First genome characterization and prevalence of grapevine leafroll-associated virus 2 (GLRaV-2) belonging to the RG phylogroup in Peruvian commercial vineyards

Primeira caracterização genômica do grapevine leafroll-associated virus 2 (GLRaV-2), pertencente ao filogrupo RG, e sua prevalência em vinhedos comerciais peruanos

Abstract

Table grape production is one of the most important agricultural export activities in Peru. However, its productivity can be compromised by viral diseases, including grapevine leafroll-associated virus 2 (GLRaV-2), a pathogen widely distributed in grape-growing regions worldwide. The present study aimed to characterize the genomes of Peruvian GLRaV-2 isolates from different grape-growing regions using high-throughput sequencing (HTS) and to assess the prevalence of the virus in commercial vineyards located in Ica region. To achieve these objectives, GLRaV-2-infected grapevine plants from the Peruvian regions of Ica, Piura, and Lambayeque were collected between 2023 and 2025 and analyzed using HTS. Bioinformatic analyses enabled the reconstruction of the complete genome of GLRaV-2-TI85, as well as four near-complete genomes corresponding to isolates GLRaV-2-TP12, GLRaV-2-TC108, GLRaV-2-TC109, and GLRaV-2-TI83. The complete genome of GLRaV-2-TI85 was 16,495 nt in length and had a GC content of 44.7%. The representative isolate GLRaV-2-TI85 shared 99.7% nucleotide identity with a previously reported U.S. isolate and retained the conserved viral domains characteristic of GLRaV-2. Bayesian phylogenetic analysis clustered all Peruvian isolates within the RG phylogroup, a lineage associated with graft incompatibility and grapevine leafroll symptoms. Field surveys further revealed that GLRaV-2 was present in 20.3% of the sampled grapevine plants in Ica, with the largest numbers of GLRaV-2-positive vines detected in ‘Autumn Crisp’ and ‘Sweet Globe’, both of which are extensively cultivated for export. Overall, this study provides the first genomic characterization of Peruvian GLRaV-2 isolates and demonstrates the occurrence of this virus in commercial vineyards of the Ica region. These findings contribute to a better understanding of the genetic diversity and distribution of GLRaV-2 in the Peruvian grape industry and provide valuable information for future disease management and certification programs.

Keywords:
Vitis vinifera; epidemiology; closterovirus; High-Throughput Sequencing (HTS); phytosanitary management

Resumo

A produção de uvas de mesa constitui uma das atividades agroexportadoras mais importantes do Peru. No entanto, sua produtividade pode ser comprometida por doenças virais, incluindo o grapevine leafroll-associated virus 2 (GLRaV-2), um patógeno amplamente distribuído nas regiões vitivinícolas em todo o mundo. O presente estudo teve como objetivos caracterizar os genomas de isolados peruanos de GLRaV-2 provenientes de diferentes regiões produtoras de uva, utilizando sequenciamento de alto rendimento (HTS), e avaliar a prevalência do vírus em vinhedos comerciais localizados na região de Ica. Para isso, plantas de videira infectadas com GLRaV-2, provenientes das regiões peruanas de Ica, Piura e Lambayeque, foram coletadas entre 2023 e 2025 e analisadas por meio de HTS. As análises bioinformáticas permitiram reconstruir o genoma completo de GLRaV-2-TI85, bem como quatro genomas quase completos correspondentes aos isolados GLRaV-2-TP12, GLRaV-2-TC108, GLRaV-2-TC109 e GLRaV-2-TI83. O genoma completo de GLRaV-2-TI85 apresentou 16.495 nt de comprimento e conteúdo de GC de 44,7%. O isolado representativo GLRaV-2-TI85 apresentou 99,7% de identidade nucleotídica com um isolado previamente relatado nos Estados Unidos e manteve os domínios virais conservados característicos de GLRaV-2. A análise filogenética bayesiana agrupou todos os isolados peruanos no filogrupo RG, uma linhagem associada à incompatibilidade de enxertia e aos sintomas de enrolamento foliar da videira. Os levantamentos de campo revelaram ainda que GLRaV-2 estava presente em 20,3% das plantas de videira amostradas em Ica, sendo os maiores números de plantas positivas para GLRaV-2 detectados nas cultivares ‘Autumn Crisp’ e ‘Sweet Globe’, ambas amplamente cultivadas para exportação. De modo geral, este estudo apresenta a primeira caracterização genômica de isolados peruanos de GLRaV-2 e demonstra a ocorrência desse vírus em vinhedos comerciais da região de Ica. Esses resultados contribuem para uma melhor compreensão da diversidade genética e da distribuição de GLRaV-2 na viticultura peruana e fornecem informações relevantes para futuros programas de manejo da doença e certificação.

Palavras chave:
Vitis vinifera; epidemiologia; closterovírus; Sequenciamento de Alto Rendimento (HTS); manejo fitossanitário

1. Introduction

Table grapes represent one of Peru’s most important agricultural export commodities, generating substantial economic revenue and playing a significant social role through the creation of formal agricultural employment (ADEX, 2023; MIDAGRI, 2025). Grape production is exposed to various factors that can negatively affect yield and fruit quality (Fraga et al., 2012). Among these, viral diseases constitute one of the main phytosanitary limitations due to their economic impact, pathogenicity, and ability to spread through infected plant material (Elad and Pertot, 2014; Venios et al., 2020; Rienth et al., 2021; Ertunc, 2020). This risk is particularly significant in Peru, where the rapid expansion of licensed cultivars such as ‘Sweet Globe’ and ‘Autumn Crisp’, which together represent approximately 39% of the area cultivated with table grapes (USDA, 2025), requires the intensive multiplication and movement of propagation material. Because grapevines are propagated vegetatively through cuttings, buds, and grafts, the use of infected material could facilitate the introduction and dissemination of viruses. Globally, four major viral disease complexes have been recognized in grapevine (Naidu et al., 2014; Basso et al., 2017; Meng et al., 2017; Schoelz et al., 2021). The first is grapevine leafroll disease, which is associated with several closteroviruses, including grapevine leafroll-associated virus 1, 2, 3, 4, 7, and 13 (GLRaV-1, GLRaV-2, GLRaV-3, GLRaV-4, GLRaV-7, and GLRaV-13) (Naidu et al., 2014). The second is the rugose wood complex, which is associated with the vitiviruses grapevine virus A (GVA) and grapevine virus B (GVB), as well as the foveavirus grapevine rupestris stem pitting-associated virus (GRSPaV) (Constable et al., 2013; Martelli, 2014). The third comprises grapevine degeneration and decline diseases, which are mainly linked to several nepoviruses. Grapevine degeneration has been associated with grapevine fanleaf virus (GFLV) (Andret-Link et al., 2004), tomato black ring virus (TBRV), arabis mosaic virus (ArMV), raspberry ringspot virus (RpRSV), grapevine chrome mosaic virus (GCMV), grapevine Bulgarian latent virus (GBLV), artichoke Italian latent virus (AILV), and strawberry latent ringspot virus (SLRSV) (Martelli, 2014). In contrast, grapevine decline has been related to tomato ringspot virus (ToRSV), tobacco ringspot virus (TRSV), peach rosette mosaic virus (PRMV), and blueberry leaf mottle virus (BLMoV) (Harrison and Murant, 1977; Stace-Smith and Ramsdell, 1987). Finally, fleck disease is caused by grapevine fleck virus (GFkV), a member of the genus Maculavirus (Martelli, 2014; Basso et al., 2017).

