has been classified into four subfamilies, viz., Anaxagoreoideae, Ambavioideae, Annonoideae, and Malmeoideae; the last two subfamilies, which constitute the majority of generic and species diversity in the family, have each been further subdivided into tribes (Chatrou et al. 2012). Two additional tribes in Malmeoideae have been subsequently proposed (Guo et al. 2017; Couvreur et al. 2019). Every subfamily received unequivocally and consistently strong molecular support except the subfamily Ambavioideae, which is composed of nine genera: Ambavia, Cananga, Cleistopholis, Cyathocalyx, Drepananthus, Lettowianthus, Meiocarpidium, Mezzettia, and Tetrameranthus (e.g., Surveswaran et al. 2010; Chatrou et al. 2012; Guo et al. 2017; Couvreur et al. 2019). The monotypic Meiocarpidium endemic to Africa is a phylogenetically problematic genus because it was identified as the sister group of a clade composed of the remaining genera of Ambavioideae, but with only moderate to no support in certain analyses (Guo et al. 2017), which is in contrast to the analyses presented by Surveswaran et al. (2010), Chatrou et al. (2012), and Xue et al. (2018), yielding rather strong support. Further, in an analysis using a targeted enrichment of nuclear genes by Couvreur et al. (2019), this genus was either weakly supported as the sister group of the remaining Ambavioideae genera or moderately supported as the sister group of Annonaceae excluding Anaxagoreoideae and other Ambavioideae members.

The primary aim of the present study is, therefore, to re-elucidate the position of Meiocarpidium by sequencing two and three additional plastid regions of this genus compared to Chatrou et al. (2012) and Guo et al. (2017), respectively. In addition, more plastid regions are also sequenced for representatives of Mezzettia, Cyathocalyx, and Drepananthus in order to gain deeper insights into relationships of particular clades in Ambavioideae, i.e., the Ambavia-Cleistopholis-Mezzettia and Cananga-Cyathocalyx-Drepananthus clades. It is worthy of notice that the relationships in the latter clade have been controversial since Cyathocalyx was found to be the sister group of Drepananthus in one study (Guo et al. 2017), whereas Cananga and Drepananthus were recovered as sister genera in another study (Xue et al. 2018).

Materials and methods

Character and taxon sampling (see List S1 in supplementary materials, for a list of taxa, voucher information, and GenBank accession number)

Twenty-four accessions comprised the ingroup, with three representatives of Annonoideae, four representatives of Malmeoideae, and 17 representatives of Ambavioideae covering all currently accepted genera in this subfamily. At least two accessions or species per genus were included for Cananga, Cyathocalyx, Drepananthus, Meiocarpidium, and Mezzettia. Two species of Anaxagorea (the only genus of Anaxagoreoideae) were assigned as outgroups because this subfamily has always been recovered as the sister group of a consistently strongly supported clade comprising the remaining subfamilies of Annonaceae (e.g., Chatrou et al. 2012; Guo et al. 2017). Up to eight plastid regions (matK, ndhF, and rbcL exons; trnL intron; atpB-rbcL, psbA-trnH, trnL-trnF, and trnS-trnG intergenic spacers) were included in this study. Seventy-seven sequences were newly produced for the present study; the remaining sequences were taken from GenBank. There were some missing data in the following accessions (see List S1 in supplementary materials): Ambavia gerrardii (Baill.) Le Thomas, Lettowianthus stellatus Diels, Tetrameranthus duckei R.E.Fr., and one specimen of Meiocarpidium oliverianum (Baill.) D.M.Johnson & N.A.Murray (M. oliverianum is the same species as the well-known M. lepidotum (Oliv.) Engl. & Diels; the basionym of the former was published before the basionym of the latter; see Johnson & Murray 2018).

