Genome-wide identification and analysis of SAUR gene family in strawberry (Fragaria vesca L.) reveal its potential functions in different developmental stages

ABSTRACT

Auxin is a plant hormone that is highly associated with various biological processes, especially plant growth, development and fruit ripening. The Small Auxin Upregulated RNA (SAUR) genes, whose family is the largest one of early auxin response genes, has received less attention from genome-wide analyzes compared to other gene families. In this study, we successfully conducted a genome-wide analysis of Fragaria vesca L. and identified 66 SAUR genes. In this paper, we provide important information on the identification of all SAUR genes in Fragaria vesca, including gene and protein sequences, chromosome mapping, and phylogeny analyzes. Gene expression data from the strawberry eFP Browser demonstrated that FvSAUR genes had diversified expression patterns in vegetative tissues. The RT-qPCR analysis demonstrated that 10 selected SAUR genes based on eFP strawberry browser could be expressed with expression divergence at least in one of the strawberry organs/tissues tested. Our analysis provides some basic genomic information for the FvSAUR genes in strawberry and a foundation for further investigations for deciphering their function during plant development and fruit ripening.

Keywords:
auxin; expression analysis; identification; SAUR; strawberry

Introduction

The phytohormone auxins are essential regulators of plant developmental processes, including cell elongation, division, differentiation, root initiation, organ patterning and responses to various stimuli. Auxin mediates these effects at the molecular level by altering the expression of hundreds of genes, including early auxin response gene families, Aux/IAA, Gretchen Hagen3 (GH3), and Small Auxin Up-regulated RNA (SAUR) (Abel & Theologis 1996; Guilfoyle et al. 1998; Liscum & Reed 2002). Among these gene families, the SAUR is the largest, and the expression of those rapidly and robustly induced by auxin implies that auxin plays a critical role in their transcription (Franco et al. 1990). SAURs are also post-transcriptionally regulated due to a conserved downstream element (DST) existing in the 3′-untranslated region, which confers highly mRNA instability (McClure & Guilfoyle 1989; Newman et al. 1993).

The first SAUR gene was identified in elongating soybean hypocotyl sections (McClure & Guilfoyle 1987). Subsequently, homologues of this class have been reported at genome-wide level in many plants, some of those including 80 SAURs in apple (Wang et al. 2020), 57 SAURs in loquat (Gan et al. 2020), 65 SAURs in watermelon (Zhang et al. 2017), 99 and 134 SAURs in tomato and potato (Wu et al. 2012), and 81 SAURs in Arabidopsis (Hagen & Guilfoyle 2002). Although many SAUR genes have been predicted or identified in many different plant species, only a small number have been functionally characterized (Shin et al. 2019). Overexpression of SAUR19-24 in Arabidopsis resulted in increased hypocotyl and leaf size, defective apical hook maintenance, and altered tropic responses, providing clear evidence that SAUR genes are important regulators of plant cell expansion (Spartz et al. 2012). Ectopic overexpression of TaSAUR75, isolated from wheat, enhanced drought and salt tolerance in Arabidopsis. Transgenic lines showed longer root structure, higher survival rate, and higher expression level of stress-responsive genes under abiotic stress conditions compared to control plants. In another recent study, overexpression of AbSAUR1 in Atropa belladonna enhanced biomass production by increasing fresh and dry weight (Bai et al. 2019).

The first whole-genome sequencing initiative in the Rosoideae was the genome of the woodland strawberry (Fragaria vesca, 2n=2x=14), which offers generous advantages for genomic and molecular research of Rosaceae (Shulaev et al. 2011). F. vesca has become a model plant for understanding the ripening mechanism in non-climacteric fruits where fruit ripening is controlled by abscisic acid (ABA), auxin (IAA), sugar and insensitive to ethylene. (Xie et al. 2020).

Characterization of SAUR gene families from different plants by formulating better hypotheses regarding physiological and developmental processes is a necessary step. However, as far as we know, no systematic investigation has been reported on the SAUR gene family in strawberries. In this study, genome-wide identification of putative FvSAUR genes in strawberry was performed to characterize the SAUR gene family based on their genomic structures, chromosomal locations, and sequence analyses. Subsequently, the expression profiles of 10 selected FvSAUR genes in diverse tissues and ripening stages of fruits were analysed using RT-qPCR. The results of this study will enhance the understanding of the SAUR genes as a foundation for future research into the functional roles of FvSAUR genes in strawberries.

Materials and methods

Acquisition and identification of FvSAUR genes

The SAUR gene sequences of Arabidopsis were downloaded from TAIR (The Arabidopsis Information Resource (http://www.arabidopsis.org/) and UniProt database (http://www.uniprot.org/) and used as reference sequences. To identify SAUR genes in the Fragaria genome, downloaded sequences were submitted to the Pfam database (http://pfam.sanger.ac.uk) to obtain the domain architecture of this family. The amino acid sequences of SAUR genes were queried in the Fragaria vesca genome using Phytozome v13 (https://phytozome-next.jgi.doe.gov/) (Goodstein et al. 2012). The Hidden Markov Model (HMM) profiles of SAURs were downloaded from PFam database (http://pfam.sanger.ac.uk/) and the HMMER software package was used to verify SAUR genes with the best domain e-value cut off as 1e^-10.

