Association of Morpho-Physiological Traits to Identify Salinity Tolerance in Newly Developed Sugarcane Genotypes

Dhansu, Pooja; Kumar, Ravinder; Kumar, Ashwani; Preet, Kumar; Kundu, Antim; Kaushik, Shruti; Meena, Mintu Ram; Devi, Sunita; Kulshreshtha, Neeraj

doi:10.1590/1678-4324-2026250141

Article - Agricultural Technologies, Biotechnology and Environment • Braz. arch. biol. technol. 69 • 2026 • https://doi.org/10.1590/1678-4324-2026250141 linkcopy

Association of Morpho-Physiological Traits to Identify Salinity Tolerance in Newly Developed Sugarcane Genotypes

Authorship SCIMAGO INSTITUTIONS RANKINGS

Sugarcane is severely impacted by abiotic stresses and is cultivated across various agro-climatic environments. Hence, to evaluate the potential of twenty-four co-canes, we conducted an experiment under three levels of saline water irrigation viz., 4, 8 and 12 dS m^-1 EC_iw along with control (EC_iw ~ 0.4). Leaf chlorophyll content and SPAD index constantly decreased with increase in irrigation water salinity along with RWC which reduced by 3.88%, 12.51 % and 20.23% under 4, 8 and 12 dS m^-1 EC_iw, respectively. Similarly, gas exchange attributes (Pn, gS, E) decreased in the range of 8 - 10%; 20 - 30% and 35 - 47% respectively. On an average, Na⁺ ions accumulated in range of 0.478 - 1.194% and K⁺ content reduced by 25.09 - 56.27% under 4, 8, 12 dS m^-1 EC_iw, respectively. Sugar yield (CCS %) declined to 21.71, 53.08 and 67.38% and cane yield (t ha^-1) reduced by 19.34, 50.43 and 64.8 % with irrigation salinity of 4, 8 and 12 dS m^-1 EC_iw. Based on growth and yield parameters, these co-canes were categorized as tolerant (Co 15023, Co 0238, Co 13035 and Co 0118) and sensitive (Co 14036, Co 12027, Co 14026 and Co 13034). PCA biplot analysis and Association/Cluster analysis using heatmap also categorized these advanced lines into sensitive, moderately tolerant and tolerant category. Additionally, differential expression of salinity-responsive genes (SOS1, SOS2, SOS3, HKT, and NHX1) further distinguished tolerant genotypes like Co 13035 by their enhanced ionic homeostasis under salt stress. Briefly, we can say that physiological and ionic traits are important indictors in governing yield and identified tolerant advanced lines can be leveraged in hybridization programs aimed at developing new high-yielding, salt-tolerant breeding lines.

Keywords:
Sugarcane; Salinity; Physiology; Na⁺/K⁺; Yield; Cluster analysis; Correlations.

• Twenty four co-canes were evaluated with four levels of saline irrigation water viz., Control, ECiw ~ 4, 8 and 12 dS m-1.

• Co-canes Co 15023, Co 0238, Co 13035 and Co 0118 showed higher salt tolerance potential than other lines and maintain higher physiological traits along with yield.

• Co-canes Co 14036, Co 12027, Co 14026 and Co 13034 were highly sensitive towards water salinity.

• These co-canes accumulated Na+ ions in range of 0.478 - 1.194 %, while K+ content reduced by 25.09 - 56.27 % under ECiw ~ 4 dS m-1, ECiw ~ 8 dS m-1 and ECiw ~ 12 dS m-1, respectively.

• The identified sugarcane lines can be promoted further for detailed farmer field trails and can be included in breeding advancement for propagation.

Genes name	Primer name	Sequence (5’-3’)
*SoSOS1*	SoSOS1 Fw	GAGGGTTCTCATAGCTGAAAGG
*SoSOS1*	SoSOS1 Re	GCGTGATTAGAGTCAGGTTCTC
*SoSOS2*	SoSOS2 Fw	AGGTCTGAATGCTGACAAGAC
*SoSOS2*	SoSOS2 Re	CTCCTGCTGCTCTTTGTAGTT
*SoSOS3*	SoSOS3 Fw	CATCCACAAGGAGGAGTTTCA
*SoSOS3*	SoSOS3 Re	ATGACTCCGTTCCGTTTGAG
*SoNHX1*	SoNHX1 Fw	TGGTGGGCTGGACTGATGAGAGGCG
*SoNHX1*	SoNHX1 Re	TGCCGTGCAGCTGAGTGTGTCCAGA
*SoHKT*	SoHKT Fw	TCGGCTCTGGACCTACTCTT
*SoHKT*	SoHKT Re	ACGACGACGACTCTGCTCTA