In Peru, several grapevine viruses were initially reported based on symptomatological and serological evidence, including GFkV, GFLV, GLRaV-1, GLRaV-3, and ToRSV (Fribourg, 2007; Gonzales-Llontop, 2016). Subsequent RT-PCR analyses confirmed the presence of GLRaV-2 and GFkV (Gonzales-Llontop, 2016). More recently, grapevine pinot gris virus (GPGV) was detected by RT-PCR in commercial vineyards located in the Ica region (Sánchez-Moncada and Álvarez, 2025). Furthermore, Cuya et al. (2026a), using high-throughput sequencing (HTS) validated by RT-PCR and Sanger sequencing, reported for the first time the occurrence of GRSPaV, GVB, grapevine syrah virus-1 (GSyV-1), and grapevine red globe virus (GRGV) in grapevine samples collected from the regions of Ica, La Libertad, and Lambayeque. Despite these advances, genomic information on several grapevine viruses present in Peru remains limited, particularly for GLRaV-2.

Grapevine leafroll-associated virus 2 (GLRaV-2) is a positive-sense single-stranded RNA [ssRNA(+)] virus with a genome of approximately 16.5 kb and belongs to the genus Closterovirus within the family Closteroviridae (ICTV, 2024). Its genome comprises nine open reading frames (ORFs), designated ORF1a, ORF1b, and ORF2–ORF8, flanked by untranslated regions (UTRs) at both the 5′ and 3′ termini. Symptoms associated with GLRaV-2 infection are highly variable and range from latent infections to leaf rolling, vine decline, and foliar necrosis (Bertazzon et al., 2010; Poojari et al., 2013; Angelini et al., 2017; Habili et al., 2023). The virus is primarily disseminated through grafting and vegetative propagation of infected plant material, while no biological vector has yet been identified (Angelini et al., 2017; Habili et al., 2023).

Genetic diversity studies have identified six major phylogenetic lineages within GLRaV-2, namely PN, 93/955, H4, PV20, BD, and RG. These lineages were initially defined based on sequence analyses of the coat protein (CP) gene and a portion of the heat shock protein 70 homolog (HSP70h) gene (Jarugula et al., 2010; Fonseca et al., 2016). More recent investigations based on complete genome analyses have further supported this classification and revealed associations between specific lineages and biological traits, such as the graft incompatibility phenotype linked to the RG group (Habili et al., 2023). GLRaV-2 viruses belonging to the RG phylogroup pose a significant risk to viticulture, as they may not produce obvious symptoms of leaf curl but can induce graft incompatibility, reduce graft take, and cause plant death when combined with susceptible rootstocks. Because this response depends on the interaction between the viral isolate, the variety, and the rootstock, visual inspection is insufficient to guarantee the health of the plant material. Therefore, early diagnosis and the use of certified, virus-free propagation material are fundamental measures to prevent their introduction and spread in vineyards (Bertazzon et al., 2010; Alkowni et al., 2011; Velasco and Padilla, 2021).

Furthermore, the detection and characterization of plant viruses can be performed using serological, molecular, and high-throughput sequencing (HTS) methods, which should be considered complementary. Small RNA high-throughput sequencing (sRNA-HTS) is particularly useful for identifying known and emerging viruses because it recovers small RNAs derived from the plant's antiviral RNA-silencing mechanism; however, the short length and uneven distribution of these reads can lead to fragmented assemblies. In contrast, total RNA sequencing, preferably with ribosomal RNA depletion, produces longer contigs and facilitates the reconstruction of complete or nearly complete genomes, including viruses with extensive genomes such as GLRaV-2, which is approximately 16.5 kb. Consequently, combining sRNA-HTS and total RNA high-throughput sequencing (total RNA-HTS) constitutes a robust strategy for characterizing the virome and completing viral genomes (Kreuze et al., 2009; Pecman et al., 2017; Sidharthan et al., 2020).

Therefore, the objectives of the present study were to assemble consensus genome sequences of GLRaV-2 from sequencing data, characterize the genomes of Peruvian isolates, and determine their phylogenetic relationship with reference isolates of the same species. In addition, the prevalence of GLRaV-2 was assessed in commercial vineyards in the Ica region, the principal table grape-producing and exporting area of Peru.

2. Materials and Methods

2.1. GLRaV-2 sequences from Peruvian isolates

As part of the Peruvian Grapevine Virome project (PGV, funded by Prociencia, Contract No. PE501078859-2022) (Cuya et al., 2026b, unpublished data), high-throughput sequencing (HTS) data of small RNAs (sRNA) were generated from grapevine leaf samples. Among the GLRaV-2-positive samples identified in this project, TI85, obtained from cultivar ‘Candy Dreams’ in the Ica region, was selected as the main representative for detailed genome reconstruction and characterization. Initial analyses by Cuya et al. (2026b, unpublished data) revealed that this sample contained the most robust set of viral contigs with high similarity to grapevine leafroll-associated virus 2 (GLRaV-2), particularly to the GenBank reference sequence AF314061. Additional GLRaV-2-related contigs were also detected in samples TP12 (‘Sweet Globe’, Piura), TI83 (‘Candy Dreams’, Ica), TC108 (‘Red Globe’, Lambayeque), and TC109 (‘Jack Salute’, Lambayeque), which were considered complementary isolates for comparative and phylogenetic analyses.

2.2. Total RNA sequencing

To validate the consensus sequence reconstructed with Geneious from the sRNA-HTS dataset, total RNA extracted from the same TI85 sample was subjected to an independent HTS analysis using the Illumina NovaSeq X Plus platform. Sequencing was performed in a paired-end 150 bp (PE150) format, yielding approximately 96 million reads. This additional dataset was used to corroborate the viral sequence obtained from the sRNA-based assembly.

2.3. Bioinformatics Analysis and Genome Reconstruction from sRNA-HTS Data

For the GLRaV-2-TI85 isolate, clean reads obtained by small RNA sequencing (sRNA-HTS) were mapped against the GLRaV-2 AF314061 reference genome using a reference-guided approach in Geneious R11 (Kearse et al., 2012). A preliminary consensus sequence was generated from the mapped reads and subsequently used to complement the genome reconstruction obtained by total RNA sequencing.