Chromosomal localization, sequence and phylogenetic analyzes of FvSAUR genes

Exon/intron information and chromosomal location of FvSAUR genes were extracted from the PLAZA (https://bioinformatics.psb.ugent.be/plaza/versions/plaza_v4_5_dicots/) (Van Bel et al. 2018), Phytozome v13 (https://phytozome-next.jgi.doe.gov/) (Goodstein et al. 2012) and confirmed with NCBI (https://www.ncbi.nlm.nih.gov/). The exon-intron display was constructed according to the Gene Structure Display Server (GSDS, http://gsds.gao-lab.org/) (Guo et al. 2007). The location of the FvSAUR genes on the chromosome was identified by using MapGene2 (http://mg2c.iask.in/mg2c%5Fv2.1/) (Jiangtao et al. 2015). The online PeptideMass (https://web.expasy.org/peptide_ mass/) tool was used in analysing to predict the molecular weight and isoelectric point (pI) of each FvSAUR protein. Predicted subcellular localizations of the FvSAUR proteins were determined using the CELLO v2.5 server (http://cello.life.nctu.edu.tw/) (Yu et al. 2006).

The MEME (https://meme-suite.org/meme/) is the online tool used to search the motifs of FvSAURs. The parameters were set as follows: the site distribution was set to zero or one occurrence per sequence, the number was set to 10, the width was limited to between 6 and 50; and other optional parameters remained default. The MEME motifs were then verified using the Pfam database (http://pfam.sanger.ac.uk/) and the SMART server (http://smart.embl-heidelberg.de/).

Predicted protein-protein interaction network and promoter analyses

The amino acid sequences were used to further analyse the protein-protein interactions of the strawberry SAUR proteins. Predicted protein-protein interaction (PPI) networks of FvSAUR proteins were analysed using the STRING v11 (Search Tool for the Retrieval of Interacting Genes; https://string-db.org/) (Szklarczyk et al. 2019). To explore cis-elements in promoter sequences of strawberry SAUR genes, 1000 bp (of genomic DNA sequence upstream of initiation codon (ATG) were downloaded from the Phytozome (https://phytozome-next.jgi.doe.gov/) database. The PlantPAN 3.0 (The Plant Promoter Analysis Navigator) server was employed to identify cis-elements related with transcription factor binding sites (TFBSs) in the promoter regions (http://plantpan2.itps.ncku.edu.tw/) (Chow et al. 2019).

In Silico gene expression pattern analysis

The transcript relative abundance values of all F. vesca SAUR genes from various tissues were obtained from the F. vesca transcript abundances datasets (Hawkins et al. 2017) in the website of the F. vesca electronic fluorescent pictograph browser (eFP) (F. vesca eFP bowser: https://bar.utoronto.ca/~asher/efp_strawberry/cgi-bin/efpWeb.cgi). The data were generated from 42 different tissues and stages, and eight RNA-Seq data sets from receptacle parts of ripening fruit of yellow-colored (Yellow Wonder) and red-colored (Ruegen) wild strawberry varieties. In this study, since we focused more on regenerating vegetative tissues (flower, leaf and seedling) and fruit ripening, we only extracted the transcript data of these tissues from the eFP browser. The heatmap was created using 'Clustvis', a web tool to visualize the clustering of the multivariate data tool (https://biit.cs.ut.ee/clustvis/) and all expression values were displayed using the heat map to analyze ‘corresponding genes’ expression pattern in different tissues.

Plant materials

A F. vesca cultivar called ‘Ottoman Strawberry’ plants was cultivated in a local strawberry producer in Burdur, Turkey. The flower samples and fruits at four different growth stages were harvested at the same time in the month of May 2020. The fruit growth and developmental stages were grouped as follows: Stage 1, small green fruits (S1, 17 days post-anthesis (DPA)); S2, larger green fruits (22 DPA); S3 white fruits (27 DPA); and S4, full red fruits (38 DPA) (Fig. 1). At least three fruits were pooled (at least 10 fruits for S1 stage) and considered as one biological replicate. In total, three biological replicates were harvested from flowers and four different ripening stages. The samples harvested were snap-frozen in liquid nitrogen, and stored at -80 °C for further analysis.

Figure 1
Appearance of cultivar ‘Ottoman Strawberry’ flower and at four developmental stages.

RNA isolation and RT-qPCR

Total RNA was extracted from fine powdered strawberry fruits using PureLink™ Plant RNA Reagent (Thermo Fisher Scientific) in accordance with the manufacturer’s instructions. The final concentration of total RNA was quantified by NanoDrop (Epoch Microplate, Biotek) and cDNA was prepared by the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). The primers for selected FvSAUR genes were designed using primer 3 (http://primer3.ut.ee/) and listed in Table 1. For RT-qPCR analysis, actin was used as an internal constitutively expressed gene (Mo et al. 2020). The RT-qPCR was performed using CFX96™ Real-Time System (Bio-Rad) using a SYBR® Green Master (Bio-Rad) in the following reaction conditions: 2 min at 50 °C, 2 min at 95 °C followed by 35 cycles at 95 °C for 15 s and 60 °C for 30 s.

Table 1
Primers of strawberry actin gene (endogenous control) and selected 10 FvSAUR genes used for RT-qPCR.

Gene	Forward Sequence	Reverse Sequence
FvSAUR4	ATGGGCGCCTCATATCAGAA	ATGCTCGATCACAACCTCACA
FvSAUR23	GAGTACGGCTTCACCAACCA	GGGAAATGTACCGGACCACC
FvSAUR32	CGACGACGACGACTCAATCA	TTCATCGATTCCGGCTGAGG
FvSAUR35	TGGAAACCAGACAGCTCCAA	TCGCTTCTTCTGGCTCTCTC
FvSAUR36	GGGGAGAGCCAGAAGAAGAGA	GACTCAGCAGCATGTCTCCCA
FvSAUR41	CCCAAAAGGCTATTTCGCAGTC	GGCTTGACTCAGCAAATCCA
FvSAUR44	GGGAAGAGCCAGAAAAAGCGA	AAGGCGTCTTCACTACATGGG
FvSAUR46	TAGGCGAAAACAGAAGCCGA	GTACTCCTCCTCAGCCCTCT
FvSAUR58	GATGACCAATGCCGAGGAGG	ACGTAACGGATCAGTCTCCAC
FvSAUR59	CAAGCAGCGGAGGAGTATGG	AGTGATGCAGTTCTCCCTCTG
Actin	TGGGTTTGCTGGAGATGAT	CAGTAGGAGAACTGGGTGC

Gene expression levels were calculated using the 2^−ΔΔCt method (Livak & Schmittgen 2001). Changes in relative expression levels of the 10 FvSAUR genes were checked for statistical significance in accordance with the one-way ANOVA and the means and standard deviation of the replications were compared by the least significant difference (LSD) test at the P≤ 0.05.