DNA extraction, amplification, and sequencing

All methods for DNA extraction, amplification, and sequencing used in the present study were the same as those described in Chaowasku et al. (2018a; b; 2020). For plastid regions not included in Chaowasku et al. (2018a; b; 2020), their primer sequences for the amplification and sequencing were obtained from Hoot et al. (1995) and Scharaschkin & Doyle (2005) for atpB-rbcL intergenic spacer, with internal primers newly designed for the present study: ATPB-RBCL-INT-A (5’- GGATGCTGAAATAAAGAACAACAGCC -3’) and ATPB-RBCL-INT-B (5’- GGCTGTTGTTCTTTATTTCAGCATCC -3’); and Hamilton (1999) for trnS-trnG intergenic spacer, with internal primers newly designed for the present study: TRNSG-NEW-F-SHORT (5’- CCTCTTTGATTCCGTACGAAAGG -3’), TRNSG-NEW-R (5’- GTCGAATAAGCGAATGAGACG -3’), and TRNSG-INT-R-SHORT (5’- GGAATGGAAATAGCCTTTGTCAC -3’).

Phylogenetic analyses

Sequences were edited using the Staden package [http://staden.sourceforge.net] (Staden et al. 2000) and then aligned by Multiple Alignment using Fast Fourier Transform (MAFFT; Katoh et al. 2002) via an online platform (Katoh et al. 2017), with default settings. The aligned matrix was subsequently checked and manually adjusted (where necessary) using the similarity criterion (Simmons 2004). In total, 7,149 aligned nucleotide plus twelve binary-coded indel characters were included. Following Simmons & Ochoterena (2000), the simple coding method for the binary indel characters was implemented, with the focus on non-autapomorphic and less homoplasious indel structures. A 15 base-pair inversion is present in certain accessions in the psbA-trnH intergenic spacer and was complementarily reversed to be homologically alignable to the remaining accessions, following Pirie et al. (2006). The phylogenetic trees were rooted by specifying the two Anaxagorea species as outgroups.

Parsimony analysis was performed in TNT version 1.5 (Goloboff & Catalano 2016). All characters were equally weighted and unordered. Incongruence among regions was assessed by performing an analysis for each region to see if there was any significant conflict in clade support (e.g., Wiens 1998). Most parsimonious trees were generated by a heuristic search of the combined data, with 9,000 replicates of random sequence addition, saving 10 trees per replicate, and using the tree bisection and reconnection (TBR) branch-swapping algorithm. Clade support was evaluated by symmetric resampling (SR; Goloboff et al. 2003). A default change probability was used. One hundred thousand replicates were run, each with five replicates of random sequence addition, saving five trees per replicate. A clade with SR ≥ 85 %, 70-84 %, or 50-69 % was considered strongly, moderately, or weakly supported, respectively.

Maximum likelihood analysis was accomplished in IQ-TREE version 1.6.10 (Nguyen et al. 2015) under partition models (Chernomor et al. 2016) performed with the “-spp” command, whereas Bayesian Markov chain Monte Carlo (MCMC; Yang & Rannala 1997) phylogenetic analysis was implemented in MrBayes version 3.2.7a (Ronquist et al. 2012). Both methods were analyzed via the CIPRES Science Gateway version 3.3 (Miller et al. 2010). The data matrix was divided into seven partitions based on identity of DNA region (the trnL intron and adjacent trnL-trnF intergenic spacer were combined as a single partition) plus a binary-coded indel partition. The most suitable model of sequence evolution for each DNA partition was selected by Akaike Information Criterion (AIC; Akaike 1974) scores, using FindModel [http://www.hiv.lanl.gov/content/sequence/findmodel/findmodel.html] (Posada & Crandall 1998). The General Time Reversible (GTR; Tavaré 1986) nucleotide substitution model with a gamma distribution for among-site rate variation was selected for all seven DNA partitions (atpB-rbcL, matK , ndhF, psbA-trnH, rbcL, trnLF [= trnL intron + trnL-trnF intergenic spacer], and trnS-trnG). In the maximum likelihood analysis, the model “JC2+FQ+ASC” was selected by corrected AIC scores for the binary indel partition. Clade support was measured by non-parametric bootstrap resampling method (BS; Felsenstein 1985) with 2,000 replicates. A clade with BS ≥ 85 %, 70-84 %, or 50-69 % was considered strongly, moderately, or weakly supported, respectively.