To expand the genomic characterization of GLRaV-2 in different wine-growing regions of Peru, clean reads of the sRNA-HTS datasets corresponding to samples TP12, TI83, TC108, and TC109, generated within the framework of the Peruvian Grapevine Virome (PGV) project, were mapped against the GLRaV-2 reference genome AF314061 using BWA v0.7.10 (Li and Durbin, 2009) and Bowtie 2 (Langmead and Salzberg, 2012). The mapped reads were used to reconstruct nearly complete viral consensus sequences for each isolate, which were subsequently used in comparative and phylogenetic analyses.

2.4. Bioinformatics analysis and genome assembly from Total-HTS RNA data of the TI85 isolate

Total RNA (total-HTS RNA) sequencing data from the TI85 isolate were processed using the Galaxy Australia bioinformatics platform (Galaxy Community, 2024). The quality of the raw reads was assessed using FastQC v0.12.1 (Andrews, 2010), and adapter sequences and low-quality reads were removed using Trimmomatic v0.36 (Bolger et al., 2014). The processed reads were used for de novo assembly with SPAdes v4.2.0 (Prjibelski et al., 2020). Host-derived sequences were identified by mapping against a Vitis vinifera reference genome using Bowtie 2.

The resulting contigs were imported into Geneious R11 (Kearse et al., 2012) and analyzed by BLASTn against reference viral sequences. Contigs showing >95% nucleotide identity with GLRaV-2 were selected for viral consensus sequence reconstruction.

To obtain a more complete GLRaV-2-TI85 genomic sequence, the consensus derived from total HTS RNA was aligned and compared with the consensus sequence previously reconstructed from sHTS RNA data. Incomplete or underrepresented genomic regions in one dataset were supplemented using information available in the other. The regions that remained unresolved after integrating both datasets were subsequently verified and completed using RT-PCR and Sanger sequencing, as described in Section 2.5.

2.5. Gap filling and validation of HTS-derived viral sequences via RT-PCR and Sanger sequencing

2.5.1. Primer design

To confirm the viral sequences obtained by HTS and resolve genomic regions that remained incomplete during bioinformatic assembly, specific primer pairs were designed using Primer3Plus (Untergasser et al., 2012) based on the hybrid consensus sequence generated from the combined sRNA-HTS and total RNA-HTS datasets. Primer design criteria restricted melting temperatures close to 60 °C to ensure efficient amplification at a standard annealing temperature of 55 °C. Oligonucleotide lengths ranged from 20 to 23 nucleotides, with a GC content between 50% and 60%. Candidates primers with the potential to form secondary structures, including self-dimers and cross-dimers, were excluded. Only primers with predicted Gibbs free energy (ΔG) values higher than or equal to −9 kcal/mol for hairpin and dimer formation were retained, following the criteria described by Apte and Daniel (2009).

2.5.2. Reverse Transcription Polymerase Chain Reaction (RT-PCR) and sequencing

RT-PCR assays were performed to validate HTS-derived sequences and amplify genomic regions of interest. First-strand cDNA was synthesized from total RNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA; Part No. M170A), following the manufacturer’s protocol.. Briefly, total RNA was mixed with random primers and nuclease-free water, denatured at 70 °C for 5 min, and immediately chilled on ice. The reverse transcription reaction was then performed in a final volume of 25 µL containing 1X M-MLV reaction buffer, dNTPs, Recombinant RNasin® Ribonuclease Inhibitor, and 200 U of M-MLV Reverse Transcriptase, followed by incubation at 37 °C for 60 min. PCR amplification was subsequently carried out using GoTaq® G2 Flexi DNA Polymerase (Promega, Madison, WI, USA; Cat. No. M7801). Reactions were performed in a final volume of 20 µL containing 1X Colorless GoTaq® Flexi Buffer, 2.5 mM MgCl₂, 0.2 mM each dNTP, 0.3 µM of each primer, 0.6 U of GoTaq® G2 Flexi DNA Polymerase, cDNA, and nuclease-free water. Amplifications were conducted under the following cycling conditions: an initial denaturation at 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 55 °C for 1 min, and 72 °C for 1 min, with a final extension at 72 °C for 10 min. PCR amplicons were resolved by electrophoresis on 0.8% agarose gels prepared in 0.5x TBE buffer and stained with GelRed® for visualization. Products of the expected size were purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA, USA) and subjected to bidirectional Sanger sequencing at Macrogen Inc. (Seoul, South Korea) to confirm HTS-derived sequences and complete unresolved regions of the viral genome.

2.6. Molecular characterization of the viral genome

Open reading frames (ORFs) in the reconstructed viral genome were predicted using NCBI ORFfinder (NCBI, 2026), with genetic code standard and start codon parameter set to “ATG only”. The resulting amino acid sequences were analyzed for conserved domains and functional motifs using the Motif Search platform available through GenomeNet. The genomic coordinates of predicted ORFs and conserved motifs were documented to complete the molecular characterization of the Peruvian isolate GLRaV-2-TI85. Finally, the complete and near-complete GLRaV-2 genome sequences assembled from samples TP12, TI83, TI85, TC108, and TC109 were deposited in the NCBI GeneBank database.

2.7. Phylogenetic analysis

2.7.1. Dataset construction

GLRaV-2 genomic sequences available in the National Center for Biotechnology Information (NCBI) database were retrieved and compiled for phylogenetic analyses. Based on sequence availability and genomic coverage, several datasets were generated, including a complete genome dataset (dataset_complete; n = 83), an HSP70h gene dataset (dataset_HSP70; n = 71), an RNA-dependent RNA polymerase gene dataset (dataset_RdRP; n = 71), and a coat protein gene dataset (dataset_CP; n = 86). Sequences obtained in the present study were incorporated into each dataset to enable comparative analyses with previously reported GLRaV-2 isolates. The HSP70h, CP, and RdRp genomic regions were selected because of their recognized taxonomic significance within the family Closteroviridae. These gene products are regarded by the International Committee on Taxonomy of Viruses (ICTV) as key criteria for species demarcation within the genus Closterovirus (Fuchs et al., 2020).

2.7.2. Recombination analysis

Potential recombination events were investigated using the dataset designated as “dataset_complete” and analyzed with RDP4 software (Martin et al., 2015). Detection was performed using the RDP, GENECONV, BootScan, MaxChi, Chimaera, SiScan, and 3Seq algorithms. To minimize false-positive results, only recombination signals supported by at least three independent methods were considered credible. In addition, a stringent significance threshold of p < 0.05 was applied. Sequences identified as putative recombinants were removed from the dataset and excluded from subsequent phylogenetic analyses.

Sequences identified as putative recombinants were removed before phylogenetic reconstruction. Consequently, after exclusion of the nine recombinant sequences, the final nearly complete genome dataset used for phylogenetic inference comprised 74 sequences.