Results

Identification and classification of SAUR genes in F. vesca

In this study, SAUR family genes were identified with a genome-wide scale and the details of those presented in Table 2. After removing the redundant sequences and bioinformatics analysis, 66 putative SAUR genes with full-length coding regions were identified and named sequentially from FvSAUR1 to FvSAUR66. Domain analysis showed that all FvSAUR proteins have an auxin-inducible domain structure (PF02519). The predicted amino acid length of the strawberry SAUR genes ranged from 99 (FvSAUR41) to 852 (FvSAUR22) with an average of 177.7. The molecular weights of the strawberry FvSAUR proteins ranged from 11.047 (FvSAUR51) to 94.294 (FvSAUR22) kDa. Furthermore, the theoretical isoelectric point (pI) of FvSAURs ranged from 4.66 (FvSAUR58) to 10.71 (FvSAUR66), respectively. Based on the pI values, 32 of the FvSAUR proteins are basic; three of them are neutral, while 21 of them show acidic character. According to the results obtained from predicted protein localization, we found that most of FvSAUR proteins were located in the nucleus (24) and extracellular (18). Moreover, 22 SAUR proteins were spread out of mitochondria, cytoplasm and plasma membrane. Interestingly, two FvSAUR proteins (FvSAUR29 - FvSAUR37) were found to be localized in the chloroplast.

Table 2
Details of small auxin up-regulated RNA (FvSAUR) gene family in strawberry.

Gene ID	Gene Name	Protein length (aa)	Molecular Weight (Da)	pI	Subcellular Localization
FvH4_2g10760	FvSAUR1	151	17009.63	9.23	Extracellular
FvH4_2g10770	FvSAUR2	312	33965.86	9.14	Extracellular
FvH4_2g10800	FvSAUR3	376	20010.83	6.08	Plasma membrane
FvH4_2g10810	FvSAUR4	138	15544.91	9.52	Extracellular
FvH4_2g10820	FvSAUR5	115	13029.29	10.05	Extracellular
FvH4_6g20761	FvSAUR6	168	18467.41	10.39	Extracellular
FvH4_2g10880	FvSAUR7	359	39739.72	8.24	Extracellular
FvH4_2g10900	FvSAUR8	109	12299.93	6.5	Extracellular
FvH4_7g11280	FvSAUR9	167	18775.96	10.27	Extracellular
FvH4_6g36840	FvSAUR10	153	17351.15	8.73	Extracellular
FvH4_6g36850	FvSAUR11	139	15698.08	8.97	Extracellular
FvH4_6g36860	FvSAUR12	185	20800.98	9.11	Extracellular
FvH4_6g35400	FvSAUR13	103	11919.00	9.51	Extracellular
FvH4_6g35410	FvSAUR14	128	14418.40	5.2	Extracellular
FvH4_5g08800	FvSAUR15	186	20458.36	9.38	Extracellular
FvH4_5g08790	FvSAUR16	174	19468.51	9.3	Extracellular
FvH4_5g08780	FvSAUR17	169	18731.83	9.62	Extracellular
FvH4_5g08770	FvSAUR18	212	23350.51	5.35	Cytoplasmic
FvH4_2g02300	FvSAUR19	102	11202.99	8.76	Mitochondrial
FvH4_2g02290	FvSAUR20	259	30028.03	5.52	Nuclear
FvH4_2g02280	FvSAUR21	168	19046.89	6.14	Cytoplasmic
FvH4_2g02250	FvSAUR22	852	94293.95	5.98	Nuclear
FvH4_2g38740	FvSAUR23	206	23185.81	9.45	Nuclear
FvH4_2g38720	FvSAUR24	106	12139.93	6.41	Mitochondrial
FvH4_2g36430	FvSAUR25	160	18340.04	8.8	Nuclear
FvH4_6g16370	FvSAUR26	109	12250.24	5.43	Cytoplasmic
FvH4_6g16380	FvSAUR27	134	15275.53	6.22	Nuclear
FvH4_3g15820	FvSAUR28	137	15674.74	8.51	Nuclear
FvH4_5g29950	FvSAUR29	166	18512.60	9.77	Chloroplast
FvH4_7g32600	FvSAUR30	122	13979.89	6.19	Nuclear
FvH4_1g09280	FvSAUR31	238	26399.72	6.21	Nuclear
FvH4_1g09300	FvSAUR32	124	13879.66	5.27	Mitochondrial
FvH4_5g22822	FvSAUR33	220	24933.33	5.86	Nuclear
FvH4_5g22821	FvSAUR34	178	19886.72	6.83	Nuclear
FvH4_3g13730	FvSAUR35	166	22373.00	9.83	Plasma Membrane
FvH4_5g22790	FvSAUR36	119	13533.31	5.35	Nuclear
FvH4_5g22780	FvSAUR37	101	11185.66	5.27	Chloroplast
FvH4_6g10090	FvSAUR38	314	29469.35	6.95	Nuclear
FvH4_5g22700	FvSAUR39	261	29469.35	6.95	Plasma Membrane
FvH4_5g22690	FvSAUR40	192	21715.76	5.85	Nuclear
FvH4_5g22660	FvSAUR41	99	10930.35	5.71	Nuclear
FvH4_3g13730	FvSAUR42	99	11051.70	7.83	Nuclear
FvH4_5g22620	FvSAUR43	200	22653.91	5.39	Plasma Membrane
FvH4_2g10870	FvSAUR44	106	12004.93	9.52	Mitochondrial
FvH4_5g22790	FvSAUR45	112	12741.52	9.34	Mitochondrial
FvH4_1g11980	FvSAUR46	111	12646.56	7.72	Mitochondrial
FvH4_6g19170	FvSAUR47	132	14611.73	6.82	Nuclear
FvH4_6g27350	FvSAUR48	147	16707.50	9.86	Mitochondrial
FvH4_6g21652	FvSAUR49	196	22351.67	8.21	Cytoplasmic
FvH4_7g17340	FvSAUR50	196	22412.49	6.2	Cytoplasmic
FvH4_3g13730	FvSAUR51	99	11046.64	6.55	Nuclear
FvH4_5g22810	FvSAUR52	109	12375.25	9.23	Extracellular
FvH4_4g12051	FvSAUR53	336	40013.41	5.89	Nuclear
FvH4_6g33390	FvSAUR54	110	12329.43	10.34	Mitochondrial
FvH4_7g19120	FvSAUR55	143	16767.86	9.16	Extracellular
FvH4_5g32781	FvSAUR56	158	18279.05	9.11	Mitochondrial
FvH4_5g32781	FvSAUR57	139	16132.32	9.68	Nuclear
FvH4_6g38640	FvSAUR58	282	32426.72	4.66	Cytoplasmic
FvH4_3g31140	FvSAUR59	179	20309.22	5.23	Cytoplasmic
FvH4_3g31150	FvSAUR60	172	19807.64	7.73	Nuclear
FvH4_5g26890	FvSAUR61	120	13627.67	5.16	Nuclear
FvH4_5g26860	FvSAUR62	134	14876.14	5.51	Plasma Membrane
FvH4_5g26860	FvSAUR63	123	14156.30	5.3	Nuclear
FvH4_3g15390	FvSAUR64	145	16121.22	8.68	Nuclear
FvH4_6g17520	FvSAUR65	128	14802.92	8.8	Nuclear
FvH4_5g00360	FvSAUR66	178	20959.30	10.71	Mitochondrial