In the Bayesian analysis, the “coding=variable” setting was implemented for the binary indel partition, which was performed under a simple F81-like model without a gamma distribution for among-site rate variation. Four independent analyses, each using four MCMC chains, were simultaneously run; each run was set for 10 million generations. The default prior settings were used except for the prior parameter of rate multiplier (“ratepr” [=variable]). The temperature parameter was set to 0.08. Trees and all parameter values were sampled every 1,000th generation. Convergence was assessed by checking the standard deviation of split frequencies of the runs with values < 0.01 interpreted as indicating a good convergence and by checking for adequate effective sample sizes (ESS > 200) using Tracer version 1.6 (Rambaut et al. 2013). The first 25 % of all trees sampled were discarded as burn-in, and the 50 % majority-rule consensus tree was built from the remaining trees. A clade with posterior probabilities (PP) ≥ 0.95, 0.9-0.94, or 0.5-0.89 was considered strongly supported, weakly supported, or unsupported, respectively.

Results

The parsimony analysis resulted in six most parsimonious trees with 2,506 steps. The consistency (CI) and retention (RI) indices were 0.81 and 0.84, respectively. There were no strong conflicts (SR ≥ 85 %) among the analyses of different plastid regions. Figure 1 shows a 50 % majority-rule consensus tree derived from the Bayesian analysis, with corresponding support values from the other two analyses, parsimony and maximum likelihood, whereas Figure 2 depicts a phylogram derived from the maximum likelihood analysis and a strict consensus cladogram obtained from the parsimony analysis. The ingroup, comprising Ambavioideae, Annonoideae, and Malmeoideae, was recovered as a monophyletic group with maximum support. Two accessions of Meiocarpidium oliverianum were retrieved as a maximally supported clade, which was the sister group of a moderately to strongly supported clade (SR 99 %, BS 78 %, PP 0.97) composed of the remaining ingroup accessions: Annonoideae (three accessions), Malmeoideae (four accessions), and the rest of Ambavioideae (15 accessions). The three accessions of Annonoideae, four of Malmeoideae, and 15 of the remaining Ambavioideae were each recovered as a maximally supported clade, with the last one being the sister group of a strongly supported clade (SR 99 %, BS 98 %, PP 1) comprising Annonoideae and Malmeoideae accessions.

Figure 1
50 % majority-rule consensus phylogram derived from Bayesian inference of combined eight plastid DNA regions. Bayesian posterior probabilities (PP) indicated on the right; maximum likelihood bootstrap (BS) percentages in the middle; parsimony symmetric resampling (SR) percentages on the left; scale bar unit = substitutions per site.

Figure 2
A. Phylogram derived from maximum likelihood analysis, with maximum likelihood bootstrap (BS) percentages shown for a clade absent in Figure 1; scale bar unit = substitutions per site. B. Strict consensus cladogram obtained from parsimony analysis.

In the 15-accession clade of Ambavioideae, two major clades can be identified: 1) a maximally supported clade consisting of Cananga, Cyathocalyx, Drepananthus, and Lettowianthus; and 2) a strongly supported clade (SR 99 %, BS 100 %, PP 1) comprising Ambavia, Cleistopholis, Mezzettia, and Tetrameranthus. In the former clade, Lettowianthus was the sister group of a strongly supported clade (SR 99 %, BS 100 %, PP 1) embracing Cananga, Cyathocalyx, and Drepananthus. Each of these three genera was monophyletic with maximum support, but their relationships were completely unresolved. In the Ambavia-Cleistopholis-Mezzettia-Tetrameranthus clade, Tetrameranthus was retrieved as the sister group of a strongly supported clade (SR 96 %, BS 97 %, PP 1) comprising Ambavia, Cleistopholis, and Mezzettia. Mezzettia was then the sister group of a moderately to strongly supported clade (SR 94 %, BS 75 %, PP 0.98) consisting of Ambavia and Cleistopholis.