2.7.3. Bayesian Inference

To determine the phylogenetic placement of the GLRaV-2 sequences obtained in this study, Bayesian phylogenetic trees were reconstructed for each dataset, “dataset_complete”, “dataset_HSP70”, “dataset_RdRP”, “dataset_CP”. Multiple sequence alignments were generated independently for each dataset using MAFFT v7.450 (Katoh and Standley, 2013). The best-fit nucleotide substitution model for each alignment was subsequently determined with jModelTest v2.1.10 (Darriba et al., 2012) based on the Akaike Information Criterion (AIC). Bayesian phylogenetic inference was performed in BEAST X v10.5.0 (Baele et al., 2025) using Markov chain Monte Carlo (MCMC) analyses run for 30 million generations. Parameter convergence and effective sample size (ESS) values were assessed in Tracer v1.7.1 (Rambaut et al., 2018), with ESS values greater than 200 considered indicative of adequate sampling. After discarding the first 10% of the sampled states as burn-in, a maximum clade credibility (MCC) tree was generated. The resulting phylogenies were visualized and edited using FigTree v1.4.4 (Rambaut, 2018).

2.8. Pairwise identity analysis

To assess nucleotide similarity among GLRaV-2 isolates, the sequences in the “dataset_complete” were aligned in Geneious R11 using the MAFFT algorithm implemented in the program (Katoh and Standley, 2013; Kearse et al., 2012). From the resulting alignment, pairwise nucleotide identities were calculated among the isolates included in the study. The identity matrix generated by Geneious was exported and subsequently represented as a heat map to visualize the patterns of nucleotide similarity and divergence among the analyzed isolates.

2.9. Prevalence of GLRaV-2

2.9.1. Sample collection

GLRaV-2 prevalence was assessed by RT-PCR in commercial table grape vineyards from Ica, Peru. Between October 2024 and March 2025, 153 grapevine plants were randomly sampled from six vineyards, including two in Pampas de Villacurí (n = 55) and four in the Ica Valley (n = 98) (Table S1, Supplementary Material), regardless of symptom expression. For each plant, approximately 30-cm shoots bearing mature and young leaves were collected, wrapped in paper towels moistened with sterile distilled water, placed in sealed zip-lock bags, and transported on dry ice to the Phytovirology Laboratory at Universidad Nacional Agraria La Molina (UNALM) for analysis.

2.9.2. Detection of GLRaV-2 by RT-PCR

Total RNA was extracted from grapevine leaf samples following the protocol described by Bekesiova et al. (1999). GLRaV-2 detection was performed by RT-PCR using the primer pair P19qtF/P24qtR, which amplifies a partial genomic region spanning the p19 and p24 genes (Beuve et al., 2007). Subsequently, fifteen GLRaV-2-positive samples were further analyzed by RT-PCR using the primer pairs RGHSP227/RGHSP777 targeting the HSP70h gene (Alkowni et al., 2011) and V2dCPf2/V2CPr1 targeting the coat protein (CP) gene (Bertazzon and Angelini, 2004). The resulting amplicons were purified and subjected to Sanger sequencing. The obtained sequences were identified by BLASTn analysis and subsequently used for phylogenetic reconstruction.

3. Results

3.1. Detection and prevalence of GLRaV-2 in commercial vineyards

RT-PCR analysis confirmed the presence of GLRaV-2 in commercial grapevine plantations in the Ica region with an overall prevalence of 20.3% (31/153). The highest prevalence was recorded in Vineyard 1 from the Ica Valley, with 31.4% positive samples (11/35), followed by Vineyard 5, also from the Ica Valley, with 28.6% (4/14). Lower prevalence values were observed in Vineyard 3 (18.2%; 6/33), Vineyard 2 (16.0%; 4/25), Vineyard 4 (13.3%; 4/30), and Vineyard 6 (12.5%; 2/16). Overall, vineyard blocks from the Ica Valley showed a higher prevalence of GLRaV-2 than those from the Villacurí region, with 23.5% and 14.5%, respectively (Figure 1).

Figure 1
Prevalence of GLRaV-2 in grapevine samples collected from vineyard fields in Ica, Peru. (A) Overall prevalence of GLRaV-2 among the analyzed samples. Red indicates GLRaV-2-positive samples, and green indicates negative samples. (B) GLRaV-2 prevalence by vineyard field. Percentages inside the bars indicate the proportion of positive and negative samples, and sample size is shown below each bar.

3.2. Field symptoms associated with GLRaV-2 infection

Among the 31 samples that tested positive for GLRaV-2 (Table S2, Supplementary Material), both symptomatic and asymptomatic vines were detected, indicating considerable variation in symptom expression among the cultivars evaluated. No visible symptoms were observed in the infected vines of 'Candy Hearts', 'Red Globe', 'Sable', 'Tawny', and 'Timpson' during field inspections. In contrast, symptom expression in 'Autumn Crisp' ranged from asymptomatic infections to the presence of chlorotic spots and foliar mosaic patterns. A similar trend was observed in 'Sweet Celebration', where both symptomless vines and plants exhibiting chlorotic leaf spots were identified. 'Sweet Globe' displayed the widest range of symptoms, including asymptomatic infections, chlorotic spotting, and leaf reddening (Figure 2).

Figure 2
Field symptom expression associated with GLRaV-2 infection. Symptom expression ranged from asymptomatic infections (A) to visible foliar alterations including chlorotic spots (B), mosaic patterns (C), and leaf reddening (D). Overall, considerable variability in symptom expression was observed among infected grapevines under field conditions. Ica, Peru 2024 and 2025.

3.3. Genome sequencing and assembly of Peruvian GLRaV-2 isolate

Five Peruvian GLRaV-2 genomic sequences were assembled and deposited in the NCBI database. The isolates were designated as GLRaV-2-TP12 (GenBank: PZ512726), originating from the Piura region; GLRaV-2-TC108 (GenBank: PZ512728) and GLRaV-2-TC109 (GenBank: PZ512729), from the Lambayeque region; and GLRaV-2-TI83 (GenBank: PZ512727) and GLRaV-2-TI85 (GenBank: PZ512730), both from the Ica region.

The consensus sequence of the representative isolate GLRaV-2-TI85, initially generated from sRNA-derived contigs, contained approximately 20 gaps. These unresolved regions were subsequently resolved using HTS data obtained from total RNA (total RNA-HTS), resulting in an improved consensus sequence with only three remaining gaps. The final genome sequence was assembled by integrating data from sRNA-HTS, total RNA-HTS, and Sanger sequencing.

3.4. Gap filling and validation of the GLRaV-2-TI85 genomic sequence

Three primer pairs specific to the GLRaV-2-TI85 isolate were designed to verify the genome assembly and complete unresolved regions of the viral genome sequence. Amplification with these primers produced single bands on agarose gels, corresponding to two partial fragments of the methyltransferase/helicase polyprotein (435 bp and 596 bp) and one fragment of the HSP70 gene (562 bp) (Table 1). Sequence analysis of the resulting amplicons revealed 99.99% nucleotide identity with the GLRaV-2-TI85 consensus genome sequence, providing additional support for the accuracy of the assembled genome.