Gene structure, conserved motif and chromosomal localization analysis of FvSAUR genes

To obtain more insights into the evolution of the SAUR family in strawberry, gene characteristics of all identified FvSAURs were analyzed (Fig. 2). The results of the structural analysis showed that the number of exons ranged from 2 to 15. Thirty eight members had no introns. Among the FvSAUR genes, 14 had one introns, 12 had two introns, one had three introns and one had sevens introns.

Figure 2
Exon-intron structure of FvSAUR genes. Blue boxes indicate exons, orange boxes indicate upstream/downstream, green lines indicate introns.

Protein motifs play an important role in the interaction of different modules in transcriptional complexes and are seeming to be closely related to gene classification (Heim et al. 2003). Therefore, to reveal the protein structural diversification of FvSAUR proteins, 10 conserved motifs were identified by MEME (Fig. 3b). The amino acid sequence length of each motif varied from 8 to 21 amino acids (Fig. 3c). Motifs 1, 2, 3 4, 5 that correspond to SAUR (PF02519) domain were the most conserved parts and have been identified in nearly all FvSAUR proteins (Fig. 3a). The motifs of FvSAUR members within the same subgroups display similar patterns, but a specific biological function of most of these motifs is unknown and remains to be further investigated.

Figure 3
The motif composition of FvSAUR proteins. a) Distribution of FvSAUR protein motifs. b) Sequences of FvSAUR protein motifs. c) The domains found in these FvSAUR proteins.

To show the distribution of SAUR genes on 7 chromosomes of strawberry, the MG2C (MapGene2Chrom) program was used to map FvSAUR genes on the chromosomes. Chromosomal location analysis demonstrates that 66 FvSAUR genes were irregularly distributed among the seven F. vesca chromosomes (Fig. 4). The number of FvSAUR genes on each chromosome has no relationship with chromosome length. Chromosome 5 has the highest number of FvSAUR genes (22) while chromosome 4 has the lowest number (2).

Figure 4
Distribution of FvSAUR genes among 7 chromosomes. The scale on the left represents chromosome length. The chromosome number is to the top of each chromosome.

Phylogenetic analyses of FvSAUR genes

To explore the evolutionary relationship of the SAUR family, the SAUR protein sequences of Fragaria vesca L. and A. thaliana were used to construct the unrooted phylogenetic tree (Fig. 5) The tree showed that 145 SAUR genes could be divided into 11 groups, here named as Groups I to XI, which was strongly supported by bootstrap values. Twenty-seven FvSAURs were fully assigned to Group I, meanwhile, 21 AtSAURs belonged to this group. These results show that genes in this group have a closer evolutionary relationship. Other subgroups have varying numbers of AtSAUR and FvSAUR, which may provide guidance for understanding the relationship between SAUR genes in both species.

Figure 5
Phylogenetic analysis of FvSAUR. The phylogenetic tree was generated using the amino acid sequences of selected FvSAUR via NJ method. All tomato FvSAURs were classified into 4 groups. Groups I to IV are represented by orange, red, blue, and green, respectively.

PPI network and promoter region analysis of FvSAURs

The STRING online database was searched and the corresponding functional PPI networks were reconstructed using the 66 input putative strawberry SAUR proteins to explore the functional PPIs (Fig. 6). Among all FvSAUR proteins, FvSAUR48, FvSAUR30, FvSAUR32, FvSAUR9 stand out as core hub elements that interact very tightly with each other. FvSAUR46 stands out as a possible central regulator among these four core hub proteins. FvSAUR39, FvSAUR14, FvSAUR28, FvSAUR64, FvSAUR15 and FvSAUR60 are secondary proteins associated with these core proteins. Interestingly, a direct relationship between FvSAUR10, FvSAUR26, FvSAUR29 proteins has been observed, which could be regarded as crucial nodes for further research. The remaining 53 FvSAUR proteins were grouped independently at five different clusters. In order to analyze the complex relationship between FvSAUR proteins, in addition to functional analysis, proteins belonging to other gene families should be identified and uploaded to databases for strawberries.