Discussion

With more plastid DNA sequenced, the Ambavioideae topology has changed. Apart from Anaxagoreoideae, Meiocarpidium is sister to a well-supported clade embracing all other members of Annonaceae (Fig. 1). Given this new topology and the previously reported negligible support for Meiocarpidium as the sister group of the remaining Ambavioideae (Guo et al. 2017; Couvreur et al. 2019), maintaining Meiocarpidium in Ambavioideae is inappropriate. In phylogenetic systematics, the most pivotal element for delimiting a taxon is well-supported monophyly and in this case Meiocarpidium should be reclassified in its own subfamily because all other genera in the family have been assigned to subfamilies. Therefore, a new subfamily accommodating this African monotypic genus is proposed below. Meiocarpidium becomes the second diverging lineage of Annonaceae after Anaxagorea. The genus is easily identifiable because of the possession of lepidote indumentum (e.g., Heusden 1992; Keßler 1993), which is rarely found elsewhere in the family (i.e., in Duguetia; Maas et al. 2003). Several palynological features, especially the obvious intine extrusion (Thomas 1980; 1981; Hesse et al. 1985), have suggested that Meiocarpidium may be placed phylogenetically somewhere near Anaxagorea. Apart from Meiocarpidium and Anaxagorea, the more or less bulging intine also occurs in several other genera of Malmeoideae exhibiting a monosulcate pollen, e.g., Bocageopsis, Malmea, Unonopsis (Waha 1985); Maasia (Waha & Hesse 1988); Mwasumbia (Couvreur et al. 2009); and Dendrokingstonia, Monocarpia (Chaowasku et al. 2012). Further research is required to ascertain if the monosulcate pollen of all other genera of Annonaceae really does not exhibit a bulging intine. The lack of intine extrusion could be due to immature material or unsuitable methodology of pollen preparation.

Meiocarpidioideae Chaowasku subfam. nov.

Type genus: Meiocarpidium Engl. & Diels

Trees or shrubs, with distichous arrangement of both leaves and lateral branches; indumentum of lepidote (sometimes stellate) hairs; inflorescences 1- or few-flowered, terminal; flowers bisexual, both petal whorls of ± equal size; staminal connective apex truncate and dilated; carpels free in flower and fruit; ovules many, with lateral placentation; monocarps subsessile, monocarp abscission basal; aril absent; endosperm ruminations lamelliform; middle seed integument present.

Genus included: Meiocarpidium

The maximally supported Ambavioideae excluding Meiocarpidium are recircumscribed herein as Ambavioideae sensu stricto, containing eight genera (Fig. 1): Cananga, Cyathocalyx, Drepananthus, and Lettowianthus in a maximally supported clade; Ambavia, Cleistopholis, Mezzettia, and Tetrameranthus in another clade with strong support. The latter clade corresponds to the “ambavioid” clade previously coined and defined by Doyle & Thomas (1996) and Thomas & Doyle (1996), which differs greatly from the former clade (“canangoid” clade sensuSurveswaran et al. 2010), e.g., in monoploid chromosome number (x = 7 in members of the “ambavioid” clade vs. x = 8 in members of the “canangoid” clade [karyological data of Lettowianthus are unknown]; Okada & Ueda 1984; Morawetz 1986; Morawetz & Thomas 1988), branching architecture (distichous arrangement of lateral branches in members of the “ambavioid” clade [except Tetrameranthus, which has spirally arranged leaves and lateral branches unique in the family] vs. spiral arrangement of lateral branches in members of the “canangoid” clade; Johnson 2003; Westra & Maas 2012; pers. obs. for Ambavia, Drepananthus, and Mezzettia), and average pollen size (monads: small [< 45 μm] in members of the “ambavioid” clade vs. medium [45-90 μm] to large [> 90 μm] in members of the “canangoid” clade; Surveswaran et al. 2010; Doyle & Thomas 2012). Consequently, each clade deserves formal recognition and a new tribe is proposed for the “canangoid” clade, whereas the monotypic tribe Tetramerantheae is enlarged to include the other three genera in the “ambavioid” clade. Table 1 summarizes the chief differences between the two tribes of the recircumscribed Ambavioideae.

Table 1
Chief differences between two tribes, Tetramerantheae descr. emend. and Canangeae tribus nov., of recircumscribed Ambavioideae.

Ambavioideae Chatrou, Pirie, Erkens & Couvreur descr. emend.