Table 1
Specific primers designed for RT-PCR validation and Sanger sequencing of the GLRaV-2-TI85 isolate.

Primer pair	Primer name	Sequence (5′–3′)	Target region	Tm (°C)	Amplicon size (bp)
GLRaV285-K	GLRaV285-KF	GGTTCCCCCTATAAAATAGGTACTGG	HSP70	60.1	562
	GLRaV285-KR	CCCTTTAGCGGTAAACTATTTCCGC		60.4
GLRaV285-H	GLRaV285-HF	GCGGGATACCCTTTCTCACGG	Met/Hel polyprotein	59.3	596
	GLRaV285-HR	TTTCCTTCGCTTTCACCCTTAACG		59.6
GLRaV285-2	GLRaV285-2F	GTCGGAAGTGCGCCCAATA	Met/Hel polyprotein	60	435
	GLRaV285-2R	CGCAGAACAAAAGAGGTCGC		60.1

The integration of sRNA-HTS, total RNA-HTS, and Sanger sequencing data yielded the final genome sequence of GLRaV-2-TI85, with a length of 16,495 nt and a GC content of 44.7%. Comparative analysis showed 99.7% nucleotide identity with the reference sequence AF314061, corresponding to a GLRaV-2 isolate from grapevine cv. ‘Red Globe’ reported in the United States.

3.5. Molecular characterization of Peruvian GLRaV-2 isolates

Analysis of the GLRaV-2-TI85 isolate's genomic sequence using ORFfinder identified nine characteristic GLRaV-2 coding regions. ORF1a, encoding the replicase polyprotein and containing the papain-like protease (P-Pro), methyltransferase (MTR), and helicase (HEL) domains, was located between nucleotide positions 107 and 8902, with a length of 8,796 nt and a predicted protein length of 2,931 amino acids. ORF1b, encoding the RNA-dependent RNA polymerase (RdRp), extended from position 8901 to 10280, with a length of 1,380 nt and a predicted protein length of 459 amino acids. ORF1a and ORF1b showed a two-nucleotide overlap, and a programmed ribosomal frameshift of +1 was predicted in the transition region between the two ORFs. In the central region of the genome, ORF2, ORF3, and ORF4, which encode the small hydrophobic protein p6, heat shock protein 70 homolog (HSP70h), and heat shock protein 90 homolog (HSP90h), were located at positions 10373–10543, 10552–12351, and 12278–13882, respectively. Toward the 3′ end of the genome, ORF5, ORF6, ORF7, and ORF8, which encode the duplicated capsid protein (CPd), the major capsid protein (CP), p19, and p24, were located at positions 13845–14516, 14604–15200, 15200–15685, and 15687–16304, respectively. The same annotation procedure was applied to the additional Peruvian isolates GLRaV-2-TP12 (Piura), GLRaV-2-TI83 (Ica), GLRaV-2-TC108 and GLRaV-2-TC109 (Lambayeque), whose genomic coordinates and predicted protein lengths are presented in Table 2.

Table 2
Predicted coding regions in the genome of the GLRaV-2 isolates.

Predicted product	ORF	GLRaV-2-TI85	GLRaV-2-TP12	GLRaV-2-TI83	GLRaV-2-TC108	GLRaV-2-TC109	Length (nt)	Length (aa)
Replicase polyprotein (P-Pro, MTR, HEL)	ORF1a	107–8902	107–8902	107–8902	106–8901	106–8901	8796	2931
RNA-dependent RNA polymerase (RdRp)	ORF1b	8901–10280*	8901–10280*	8901–10280*	8900–10279**	8900–10279**	1380	459
Protein 6 (p6)	ORF2	10373–10543	10373–10543	10373–10543	10372–10542	10372–10542	171	56
Heat shock protein 70 homolog (HSP70h)	ORF3	10552–12351	10552–12351	10552–12351	10551–12350	10551–12350	1800	599
Heat shock protein 90 homolog (HSP90h)	ORF4	12278–13882	12278–13882	12278–13882	12277–13881	12277–13881	1605	534
Coat protein duplicate (CPd)	ORF5	13845–14516	13845–14516	13845–14516	13844–14515	13844–14515	672	223
Major coat protein (CP)	ORF6	14604–15200	14604–15200	14604–15200	14603–15199	14603–15199	597	198
p19	ORF7	15200–15685	15200–15685	15200–15685	15199–15684	15199–15684	486	161
p24	ORF8	15687–16304	15687–16304	15687–16304	15686–16303	15686–16303	618	205

• ^*
  Predicted +1 programmed ribosomal frameshift at nt 8900 in GLRaV-2-TI85, GLRaV-2-TP12, and GLRaV-2-TI83.
• ^**
  Corresponding predicted +1 programmed ribosomal frameshift at nt 8899 in GLRaV-2-TC108 and GLRaV-2-TC109.
• Amino-acid lengths exclude the terminal stop codon.

3.6. Recombination analysis

Recombination analysis performed with RDP4 on the initial “dataset_complete” of 83 GLRaV-2 genomic sequences identified nine putative recombinant sequences: MH814493, MW046649, MW046651, MW046663, MW046681, MW046684, MW046685, MW046691, and OR640977. The strongest recombination signals were detected for MH814493, MW046663, and MW046684, with minimum p-values of 1.03 × 10⁻¹⁰⁵, 6.38 × 10⁻³⁹, and 9.09 × 10⁻³⁵, respectively (Table S3, Supplementary Material). The nine recombinant sequences were excluded from subsequent phylogenetic analyses, resulting in a final dataset of 74 sequences. No evidence of recombination was detected in the Peruvian GLRaV-2 isolates under the criteria applied in this study.

3.7. Bayesian inference

Bayesian phylogenetic analysis based on complete and near-complete genome sequences showed that the five Peruvian GLRaV-2 isolates (GLRaV-2-TP12, GLRaV-2-TC108, GLRaV-2-TC109, GLRaV-2-TI83, and GLRaV-2-TI85) clustered within the RG phylogroup, with strong posterior probability support. These isolates clustered with sequences AF314061, PP003007, KU50867, MT899926, and MN548394, corresponding to GLRaV-2 isolates from the United States, Chile, China, Canada, and Slovenia, respectively (Figure 3). Phylogenetic analysis based on the nucleotide sequence of the RNA-dependent RNA polymerase (RdRp) coding region showed a similar topology, with the Peruvian isolates clustering within the RG phylogroup together with reference isolates belonging to this lineage (Figure S2, Supplementary Material).