Figure 6
The mapped profile of PPI network was constructed by the STRING online database to probe the functional interactions of FvSAUR proteins.

The prediction of cis-elements can provide a platform for the spatial and tissue-specific expression of genes. In order to identify putative cis-elements in the strawberry SAUR promoters, the PlantPAN 3.0 database was used to screen the predicted transcription factors (TF) and their binding sites of the 66 FvSAUR genes. A total of 28 type of TFs were detected and the 14 TFs with the highest number of motifs are shown in Table 3. The highest number TF motif was found as 516 for GATA, followed by 448 for AP2/ERF, 329 for bZIP, 237 for NF-YB, and 195 for Dof. Based on promotor analysis, the presence of too many TF related cis-acting elements might support the active roles of the SAUR gene family in different developmental stages of plant life cycle activities in F. vesca.

Table 3
Transcription factor binding sites detected in the upstream of promoter regions and total total number in 66 FvSAUR genes.

TF Family	Number of sites	Description	Reference
GATA	516	Regulation of plant developmental and growth processes	An et al. 2020
AP2/ERF	448	Ethylene-responsive transcription factor	Guo et al. 2016
bZIP	329	Related to plant development, environmental signalling and stress response	Dröge-Laser et al. 2018
NF-YB	237	Regulating plant growth, development and participates in various stress responses	Dai et al. 2021
Dof	195	regulating specific biological processes related to plant photosynthesis, growth and development	Shaw et al. 2009
Trihelix	183	Regulating plant growth and development involving seeds, embryos stomata and flowers	Kaplan-Levy et al. 2012
Homeodomain	178	Regulating maintenance of the stem cell niche in a shoot apical meristem	Lopes et al. 2021
SBP	164	Regulating growth, flower development, and signal transduction	Teng et al. 2021
HD-ZIP	132	Participate in vascular development, leaf polarity, embryogenesis, meristem regulation and developmental responses to environmental conditions	Ariel et al. 2007
WRKY	113	Play crucial roles in plant growth and development, defense regulation and stress responses	Abeysinghe et al. 2019
AT-Hook	104	Regulation of growth and development	Favero et al. 2020
ZF-HD	95	Play crucial roles in the response to abiotic and biotic stresses	Muthuramalingam et al.2018
Dehydrin	87	Participate in salt and osmotic stress signaling pathways.	Luo et al. 2019
TBP	85	Play diverse roles in plant growth and development	Mougiou et al. 2012

In silico expression profiles of FvSAUR genes

Since gene expression patterns provide important clues for understanding the function of genes, we examined the expression of FvSAUR genes at seedling, flower, leaf and two ripening stages of two different F. vesca genotypes using an integrated transcriptome datasets in flower and early stage of fruit development (Kang et al. 2013; Hollender et al. 2014), and recent RNA-Seq data set on ripening-stage receptacle (Hawkins et al. 2017) (Fig. 7). The electronic expression profiles of 66 FvSAUR genes in various organs/tissues were downloaded from the strawberry eFP browser at bar.utoronto.ca. Among those, the transcripts of 15 FvSAUR genes were quite low in all detected organs/tissues. In this study, we focus more specifically on the analysis of gene expression in vegetative and reproductive tissues/organs. Therefore, the heatmap indicated that the expression profiles of strawberry SAUR genes in seedling, flower, leaf and two ripening stages of two different F. vesca genotypes could be divided into four clades (Fig. 7). The genes were highly expressed in Ruegen fruits at white stage (Ruegen F7-4 W), whereas most of them had a quite low expression level at the green stage (Ruegen F7-4 G). Additionally, the highest mRNA levels of 35 genes were detected in flowers. Notably, the transcripts of five genes were specifically detected in the seedlings. Sixteen genes with the highest expression were found in the leaf tissues (Fig. 7). The results indicate that the FvSAUR genes are involved in a variety of strawberry plant development and fruit ripening process.

Figure 7
Heat map representation for tissue specific expression and two fruit development stages-related expression in two differet strawberry cultivars. These electronic expression data were downloaded from the strawberry eFP browser at bar.utoronto.ca .

Expression analysis of selected FvSAUR genes

According to the eFP data, the expression level of ten genes with high transcript levels ​​in different tissues and organs were experimentally verified by RT-qPCR. The results mostly confirmed the eFP browser data that all selected genes were differentially expressed among seven strawberry tissues (Fig. 8). The genes FvSAUR41 and FvSAUR58 were mainly expressed in flower tissues. The most expressed genes in young (YL) and mature leaf (ML) tissues were FvSAUR35, FvSAUR36 and FvSAUR59. The expression level of FvSAUR4 was the highest in big green fruits (S2) that was down-regulated in S3 and S4 ripening stages. The expression levels of FvSAUR23, FvSAUR32 and FvSAUR44 genes increased consistently in strawberry fruits as the ripening progressed.

Figure 8
Expression levels of selected 10 FvSAUR genes in different tissues/organs of strawberry. F: flower, YL: younf leaf, ML: mature leaf, S1 (small-sized green fruits), S2 (bigger size green fruits), S3 (white-purple fruits), S4 (full ripe fruits). Mean values and SD ± were obtained from three biological and two technical replicates. The bars with different letters indicate significant differences, P≤ 0.05.