Source of variation	DF	RWC	Chlorophyll content	SPAD reading	Pn	gS	E	Fv/Fm
Source of variation	DF	Mean sum of squares
Rep	2	0.565	0.0005	3.5206	0.0399	0.0001	0.0574	0.0004
Treatment (T)	3	4837.82**	7.12**	5023.54**	2661.65**	0.519**	119.7**	0.465**
Co-canes(G)	23	67.955**	73.63**	48.217**	68.159**	0.012**	2.83**	0.0107**
T × G	69	17.165**	36.868**	15.396**	20.856**	0.002**	0.488**	0.0053**
*Salinity treatments*
Control		90.62^A	1.63^A	56.39^A	29.11^A	0.53^A	8.41^A	0.640^A
EC_iw ~ 4 dS m^-1		87.1^B	1.45^B	49.19^B	25.66^B	0.48^B	7.73^B	0.606^B
EC_iw ~ 8 dS m^-1		79.28^C	1.14^C	43.31^C	20.13^C	0.41^C	6.67^C	0.536^C
EC_iw ~ 12 dS m^-1		72.29^D	0.93^D	36.8^D	15.32^D	0.34^D	5.45^D	0.459^D
CV (%)		2.138	1.371	2.145	2.892	2.906	1.225	1.689
HSD @ 5% (T)		1.02	0.01	0.57	0.38	0.01	0.05	0.01
*Co-canes*
Co 0118		78.69^FG	1.41^B	46.55^CDEFG	26.03^A	0.42^IJ	7.39^CD	0.532^G
Co 0237		82.16^BCDE	1.34^CDE	45.2^GHIJ	23.34^DEF	0.47^CD	7.54^BC	0.560^CDEF
Co 0238		82.66^ABCDE	1.35^CD	48.23^BC	26.1^A	0.51^A	7.41^CD	0.587^AB
CoS 767		81.6^CDEF	1.32^DEF	47.88^BCDE	19.4^J	0.49^BC	7.99^A	0.533^G
Co 1148		83.86^ABCDE	1.24^I	43.05^KL	25.06^B	0.44^FGHI	6.5^IJK	0.575^ABCD
Co 05009		85.57^AB	1.31^DEFG	46.03^FGHI	23.57^DE	0.44^EFG	7.42^CD	0.528^G
Co 05011		80.68^EF	1.18^J	46.03^FGHI	24.06^CD	0.46^DE	7.55^BC	0.540^FG
Co 06034		83.5^ABCDE	1.17^J	47.75^BCDEF	24.14^BCD	0.42^JK	7.2^DEF	0.542^FG
Co 11027		81.07^DEF	1.18^J	47.73^CDEF	22.23^G	0.44^EFGH	7.05^EFG	0.590^AB
Co 12026		83.23^ABCDE	1.28^FGHI	45.0^GHIJ	16.86^K	0.44^FGHI	6.25^KL	0.572^BCDE
Co 12027		83.84^ABCDE	1.31^DEFG	47.5^CDEF	24.1^CD	0.46^EF	6.71^HI	0.594^AB
Co 12029		84.78^ABC	1.29^FGH	50.08^A	22.34^G	0.44^FGHI	7.12^EFG	0.574^BCDE
Co 13033		82.14^BCDE	1.30^EFGH	46.38^DEFGH	22.65^EFG	0.44^FGHI	6.75^HI	0.587^AB
Co 13034		81.23^DEF	1.39^BC	46.13^EFGHI	21.27^HI	0.4^KL	6.87^GH	0.552^DEFG
Co 13035		83.29^ABCDE	1.27^GHI	49.58^AB	22.03^GH	0.39^LM	6.96^FGH	0.600^A
Co 13036		75.35^G	1.29^FGHI	44.15^JK	22.42^G	0.44^GHI	6.06^L	0.573^BCDE
Co 14034		83.79^ABCDE	1.18^J	44.5^IJK	20.98^I	0.45^EFG	6.41^JK	0.583^ABC
Co 14035		85.6^A	1.26^HI	45.1^GHIJ	22.45^FG	0.43^HIJ	7.24^DE	0.550^EFG
Co 14036		84.4^ABCD	1.32^DEF	47.55^CDEF	16.63^K	0.38^M	6.58^IJ	0.594^AB
Co 15023		84.05^ABCDE	1.17^J	47.85^BCDEF	23.67^D	0.44^FGHI	7.31^CDE	0.489^H
Co 15025		81.37^CDEF	1.38^BC	44.68^HIJK	22.43^FG	0.5^AB	7.06^EFG	0.498^H
Co 15026		78.59^FG	1.24^I	41.63^L	21.24^HI	0.41^JK	7.75^AB	0.585^AB
Co 15027		80.95^EF	1.30^EFGH	47.98^BCD	23.51^DE	0.4^KL	6.94^FGH	0.560^CDEF
Co 98014		83.34^ABCDE	1.45^A	47.63^CDEF	24.79^BC	0.45^EFG	7.55^BC	0.550^EFG
CV (%)		2.77	2.433	2.611	2.713	2.841	2.492	2.893
HSD @ 5% (G)		3.44	0.05	1.83	0.92	0.02	0.27	0.02
HSD @ 5% (T×G)		6.81	0.09	3.62	1.85	0.04	0.52	0.05