Type genus: Ambavia Le Thomas

Trees or shrubs, with distichous or spiral arrangement of both leaves and lateral branches, or with distichous arrangement of leaves and spiral arrangement of lateral branches; indumentum of simple or stellate hairs; inflorescences 1- to many-flowered, terminal or axillary; flowers bisexual, both petal whorls of ± equal size or inner one being (much) smaller; staminal connective apex truncate and dilated, sometimes tongue-shaped, ± conical, or apiculate; carpels free in flower and fruit; ovules 2 to many, with lateral placentation; monocarps (sub)sessile or stipitate, monocarp abscission basal or apical; aril sometimes present; endosperm ruminations irregular to ± flattened peg-like, stout or not; middle seed integument present (unknown in Ambavia).

Genera included: Ambavia, Cananga, Cleistopholis, Cyathocalyx, Drepananthus, Lettowianthus, Mezzettia, and Tetrameranthus

Tetramerantheae R.E.Fr. ex Reveal descr. emend.

Type genus: Tetrameranthus R.E.Fr.

Trees or shrubs, with distichous or spiral arrangement of both leaves and lateral branches; indumentum of simple or stellate hairs; inflorescences 1- to several-flowered, usually umbel-like when multi-flowered, axillary; flowers bisexual, both petal whorls of ± equal size or inner one being (much) smaller; staminal connective apex truncate and dilated, sometimes tongue-shaped or ± conical; carpels free in flower and fruit; ovules 2(-3), with lateral placentation; monocarps (sub)sessile or stipitate, monocarp abscission basal or apical; aril absent; endosperm ruminations irregular, stout; monoploid chromosome number x = 7; with small (< 45 µm) average pollen size [monads].

Genera included: Ambavia, Cleistopholis, Mezzettia, and Tetrameranthus

Canangeae Chaowasku tribus nov.

Type genus: Cananga (Dunal) Hook.f. & Thomson

Trees or shrubs, with distichous arrangement of leaves and spiral arrangement of lateral branches; indumentum of simple or stellate hairs; inflorescences 1- to many-flowered, terminal or axillary; flowers bisexual, both petal whorls of ± equal size; staminal connective apex truncate and dilated, sometimes apiculate; carpels free in flower and fruit; ovules 2 to many, with lateral placentation; monocarps (sub)sessile or stipitate, monocarp abscission basal or apical; aril sometimes present; endosperm ruminations ± irregular to ± flattened peg-like, sometimes stout; monoploid chromosome number x = 8 (unknown in Lettowianthus); with medium (45-90 µm) to large (> 90 µm) average pollen size [monads].

Genera included: Cananga, Cyathocalyx, Drepananthus, and Lettowianthus

It is noteworthy that all genera in Tetramerantheae possess irregular and stout endosperm ruminations (Setten & Koek-Noorman 1992). However, this trait is present in Lettowianthus of Canangeae as well, but there are also elements exhibiting more or less flattened peg-like with a dilated apex as observed in Cananga, Cyathocalyx, and Drepananthus (Setten & Koek-Noorman 1992). With more plastid regions sequenced, the phylogenetic relationships within the Cananga-Cyathocalyx-Drepananthus clade of Canangeae have become unresolved (Fig. 1), clearly necessitating further inclusion of more variable plastid and/or nuclear DNA sequences.

The presence of lamelliform endosperm ruminations in Meiocarpidioideae has some implications on the evolution of this trait in Annonaceae as discussed in Pirie & Doyle (2012); however, detailed comparisons with the lamelliform endosperm ruminations of Malmeoideae and Annonoideae genera should be conducted to verify whether they are homologous before performing any character evolutionary analyses. It would also be interesting to understand the evolution of a middle seed integument, whether it has originated independently several times (in Meiocarpidioideae, Ambavioideae, some genera and species of Malmeoideae, and a species of Artabotrys [Annonoideae]) or has originated in the common ancestor of the Meiocarpidioideae-Ambavioideae-Malmeoideae-Annonoideae clade, been lost in the Malmeoideae-Annonoideae clade, and then gained in some genera and species of Malmeoideae, plus a species of Artabotrys (Christmann 1989).