Discussion

Several research groups have identified and annotated some SAUR genes at genome-wide level in Arabidopsis (72) (Hagen & Guilfoyle 2002), rice (58) (Jain et al. 2006), sorghum (71) (Wang et al. 2010) tomato (99), potato (134) (Wu et al. 2012), maize (79) (Chen et al. 2014), citrus (70) (Xie et al. 2015), mulberry (62) (Xing et al. 2016), watermelon (65) (Zhang et al. 2017) and apple (80) (Wang et al. 2020). In the present study, we conducted a genome wide analysis and identified 66 FvSAUR genes in the strawberry genome. All the members of the family were predicted to encode the SAUR (PF02519) domains. Compared with the SAUR gene family in other species, a moderate number of genes was identified in strawberry. The smaller scales of the SAUR family might be due to whole genome duplication (Jaillon et al. 2009). In the present study, more than a third of the FvSAURs were localized in the nucleus. This feature was found in watermelon (Zhang et al. 2017), bamboo (Bai et al. 2017), agave (Deng et al. 2019), cotton (Li et al. 2017), tomato and potato (Wu et al. 2012) that is, at least a third of the SAUR proteins can be predicted to be localized in the nucleus. However, the functions of SAURs are still unclear in the nucleus (Stortenbeker & Bemer 2019).

By comparing of the 28 regulatory elements in the promoter regions, GATA transcription factor (TF) gene family has been identified as the most found cis-acting element and this was identified as the most conserved TF from fungi to angiosperms (Gupta et al. 2017). FvSAUR21 (17) has the most, and FvSAUR47 has the least (0) GATA cis-acting elements in their promoter regions. It has been reported that GATA TFs play important roles in the regulation of plant photoresponse, chlorophyll synthesis, carbon and nitrogen metabolism, and in the regulation of plant flowering time, leaf extension and other biological processes (Gupta et al. 2017). The second most abundant regulatory TF AP2/ERFs participates in the hormonal regulation of the stress response in plants (Xie et al. 2019). In strawberry, the role of AP2/ERF in fruit color and aroma was investigated (Sheng et al. 2021). In our analysis, FvSAUR22 (14) was identified as containing the most AP2/ERF element, which makes the gene play an important role in hormonal response in different plant developmental stages. Another high number of TF motifs was found in the leucine zipper (bZIP) TFs which play a vital role in plant development and responses to various stresses (Wang et al. 2017). Biochemical and functional analyses have shown that the bZIP family is involved in many major plant biological processes, including plant growth processes such as organ differentiation, flower induction, vascular development, embryogenesis and seed maturation (Abe et al. 2005).

In our analysis, FvSAUR30 and FvSAUR64 (11) have the most and bZIP promoter regions. Therefore, it can be said that especially FvSAUR30 and FvSAUR64 would potentially be involved in different plant growth processes. Nuclear factor Y (NF-Y), also called heme activator protein (HAP) or CCAAT-binding factor (CBF), can be found in almost all eukaryotes (Dorn et al. 1987). This gene family consists of three subunits, NF-YA, NF-YB and NF-YC. NF-YB genes have been shown to be involved in the process of chloroplast biogenesis in rice, fruit ripening in the tomato, grain yield metabolism in wheat. (Li et al. 2016; Thirumurugan et al. 2008). In our analysis, it was identified that FvSAUR23 has seven NF-Y binding motifs in their promoter region. Considering all the TF data obtained, it can be suggested that the FvSAUR genes may contact various TFs for regulating diverse processes of plant development and play very important roles in hormonal regulations.

Expression Divergence of FvSAUR genes in Different Tissues and Organs

Based on eFP browser data, expression analysis indicated that 51 FvSAUR genes in strawberry are predominantly expressed in the seedling, flower, leaf or fruits tissues, whereas the transcripts of 15 genes could not be detected or expressed in very low levels in any strawberry organs. Majority of the genes have expression accumulated in seedling, flower, and leaf tissues indicating that suggesting that FvSAUR gene family might play a major role in the reproduction development in strawberry. The functions of SAUR genes in dividing tissues, such as cell elongation and cell expansion have been revealed in Arabidopsis (Ren & Gray 2015). This statement was functionally supported that AtSAUR19-24 function as positive effectors of cell expansion by modulating the auxin transport, as SAUR gain-of-function and loss-of-function seedlings exhibit increased and reduced basipetal indole-3-acetic acid transport, respectively (Spartz et al. 2012). Most of the expression of the genes increased in flower and leaf indicating that the tissues are the more important growing parts of strawberry plants. In other words, more auxin might be produced in the flower and leaf tissues to maintain plant growth. The genes expressed in these organs might share similar functions with Arabidopsis.

Eight genes were highly expressed in Ruegen F7-4 that makes a red fleshy receptacle, whereas there were lower expression levels of those genes in Yellow Wonder (YW5AF7) develops yellow fleshy receptacles. Therefore, these genes might be responsible for regulating strawberry fruit development and ripening.

Supporting our results, the expression of a number of SAUR genes activated during the development of young fruit in tomato and watermelon (Zhang et al. 2017), suggesting that the SAUR gene family might play a major role in the reproduction development in different fruits.