Figure 3
Bayesian phylogenetic tree of grapevine leafroll-associated virus 2 (GLRaV-2) inferred from nearly complete genome sequences. Bayesian posterior probabilities are shown at the nodes. Sequences of the Peruvian isolates GLRaV-2-TI85, GLRaV-2-TP12, GLRaV-2-TI83, GLRaV-2-TC108, and GLRaV-2-TC109 are highlighted in red and cluster within the RG phylogroup. Terminal labels indicate GenBank accession number, isolate name, and country of origin. Phylogroups PN, 93/955, H4, RG, BD, and PV20 are indicated along the tree. PE, Peru; SAF, South Africa; CHI, Chile; CHIN, China; USA, United States; CAN, Canada; SLO, Slovenia; AUS, Australia; RU, Russia; BR, Brazil; IT, Italy.

Phylogenetic analyses based on partial regions of the CP and/or HSP70h genes showed that the fifteen additional GLRaV-2 isolates detected in Ica also clustered within the RG lineage, with strong posterior support (PP = 1.0) (Figures 4 and Figure S1, Supplementary Material). These isolates included seven with partial sequences available for both CP and HSP70h genes (samples: V01-027, V02-007, V03-004, V03-032, V05-007, V05-014, and V06-013), three represented only by partial CP sequences (samples: V01014, V03019, and V04-010), and five represented only by partial HSP70h sequences (samples: V01-005, V01-019, V02-019, V05-005, and V01-002).

Figure 4
Bayesian phylogenetic tree of GLRaV-2 based on the partial CP coding region amplified with primers V2dCPf2/V2CPr1. Sequences of Peruvian isolates are highlighted in red. Node values indicate posterior probabilities. Phylogroups PN, 93/955, H4, RG, BD, and PV20 are indicated along the tree.

3.8. Pairwise identity analysis

The nucleotide identity matrix showed that the sequence of the Peruvian isolate GLRaV-2-TI85 exhibited high similarity to sequences belonging to the RG phylogroup. In particular, GLRaV-2-TI85 showed 99.7% identity with the sequence AF314061, corresponding to a GLRaV-2 isolate from the grapevine cv. ‘Red Globe’ in the United States. High similarity was also observed with other isolates from the same phylogroup, including sequences reported in China, Chile, Canada, and Slovenia. This identity pattern was consistent with the topology of the phylogenetic tree, in which GLRaV-2-TI85 was grouped within the RG phylogroup (Figure S3, Supplementary Material).

4. Discussion

Grapevine leafroll disease is regarded as one of the most economically significant viral diseases affecting grapevine production worldwide due to its widespread occurrence and its detrimental effects on vine vigor, yield, and fruit quality (Atallah et al., 2012; Almeida et al., 2013; Naidu et al., 2014; Song et al., 2021). Among the viruses associated with this disease complex, GLRaV-2 has been linked to asymptomatic infections, leaf rolling symptoms, vine decline, and graft incompatibility disorders (Naidu et al., 2014; Basso et al., 2017). Accordingly, the range of symptoms observed in GLRaV-2-infected grapevines from commercial vineyards in Ica, Peru, highlights the variability of disease expression and is consistent with the symptomatology previously described in other grape-growing regions.

Consistent with previous reports, the prevalence of GLRaV-2-infected vines appears to vary considerably among grape-growing regions. Mujica et al. (2013) reported a prevalence of 13% in a commercial vineyard in Chile after five growing seasons, whereas Habili et al. (2023) detected the virus in only 2.7% of more than 11,000 samples analyzed in Australia. Likewise, Fiore et al. (2008) documented the occurrence of GLRaV-2 in commercial Chilean vineyards, highlighting that infection rates may differ according to region, grapevine cultivar, and diagnostic methodology. A similar pattern was observed in the present study, where GLRaV-2 prevalence varied across sampling areas within the Ica region, ranging from 12.5% to 31.4%.

The combined use of sRNA-HTS, total RNA-HTS, and Sanger sequencing enabled the reconstruction of a more complete and reliable genome sequence of the GLRaV-2-TI85 isolate. Although the sRNA dataset contained several unresolved regions, total RNA sequencing improved genome coverage and facilitated the recovery of genomic segments that were underrepresented in the initial assembly. In addition, RT-PCR and Sanger sequencing provided independent validation of specific regions, supporting the accuracy of the final genome sequence. These findings highlight the benefits of integrating complementary sequencing approaches for viral genome reconstruction, particularly for plant viruses that may occur at variable titers or exhibit uneven sequencing coverage across their genomes. Previous studies have demonstrated that HTS technologies are powerful tools for the detection and characterization of plant viruses (Al Rwahnih et al., 2015); however, their performance can be influenced by the type of nucleic acid analyzed, the sequencing strategy adopted, the bioinformatic pipeline employed, and the use of confirmatory assays (Kutnjak et al., 2021; Massart et al., 2019; Gaafar and Ziebell, 2020; Maina et al., 2024). Taken together, the integration of HTS data with targeted RT-PCR and Sanger sequencing enhanced the robustness and reliability of the GLRaV-2 genome sequence obtained in this study.

The genome organization of all sequenced GLRaV-2 isolates was consistent with the typical genomic structure previously described for GLRaV-2 and other members of the family Closteroviridae. The assembled genomes contained the ORF1a/1b region, which includes conserved domains involved in viral replication, such as methyltransferase, helicase, and RNA-dependent RNA polymerase, followed by the genes encoding p6, HSP70h, HSP90h, the duplicated coat protein, the coat protein, p19, and p24. This organization agrees with the main genomic features of closteroviruses, which are characterized by large positive-sense single-stranded RNA genomes, filamentous virions, the presence of an HSP70 homolog, and a duplicated or divergent coat protein (Fuchs et al., 2020; Martelli et al., 2012).

The high nucleotide identity and absence of recombination in the Peruvian GLRaV-2 isolates suggest a close genetic relationship with isolate AF314061. The close genetic relationship between the Peruvian isolates and AF314061, together with the vegetative propagation of grapevine, is consistent with dissemination through infected propagation material. However, the present results do not establish the geographic source or route of introduction of GLRaV-2 into Peru, and broader genomic sampling will be required to address these questions (Meng et al., 2005; Alkowni et al., 2011; Habili et al., 2023).

Phylogenetic analysis of GLRaV-2 genomic sequences placed the Peruvian isolates within the RG phylogroup. This finding represents one of the most significant results of the present study. The sequence of GLRaV-2-TI85 isolate shared high nucleotide identity (99.7%) with the U.S. sequence AF314061 (GenBank: AF314061), which was originally obtained from grapevine cultivar ‘Red Globe’. In addition, phylogenetic analysis of the partial coat protein (CP) gene from ten Peruvian GLRaV-2 isolates obtained by Sanger sequencing, all collected in the Ica region, showed that these isolates also clustered within the RG phylogroup, demonstrating the presence of this lineage among the samples evaluated in this area. Previous studies have reported that the RG phylogroup, originally associated with rootstock stem lesions and decline of grafted ‘Red Globe’ vines, is currently regarded as a divergent lineage of GLRaV-2 (Uyemoto et al., 2001; Alkowni et al., 2011; Habili et al., 2023). The identification of this phylogenetic group is particularly important because RG-related isolates have been linked to graft incompatibility disorders, whose symptoms are more likely to develop in sensitive rootstocks, whereas infected vines may remain symptomless when grown on their own roots.