The well-supported phylogenetic relationships of Tetramerantheae in the present study reveal that Ambavia is the sister group of Cleistopholis, and a clade comprising Ambavia and Cleistopholis is then the sister group of Mezzettia (Fig. 1). This is in contrast to the previously reported phylogenetic hypotheses, i.e., Mezzettia was the sister group of Ambavia, and a clade uniting these two genera was the sister group of Cleistopholis (e.g., Surveswaran et al. 2010; Guo et al. 2017). As a consequence, there definitely are biogeographic implications, especially in the likely older split of Asian (Mezzettia) and Afro-Malagasy (Cleistopholis-Ambavia) lineages (see Thomas et al. 2015 for more details).

Acknowledgements

I would like to thank the curators/directors of CMUB and WAG (now under Naturalis, The Netherlands) herbaria for the material studied. Kithisak Aongyong and Maxim Nuraliev provided useful specimens for this study. Anissara Damthongdee and Hathaichanok Jongsook assisted with some laboratory works. This study was financially supported by the Thailand Research Fund (TRG5880118), IAPT Research Grants Program in Plant Systematics 2013, and Chiang Mai University. James Doyle and an anonymous reviewer considerably improved an earlier draft of this article.

References

  • Akaike H. 1974. A new look at the statistical model identification. IEEE Transactions of Automatic Control 19: 716-723.
  • Chaowasku T, Aongyong K, Damthongdee A, Jongsook H, Johnson DM. 2020. Generic status of Winitia (Annonaceae, Miliuseae) reaffirmed by molecular phylogenetic analysis, including a new species and a new combination from Thailand. European Journal of Taxonomy 659: 1-23.
  • Chaowasku T, Damthongdee A, Jongsook H, et al 2018a. Enlarging the monotypic Monocarpieae (Annonaceae, Malmeoideae): Recognition of a second genus from Vietnam informed by morphology and molecular phylogenetics. Candollea 73: 261-275.
  • Chaowasku T, Damthongdee A, Jongsook H, et al 2018b. Genus Huberantha (Annonaceae) revisited: Erection of Polyalthiopsis, a new genus for H. floribunda, with a new combination H. luensis Annales Botanici Fennici 55: 121-136.
  • Chaowasku T, Keßler PJA, Ham RWJM. 2012. A taxonomic revision and pollen morphology of the genus Dendrokingstonia (Annonaceae). Botanical Journal of the Linnean Society 168: 76-90.
  • Chatrou LW, Pirie MD, Erkens RHJ, et al 2012. A new subfamilial and tribal classification of the pantropical flowering plant family Annonaceae informed by molecular phylogenetics. Botanical Journal of the Linnean Society 169: 5-40.
  • Chatrou LW, Turner IM, Klitgaard BB, Maas PJM, Utteridge TMA. 2018. A linear sequence to facilitate curation of herbarium specimens of Annonaceae. Kew Bulletin 73: 39. doi: 10.1007/S12225-018-9764-3
    » https://doi.org/10.1007/S12225-018-9764-3
  • Chernomor O, Haeseler A, Minh BQ. 2016. Terrace aware data structure for phylogenomic inference from supermatrices. Systematic Biology 65: 997-1008.
  • Christmann M. 1989. Die tritegmischen Annonaceen-samen. Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 110: 433-439.
  • Couvreur TLP, Ham RWJM, Mbele YM, Mbago FM, Johnson DM. 2009. Molecular and morphological characterization of a new monotypic genus of Annonaceae, Mwasumbia, from Tanzania. Systematic Botany 34: 266-276.
  • Couvreur TLP, Helmstetter AJ, Koenen EJM, et al 2019. Phylogenomics of the major tropical plant family Annonaceae using targeted enrichment of nuclear genes. Frontiers in Plant Science 9: 1941. doi: 10.1007/S12225-018-9764-3
    » https://doi.org/10.1007/S12225-018-9764-3