Source of variation	DF	Na⁺ (% DW)	K⁺ (% DW)	Na⁺/K⁺	Sugar yield (t/ha)	Cane yield (t/ha)
Source of variation	DF	Mean sum of squares
Rep	2	0.0008	0.0051	0.0003	0.138	14.258
Treatments (T)	3	14.348**	124.277**	3.226**	582.839**	37481.976**
Co-canes (G)	23	0.144**	3.419**	0.0339**	35.501**	2394.569**
T × G	69	0.0254**	0.689**	0.0129**	3.169**	187.545**
*Salinity treatments*
Control		0.14^D	5.58^A	0.02^D	9.35^A	77.67^A
EC_iw ~ 4 dS m^-1		0.48^C	4.18^B	0.12^C	7.32^B	62.65^B
EC_iw ~ 8 dS m^-1		0.74^B	3.51^C	0.22^B	4.39^C	38.5^C
EC_iw ~ 12 dS m^-1		1.19^A	2.44^D	0.51^A	3.05^D	27.34^D
CV (%)		4.2712	3.2601	10.157	10.735	9.593
HSD @ 5% (T)		0.02	0.07	0.01	0.37	2.85
*Co-canes*
Co 0118		0.61^GHIJ	3.72^IJ	0.21^FG	8.08^B	66.75^BC
Co 0237		0.58^JKL	3.71^IJ	0.19^GHI	4.02^I	29.55^HI
Co 0238		0.54^MN	5.28^A	0.12^K	7.63^BC	67.67^B
CoS 767		0.56^LM	3.35^KL	0.22^EF	4.17^HI	39.02^G
Co 1148		0.65^EF	3.1^M	0.29^C	5.65^DEF	54.57^DEF
Co 05009		0.61^GHI	4.2^DE	0.19^HIJ	4.39^GHI	39.66^G
Co 05011		0.73^D	4.47^B	0.21^EF	6.66^CD	59.93^BCDE
Co 06034		0.6^HIJK	4.13^EF	0.17^J	4.76^FGHI	37.36^GH
Co 11027		0.57^LM	4.2^DE	0.18^IJ	3.98^I	40.1^G
Co 12026		0.77^C	4.01^FG	0.26^D	4.53^GHI	37.19^GH
Co 12027		0.52^N	3.79^HIJ	0.21^FG	3.86^I	28.51^I
Co 12029		0.58^JKL	4.46^BC	0.17^J	7.42^BC	61.14^BCD
Co 13033		0.57^LM	4.28^DE	0.19^GH	4.76^FGHI	39.82^G
Co 13034		0.58^KL	3.43^K	0.25^D	6.08^DE	50.02^F
Co 13035		0.51^N	3.81^HIJ	0. 18^HIJ	7.57^BC	59.12^CDE
Co 13036		0.66^E	3.66^J	0.22^EF	5.41^EFG	50.87^F
Co 14034		0.97^A	3.91^GH	0.32^B	7.96^B	64.45^BC
Co 14035		0.62^FGH	3.24^LM	0.25^D	4.42^GHI	38.32^G
Co 14036		0.79^C	4.43^BC	0.25^D	7.52^BC	78.26^A
Co 15023		0.63^EFG	4.04^FG	0.19^HIJ	9.29^A	66.71^BC
Co 15025		0.58^IJKL	4.15^EF	0.18^IJ	5.99^DE	49.65^F
Co 15026		0.66^E	3.82^HI	0.21^EF	5.14^EFGH	52.29^EF
Co 15027		0.57^LM	2.74^N	0.37^A	9.42^A	75.78^A
Co 98014		0.84^B	4.31^CD	0.23^E	5.97^DE	50.3^F
CV (%)		2.987	2.591	5.189	12.166	10.099
HSD @ 5% (G)		0.03	0.15	0.02	1.11	7.85
HSD @ 5% (T × G)		0.06	0.31	0.04	2.20	15.63

location_on

Instituto de Tecnologia do Paraná - Tecpar Rua Prof. Algacyr Munhoz Mader, 3775 - CIC, 81350-010 , Tel: +55 41 3316-3054 - Curitiba - PR - Brazil
E-mail: babt@tecpar.br

rss_feed Acompanhe os números deste periódico no seu leitor de RSS

[1] Means with at least one letter common are not statistically significant (p < 0.05) using Tukey’s Test.

[TFN1] ^**
Represent significant at p<0.01.