Ten FvSAUR genes were selected to examine their expression patterns in different strawberry tissues based on their transcript levels in eFP strawberry browser. According to RT-qPCR, FvSAUR41 and FvSAUR58 are highly expressed in flowers. In YL and ML tissues, FvSAUR35, FvSAUR36 and FvSAUR59 showed up-regulation, implying that these genes might be more likely to play critical roles in regulating growing parts. For plants, compared with dormant tissues (such as seed), growing (such as leaf) and developing tissues (fruit developing and maturation) can often produce a large amount of auxin to satisfy the needs for plant growth (Wang et al. 2020). Interestingly, FvSAUR4 and FvSAUR46 are highly up-regulated in S2 and S3 fruit developmental stages in strawberry fruits, respectively, which might promote fruit growth by regulating cell division. The genes FvSAUR23, FvSAUR32 and FvSAUR44 were highly up-regulated specifically in ripe fruits (S4). The expression level of FvSAUR46 peaked in S3 stage where the red colouration of fruit has just started indicating that FvSAUR46 could be responsible for the ripening transition phase in which ripening related hormones might just be activated in strawberries. Down-regulation of this gene would possibly delay ripening initiation and decrease softening rate in strawberries. Previous studies have shown that some of the SAUR genes could be induced by exogenous auxin (Wang et al. 2020). In tomato overexpression of SlSAUR69 resulted in the premature initiation of ripening and down-regulation of the gene delays the initiation of fruit ripening demonstrated that SlSAUR69 contributes to the ripening transition in tomato (Shin et al. 2019). Based on these results, in order to better understand the role of FvSAURs, future work addressing the function and evolution of these genes is necessary in strawberries. Moreover, in future, it would be interesting to functionally characterize especially selected genes by up/down-regulation and to classfy them as positive and negative regulators of plant development and fruit ripening in strawberries.

Conclusion

This study presents a comprehensive analysis of the FvSAUR gene family in strawberries. A total of 66 FvSAUR genes were identified and the results provided a genomic framework for future characterization of strawberry SAUR genes. RT-qPCR analysis demonstrated the existence of the expression of 10 FvSAUR genes in different tissues and developmental stages. Our study will serve to better understand the complexity of the strawberry FvSAUR gene family and guide future studies for functional analyses.

Declarations

Funding: This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Conflicts of interest/Competing interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Ethics approval: Not applicable