The detection of Peruvian isolates belonging to the RG phylogroup represents a potential risk to national viticulture, since the use of infected buds on susceptible rootstocks could induce graft incompatibility, reduce plant establishment, and cause premature decline or death. However, the extent of these effects would depend on the specific susceptibility of the variety-rootstock combination used in Peruvian vineyards (Alkowni et al., 2011; Habili et al., 2023).

Overall, the detection of GLRaV-2 isolates belonging to the RG phylogroup in commercial vineyards from Ica highlights the importance of strengthening molecular diagnostics and sanitary certification of propagation material. Such measures are essential to limit virus dissemination and to support the long-term sustainability, productivity, and fruit quality of the Peruvian table grape industry (Meng et al., 2005).

5. Conclusions

The prevalence of GLRaV-2 observed in vineyards from the Ica region, in both symptomatic and asymptomatic vines, underscores the importance of molecular tools for accurate virus detection. This study reports the first genomic characterization of Peruvian GLRaV-2 isolates, which displayed the characteristic genome organization of the virus, shared high nucleotide identity with the U.S. isolate AF314061, and showed no evidence of recombination under the criteria applied in this study. Furthermore, phylogenetic analyses placed the Peruvian isolates GLRaV-2-TP12, GLRaV-2-TC108, GLRaV-2-TC109, GLRaV-2-TI83, and GLRaV-2-TI85 within the RG phylogroup, confirming the presence of this lineage in Peruvian vineyards.

Collectively, these findings provide valuable information for future epidemiological studies and further highlight the urgent need for the Peruvian National Agrarian Health Service (SENASA) to establish an official national certification program for grapevine propagation material, integrating high-throughput sequencing (HTS) for comprehensive health testing of mother plants and RT-PCR or RT-qPCR for routine virus detection.

Supplementary Material

Supplementary material accompanies this paper.

Figure S1

Bayesian phylogenetic tree based on partial nucleotide sequences of the HSP70h gene of Grapevine leafroll-associated virus 2 (GLRaV-2) isolates. The analyzed fragment corresponds to the region amplified with the primer pair RGHSP227/RGHSP777. Sequences of Peruvian isolates are highlighted in red. Numbers at the nodes indicate Bayesian posterior probability values

Figure S2.

Bayesian phylogenetic tree based on nucleotide sequences of the RNA-dependent RNA polymerase (RdRp) coding region of grapevine leafroll-associated virus 2 (GLRaV-2). Numbers at the nodes indicate Bayesian posterior probability values.

Figure S3

Heatmap showing pairwise nucleotide identity among nearly complete genome sequences of grapevine leafroll-associated virus 2 (GLRaV-2). The color scale indicates nucleotide identity percentages, with darker colors representing lower identity and yellow representing higher identity.

Table S1

Sampling sites and number of grapevine samples analyzed for GLRaV-2 detection in Ica, Peru.

Table S2.

Individual grapevine samples, cultivars, symptom categories, and RT-PCR detection results for GLRaV-2 in commercial vineyards of Ica, Peru.

Table S3

Recombinant GLRaV-2 sequences detected by RDP4 analysis. Parental sequences are shown as GenBank accession numbers, and values indicate method-specific P-values. NS, not significant.

This material is available as part of the online article from https://doi.org/10.1590/1519-6984.309846

Acknowledgements

This work was primarily funded by PROCIENCIA under Contract No. PE501078859-2022. The study was conducted using the facilities and equipment of the Virology Laboratory, Department of Plant Pathology, within the Master's Program in Plant Pathology, Universidad Nacional Agraria La Molina. The authors gratefully acknowledge the institutional support provided for the development of this research. The publication was self-funded by the authors.