  • Doyle JA, Thomas AL. 1996. Phylogenetic analysis and character evolution in Annonaceae. Adansonia 18: 279-334.
  • Doyle JA, Thomas AL. 2012. Evolution and phylogenetic significance of pollen in Annonaceae. Botanical Journal of the Linnean Society 169: 190-221.
  • Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783-791.
  • Goloboff PA, Catalano SA. 2016. TNT version 1.5, including a full implementation of phylogenetic morphometrics. Cladistics 32: 221-238.
  • Goloboff PA, Farris JS, Källersjö M, Oxelman B, Ramirez MJ, Szumik CA. 2003. Improvements to resampling measures of group support. Cladistics 19: 324-332.
  • Guo X, Tang CC, Thomas DC, Couvreur TLP, Saunders RMK. 2017. A mega-phylogeny of the Annonaceae: Taxonomic placement of five enigmatic genera and recognition of a new tribe, Phoenicantheae. Scientific Reports 7: 7323. doi: 10.1038/s41598-017-07252-2
    » https://doi.org/10.1038/s41598-017-07252-2
  • Hamilton MB. 1999. Four primer pairs for the amplification of chloroplast intergenic regions with intraspecific variation. Molecular Ecology 8: 521-523.
  • Hesse M, Morawetz W, Ehrendorfer F. 1985. Pollen ultrastructure and systematic affinities of Anaxagorea (Annonaceae) . Plant Systematics and Evolution 148: 253-285.
  • Heusden ECH. 1992. Flowers of Annonaceae: Morphology, classification, and evolution. Blumea Supplement 7: 1-218.
  • Hoot SB, Alastair C, Crane PR. 1995. The utility of atpB gene sequences in resolving phylogenetic relationships: Comparison with rbcL and 18S ribosomal DNA sequences in Lardizabalaceae. Annals of the Missouri Botanical Garden 82: 194-207.
  • Johnson DM, Murray NA. 2018. A revision of Xylopia L. (Annonaceae): The species of Tropical Africa. PhytoKeys 97: 1-252.
  • Johnson DM. 2003. Phylogenetic significance of spiral and distichous architecture in the Annonaceae . Systematic Botany 28: 503-511.
  • Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059-3066.
  • Katoh K, Rozewicki J, Yamada KD. 2017. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20: 1160-1166.
  • Keßler PJA. 1993. Annonaceae. In: Kubitzki K, Rohwer JG, Bittrich V. (eds.) The families and genera of vascular plants. Vol. II. Berlin, Springer Verlag. p. 93-129.
  • Maas PJM, Westra LYT, Chatrou LW, Collaborators . 2003. Duguetia (Annonaceae). Flora Neotropica, Monograph 88: 1-274.
  • Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: Miller MA, Pfeiffer W, Schwartz T. (eds.) Proceedings of the Gateway Computing Environments Workshop (GCE). Piscataway, NJ, IEEE. p. 45-52.
  • Morawetz W, Thomas AL. 1988. Karyology and systematics of the genus Ambavia and other Annonaceae from Madagascar. Plant Systematics and Evolution 158: 155-160.
  • Morawetz W. 1986. Systematics and karyoevolution in Magnoliidae: Tetrameranthus as compared with other Annonaceae genera of the same chromosome number. Plant Systematics and Evolution 154: 147-173.
  • Nguyen LT, Schmidt HA, Haeseler A, Minh BQ. 2015. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32: 268-274.
  • Okada H, Ueda K. 1984. Cytotaxonomical studies on Asian Annonaceae. Plant Systematics and Evolution 144: 165-177.
  • Pirie MD, Chatrou LW, Mols JB, Erkens RHJ, Oosterhof J. 2006. ‘Andean-centred’ genera in the short-branch clade of Annonaceae: Testing biogeographical hypotheses using phylogeny reconstruction and molecular dating. Journal of Biogeography 33: 31-46.
  • Pirie MD, Doyle JA. 2012. Dating clades with fossils and molecules: The case of Annonaceae. Botanical Journal of the Linnean Society 169: 84-116.
  • Posada D, Crandall KA. 1998. MODELTEST: Testing the model of DNA substitution. Bioinformatics (Oxford, England) 14: 817-818.