Availability of data and material: Not applicable

References

• Abe M, Kobayashi Y, Yamamoto S. 2005. FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 309: 1052-1056.
• Abel S, Theologis A. 1996. Early genes and auxin action. Plant Physiology 111: 9-17.
• Bai F, Li S, Yang C, et al 2019. Overexpression of the AbSAUR1 gene enhanced biomass production and alkaloid yield in Atropa belladonna Industrial Crops and Products 140: 111705.
• Bai Q, Hou D, Li L, et al 2017. Genome-wide analysis and expression characteristics of small auxin-up RNA (SAUR) genes in moso bamboo (Phyllostachys edulis). Genome 60: 325-336.
• Chen Y, Hao X, Cao J. 2014. Small auxin upregulated RNA (SAUR) gene family in maize: Identification, evolution, and its phylogenetic comparison with Arabidopsis, rice, and sorghum. Journal of Integrative Plant Biology 56: 133-150.
• Chow CN, Lee TY, Hung YC, et al 2019. Plantpan3.0: A new and updated resource for reconstructing transcriptional regulatory networks from chip-seq experiments in plants. Nucleic Acids Research 47: D1155-D1163.
• Deng G, Huang X, Xie L, et al 2019. Identification and expression of SAUR genes in the cam plant agave. Genes 10. https://doi.org/10.3390/genes10070555
  » https://doi.org/10.3390/genes10070555
• Dorn A, Bollekens J, Staub A, et al 1987. A multiplicity of CCAAT box-binding proteins. Cell 50: 863-872.
• Franco AR, Gee MA, Guilfoyle TJ. 1990. Induction and superinduction of auxin-responsive mRNAs with auxin and protein synthesis inhibitors. Journal of Biological Chemistry 265: 15845-15849.
• Gan X, Jing Y, Shahid MQ, et al 2020. Identification, phylogenetic analysis, and expression patterns of the SAUR gene family in loquat (Eriobotrya japonica). Turkish Journal of Agriculture and Forestry 44: 15-23.
• Goodstein DM, Shu S, Howson R, et al 2012. Phytozome: a comparative platform for green plant genomics. Nucleic Acid Research 40: 1178-1186.
• Guilfoyle T, Hagen G, Ulmasov T, Murfett J. 1998. How does auxin turn on genes? Plant Physiologu 118: 341-347.
• Guo AY, Zhu QH, Chen X, Luo JC. 2007. GSDS: a gene structure display server. Hereditas (Beijing) 29: 1023-6.
• Gupta P, Nutan KK, Singla-Pareek SL, Pareek A. 2017. Abiotic stresses cause differential regulation of alternative splice forms of GATA transcription factor in rice. Frontiers in Plant Science 8. https://doi.org/10.3389/fpls.2017.01944
  » https://doi.org/10.3389/fpls.2017.01944
• Hagen G, Guilfoyle T. 2002. Auxin-responsive gene expression: Genes, promoters and regulatory factors. Plant Molecular Biology 49:373-385.
• Hawkins C, Caruana J, Li J. et al 2017. An eFP browser for visualizing strawberry fruit and flower transcriptomes. Horticulture Research 4: 17029.
• Heim MA, Jakoby M, Werber M, Martin C, Weisshaar B, Bailey PC. 2003. The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. Molecular Biology and Evolution 20:735-747.
• Hollender CA, Kang C, Darwish O, et al 2014. Floral transcriptomes in woodland strawberry uncover developing receptacle and anther gene networks. Plant Physiology 165: 1062-1075.
• Jaillon O, Aury JM, Wincker P. 2009. 'Changing by doubling', the impact of Whole Genome Duplications in the evolution of eukaryotes. Comptes Rendus Biologies 332: 241-253.
• Jain M, Tyagi AK, Khurana JP. 2006. Genome-wide analysis, evolutionary expansion, and expression of early auxin-responsive SAUR gene family in rice (Oryza sativa). Genomics 88: 360-371.
• Jiangtao C, Yingzhen K, Qian W, et al 2015. MapGene2Chrom, a tool to draw gene physical map based on Perl and SVG languages. Yi chuan = Heredity 37: 91-97.
• Kang C, Darwish O, Geretz A, Shahan R, Alkharouf N, Liu Z. 2013. Genome-scale transcriptomic insights into early-stage fruit development in woodland strawberry Fragaria vesca Plant Cell 25: 1960-1978.
• Li S, Li K, Ju Z, et al 2016. Genome-wide analysis of tomato NF-Y factors and their role in fruit ripening. BMC Genomics 17. https://doi.org/10.1186/s12864-015-2334-2
  » https://doi.org/10.1186/s12864-015-2334-2
• Li X, Liu G, Geng Y, et al 2017. A genome-wide analysis of the small auxin-up RNA (SAUR) gene family in cotton. BMC Genomics 18: 1-22.
• Liscum E, Reed JW. 2002. Genetics of Aux/IAA and ARF action in plant growth and development. Plant Molecular Biology 49: 387-400.
• Livak KJ, Schmittgen TD. 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2CT Method. Methods 25: 402-408.
• McClure BA, Guilfoyle T. 1987. Characterization of a class of small auxin-inducible soybean polyadenylated RNAs. Plant Molecular Biology 9: 61-623.
• McClure BA, Guilfoyle T. 1989. Rapid redistribution of auxin-regulated RNAs during gravitropism. Science (80) 243: 91-93.
• Mo A, Xu T, Bai Q, et al 2020. FaPAO5 regulates Spm/Spd levels as a signaling during strawberry fruit ripening. Plant Direct 4. https://doi.org/10.1002/pld3.217
  » https://doi.org/10.1002/pld3.217
• Newman TC, Ohme-Takagi M, Taylor CB, Green PJ. 1993. DST sequences, highly conserved among plant SAUR genes, target reporter transcripts for rapid decay in tobacco. Plant Cell 5: 701-714.
• Ren H, Gray WM. 2015. SAUR Proteins as Effectors of Hormonal and Environmental Signals in Plant Growth. Molecular Plant 8: 1153-1164.
• Sheng L, Ma C, Chen Y, Gao H, Wang J. 2021. Genome-wide screening of AP2 transcription factors involving in fruit color and aroma regulation of cultivated strawberry. Genes 12: 530.
• Shin JH, Mila I, Liu M, et al 2019. The RIN-regulated Small Auxin-Up RNA SAUR69 is involved in the unripe-to-ripe phase transition of tomato fruit via enhancement of the sensitivity to ethylene. New Phytologist 222: 820-836.
• Shulaev V, Sargent DJ, Crowhurst RN, et al 2011. The genome of woodland strawberry (Fragaria vesca). Nature Genetics 43: 109-16.
• Spartz AK, Lee SH, Wenger JP, et al 2012. The SAUR19 subfamily of SMALL AUXIN UP RNA genes promote cell expansion. The Plant Journal 70: 978-990.
• Stortenbeker N, Bemer M. 2019. The SAUR gene family: The plant’s toolbox for adaptation of growth and development. Journal of Experimental Botany 70: 17-27.
• Szklarczyk D, Gable AL, Lyon D, et al 2019. STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Research 47: D607-D613.
• Thirumurugan T, Ito Y, Kubo T, et al 2008. Identification, characterization and interaction of HAP family genes in rice. Molecular Genetics and Genomics 279: 279-289.
• Van Bel M, Diels T, Vancaester E, et al 2018. PLAZA 4.0: an integrative resource for functional, evolutionary and comparative plant genomics. Nucleic Acids Research 46(1): 1190-1196.
• Wang P, Lu S, Xie M, et al 2020. Identification and expression analysis of the small auxin-up RNA (SAUR) gene family in apple by inducing of auxin. Gene 750: 144725.
• Wang S, Bai Y, Shen C, et al 2010. Auxin-related gene families in abiotic stress response in Sorghum bicolor Functional & Integrative Genomics 10: 533-546.
• Wang XL, Chen X, Yang TB, Cheng Q, Cheng ZM. 2017. Genome-wide identification of bZIP family genes involved in drought and heat stresses in strawberry (Fragaria vesca). International Journal of Genomics 3981031. https://doi.org/ 10.1155/2017/3981031
  » https://doi.org/ 10.1155/2017/3981031
• Wu J, Liu S, He Y, et al 2012. Genome-wide analysis of SAUR gene family in Solanaceae species. Gene 509: 38-50.
• Xie R, Dong C, Ma Y, et al 2015. Comprehensive analysis of SAUR gene family in citrus and its transcriptional correlation with fruitlet drop from abscission zone A. Functional & Integrative Genomics 15: 729-740.
• Xie YG, Ma YY, Bi PP, et al 2020. Transcription factor FvTCP9 promotes strawberry fruit ripening by regulating the biosynthesis of abscisic acid and anthocyanins. Plant Physiology and Biochemistry 146: 374-383.
• Xie Z, Nolan TM, Jiang H, Yin Y. 2019. AP2/ERF transcription factor regulatory networks in hormone and abiotic stress responses in Arabidopsis Frontiers in Plant Science 10. doi: 10.3389/fpls.2019.00228.
  » https://doi.org/10.3389/fpls.2019.00228
• Xing H, Bao Y, Wang B, et al 2016. Identification of small auxin-up RNA (SAUR) genes in Urticales plants: mulberry (Morus notabilis), hemp (Cannabis sativa) and ramie (Boehmeria nivea). Journal of Genetics 95: 119-129.
• Yu CS, Chen YC, Lu CH, Hwang JK. 2006. Prediction of protein subcellular localization. Proteins: Structure, Function, and Bioinformatics 64: 643-651.
• Zhang N, Huang X, Bao Y, et al 2017. Genome-wide identification of SAUR genes in watermelon (Citrullus lanatus). Physiology and Molecular Biology 23: 619-628.

Publication Dates

• Publication in this collection
  29 July 2022
• Date of issue
  2022

History

• Received
  23 Dec 2021
• Accepted
  18 Apr 2022