  • Rambaut A, Suchard M, Drummond A. 2013. Tracer, version 1.6. http://tree.bio.ed.ac.uk/software/tracer 18 May 2017.
    » http://tree.bio.ed.ac.uk/software/tracer
  • Ronquist F, Teslenko M, Mark P, et al 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539-542.
  • Scharaschkin T, Doyle JA. 2005. Phylogeny and historical biogeography of Anaxagorea (Annonaceae) using morphology and non-coding chloroplast sequence data. Systematic Botany 30: 712-735.
  • Setten AK, Koek-Noorman J. 1992. Fruits and seeds of Annonaceae: Morphology and its significance for classification and identification. Bibliotheca Botanica 142: 1-101.
  • Simmons MP, Ochoterena H. 2000. Gaps as characters in sequence-based phylogenetic analyses. Systematic Biology 49: 369-381.
  • Simmons MP. 2004. Independence of alignment and tree search. Molecular Phylogenetics and Evolution 31: 874-879.
  • Staden R, Beal KF, Bonfield JK. 2000. The Staden package, 1998. In: Misener S, Krawetz SA. (eds.) Bioinformatics methods and protocols. Methods in Molecular Biology. Vol. 132. Totowa, Humana Press. p. 115-130.
  • Surveswaran S, Wang RJ, Su YCF, Saunders RMK. 2010. Generic delimitation and historical biogeography in the early-divergent 'ambavioid' lineage of Annonaceae: Cananga, Cyathocalyx and Drepananthus Taxon 59: 1721-1734.
  • Tavaré S. 1986. Some probabilistic and statistical problems in the analysis of DNA sequences. Lectures on Mathematics in the Life Sciences 17: 57-86.
  • Thomas AL, Doyle JA. 1996. Geographic relationships of Malagasy Annonaceae. In: Lourenço WR. (ed.) Biogéographie de Madagascar. Paris, ORSTOM. p. 85-94.
  • Thomas AL. 1980. Ultrastructural characters of the pollen grains of African Annonaceae and their significance for the phylogeny of primitive angiosperms (first part). Pollen et Spores 22: 267-342.
  • Thomas AL. 1981. Ultrastructural characters of the pollen grains of African Annonaceae and their significance for the phylogeny of primitive angiosperms (second part). Pollen et Spores 23: 5-36.
  • Thomas DC, Chatrou LW, Stull GW, et al 2015. The historical origins of palaeotropical intercontinental disjunctions in the pantropical flowering plant family Annonaceae. Perspectives in Plant Ecology, Evolution and Systematics 17: 1-16.
  • Waha M, Hesse M. 1988. Aperture types within Sapranthus and Polyalthia (Annonaceae). Systematics and Evolution 161: 135-146.
  • Waha M. 1985. Ultrastruktur und systematische Bedeutung des Pollens bei Bocageopsis, Ephedranthus, Malmea und Unonopsis (Annonaceae). Plant Systematics and Evolution 150: 165-177.
  • Westra LYT, Maas PJM. 2012. Tetrameranthus (Annonaceae) revisited including a new species. PhytoKeys 12: 1-21.
  • Wiens JJ. 1998. Combining data sets with different phylogenetic histories. Systematic Biology 47: 568-581.
  • Xue B, Tan YH, Thomas DC, Chaowasku T, Hou XL, Saunders RMK. 2018. A new Annonaceae genus, Wuodendron, provides support for a post-boreotropical origin of the Asian-Neotropical disjunction in the tribe Miliuseae. Taxon 67: 250-266.
  • Yang Z, Rannala B. 1997. Bayesian phylogenetic inference using DNA sequences: A Markov Chain Monte Carlo method. Molecular Biology and Evolution 14: 717-724.

Publication Dates

  • Publication in this collection
    02 Oct 2020
  • Date of issue
    Jul-Sep 2020

History

  • Received
    14 Feb 2020
  • Accepted
    12 June 2020
location_on
Sociedade Botânica do Brasil SCLN 307 - Bloco B - Sala 218 - Ed. Constrol Center Asa Norte CEP: 70746-520 Brasília/DF. - Alta Floresta - MT - Brazil
E-mail: acta@botanica.org.br
rss_feed Stay informed of issues for this journal through your RSS reader
Go to top Report error