Data Availability Statement

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

References

• AL RWAHNIH, M., DAUBERT, S., GOLINO, D., ISLAS, C. and ROWHANI, A., 2015. Comparison of next-generation sequencing versus biological indexing for the optimal detection of viral pathogens in grapevine. Phytopathology, vol. 105, no. 6, pp. 758-763. https://doi.org/10.1094/PHYTO-06-14-0165-R PMid:25689518.
  » https://doi.org/10.1094/PHYTO-06-14-0165-R
• ALKOWNI, R., ZHANG, Y.P., ROWHANI, A., UYEMOTO, J.K. and MINAFRA, A., 2011. Biological, molecular, and serological studies of a novel strain of Grapevine leafroll-associated virus 2. Virus Genes, vol. 43, no. 1, pp. 102-110. https://doi.org/10.1007/s11262-011-0607-7 PMid:21487783.
  » https://doi.org/10.1007/s11262-011-0607-7
• ALMEIDA, R.P.P., DAANE, K.M., BELL, V.A., BLAISDELL, G.K., COOPER, M.L., HERRBACH, E. and PIETERSEN, G., 2013. Ecology and management of grapevine leafroll disease. Frontiers in Microbiology, vol. 4, pp. 94. https://doi.org/10.3389/fmicb.2013.00094 PMid:23630520.
  » https://doi.org/10.3389/fmicb.2013.00094
• ANDRET-LINK, P., LAPORTE, C., VALAT, L., RITZENTHALER, C., DEMANGEAT, G., VIGNE, E. and FUCHS, M., 2004. Grapevine fanleaf virus: still a major threat to the grapevine industry. Journal of Plant Pathology, vol. 86, no. 3, pp. 183-195.
• ANDREWS, S., 2010 [viewed 14 August 2026]. FastQC: a quality control tool for high throughput sequence data [online]. Cambridge: Babraham Bioinformatics. Available from: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
  » http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
• ANGELINI, E., ABOU GHANEM-SABANADZOVIC, N., DOLJA, V.V. and MENG, B., 2017. Grapevine leafroll-associated virus 2. In: B. MENG, G.P. MARTELLI, D.A. GOLINO and M. FUCHS, eds. Grapevine viruses: molecular biology, diagnostics and management Cham: Springer, pp. 141-165. https://doi.org/10.1007/978-3-319-57706-7_7
  » https://doi.org/10.1007/978-3-319-57706-7_7
• APTE, A. and DANIEL, S. 2009. PCR primer design. Cold Spring Harbor Protocols, vol. 2009, no. 3, pp. pdb.ip65.
• ASOCIACIÓN DE EXPORTADORES DEL PERÚ – ADEX, 2023 [viewed 14 August 2026]. Uva peruana sigue su carrera ascendente en el exterior [online]. Available from: https://www.adexperu.org.pe/notadeprensa/uva-peruana-sigue-su-carrera-ascendente-en-el-exterior/
  » https://www.adexperu.org.pe/notadeprensa/uva-peruana-sigue-su-carrera-ascendente-en-el-exterior/
• ATALLAH, S.S., GÓMEZ, M.I., FUCHS, M.F. and MARTINSON, T.E., 2012. Economic impact of grapevine leafroll disease on Vitis vinifera cv. Cabernet Franc in Finger Lakes vineyards of New York. American Journal of Enology and Viticulture, vol. 63, no. 1, pp. 73-79. https://doi.org/10.5344/ajev.2011.11055
  » https://doi.org/10.5344/ajev.2011.11055
• BAELE, G., JI, X., HASSLER, G.W., MCCRONE, J.T., SHAO, Y., ZHANG, Z., HOLBROOK, A.J., LEMEY, P., DRUMMOND, A.J., RAMBAUT, A. and SUCHARD, M.A., 2025. BEAST X for Bayesian phylogenetic, phylogeographic and phylodynamic inference. Nature Methods, vol. 22, no. 8, pp. 1653-1656. https://doi.org/10.1038/s41592-025-02751-x PMid:40624354.
  » https://doi.org/10.1038/s41592-025-02751-x
• BASSO, M.F., FAJARDO, T.V.M. and SALDARELLI, P., 2017. Grapevine virus diseases: economic impact and current advances in viral prospection and management. Revista Brasileira de Fruticultura, vol. 39, no. 1, pp. e-411. https://doi.org/10.1590/0100-29452017411
  » https://doi.org/10.1590/0100-29452017411
• BEKESIOVA, I., NAP, J.P. and MLYNAROVA, L., 1999. Isolation of high quality DNA and RNA from leaves of the carnivorous plant Drosera rotundifolia. Plant Molecular Biology Reporter, vol. 17, no. 3, pp. 269-277. https://doi.org/10.1023/A:1007627509824
  » https://doi.org/10.1023/A:1007627509824
• BERTAZZON, N. and ANGELINI, E., 2004. Advances in the detection of Grapevine leafroll-associated virus 2 variants. Journal of Plant Pathology, vol. 86, no. 4, pp. 283-290.
• BERTAZZON, N., BORGO, M., VANIN, S. and ANGELINI, E., 2010. Genetic variability and pathological properties of Grapevine leafroll-associated virus 2 isolates. European Journal of Plant Pathology, vol. 127, no. 2, pp. 185-197. https://doi.org/10.1007/s10658-010-9583-3
  » https://doi.org/10.1007/s10658-010-9583-3
• BEUVE, M., SEMPÉ, L. and LEMAIRE, O., 2007. A sensitive one-step real-time RT-PCR method for detecting Grapevine leafroll-associated virus 2 variants in grapevine. Journal of Virological Methods, vol. 141, no. 2, pp. 117-124. https://doi.org/10.1016/j.jviromet.2006.11.042 PMid:17223202.
  » https://doi.org/10.1016/j.jviromet.2006.11.042
• BOLGER, A.M., LOHSE, M. and USADEL, B., 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics (Oxford, England), vol. 30, no. 15, pp. 2114-2120. https://doi.org/10.1093/bioinformatics/btu170 PMid:24695404.
  » https://doi.org/10.1093/bioinformatics/btu170
• CONSTABLE, F.E., CONNELLAN, J., NICHOLAS, P. and RODONI, B.C., 2013. The reliability of woody indexing for detection of grapevine virus-associated diseases in three different climatic conditions in Australia. Australian Journal of Grape and Wine Research, vol. 19, no. 1, pp. 74-80. https://doi.org/10.1111/j.1755-0238.2012.00204.x
  » https://doi.org/10.1111/j.1755-0238.2012.00204.x
• CUYA, G., DE SOUZA, J., FUENTES, S., GUZMÁN, F., VILLENA, G. and SAMOLSKI, I., 2026a. First report of Grapevine rupestris stem pitting-associated virus, Grapevine virus B, Grapevine Syrah virus-1, and Grapevine red globe virus infecting grapevine in Peru. Plant Disease, vol. 110, no. 3, pp. 1027. https://doi.org/10.1094/PDIS-08-25-1738-PDN
  » https://doi.org/10.1094/PDIS-08-25-1738-PDN
• CUYA, G., DE SOUZA, J., FUENTES, S., GUZMÁN, F., VILLENA, G. and SAMOLSKI, I., 2026b. Status of the Peruvian table grapevine virome by high-throughput sequencing (HTS). In press.
• DARRIBA, D., TABOADA, G.L., DOALLO, R. and POSADA, D., 2012. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods, vol. 9, no. 8, pp. 772. https://doi.org/10.1038/nmeth.2109 PMid:22847109.
  » https://doi.org/10.1038/nmeth.2109
• ELAD, Y. and PERTOT, I., 2014. Climate change impacts on plant pathogens and plant diseases. Journal of Crop Improvement, vol. 28, no. 1, pp. 99-139. https://doi.org/10.1080/15427528.2014.865412
  » https://doi.org/10.1080/15427528.2014.865412
• ERTUNC, F., 2020. Emerging plant viruses. In: M.M. ENNAJI, ed. Emerging and reemerging viral pathogens London: Academic Press, pp. 1041-1062. https://doi.org/10.1016/B978-0-12-819400-3.00046-6
  » https://doi.org/10.1016/B978-0-12-819400-3.00046-6
• FIORE, N., PRODAN, S., MONTEALEGRE, J., ABALLAY, E., PINO, A.M. and ZAMORANO, A., 2008. Survey of grapevine viruses in Chile. Journal of Plant Pathology, vol. 90, no. 1, pp. 125-130.
• FONSECA, F., ESTEVES, F., TEIXEIRA SANTOS, M., BRAZÃO, J. and EIRAS-DIAS, J.E., 2016. Genetic variants of Grapevine leafroll-associated virus 2 infecting Portuguese grapevine cultivars. Phytopathologia Mediterranea, vol. 55, no. 1, pp. 73-88. https://doi.org/10.14601/Phytopathol_Mediterr-16378
  » https://doi.org/10.14601/Phytopathol_Mediterr-16378
• FRAGA, H., MALHEIRO, A.C., MOUTINHO-PEREIRA, J. and SANTOS, J.A., 2012. An overview of climate change impacts on European viticulture. Food and Energy Security, vol. 1, no. 2, pp. 94-110. https://doi.org/10.1002/fes3.14
  » https://doi.org/10.1002/fes3.14
• FRIBOURG, C.E., 2007. Virus, viroides y mollicutes de las plantas cultivadas en el Perú. Lima: Biblioteca Nacional del Perú.
• FUCHS, M., BAR-JOSEPH, M., CANDRESSE, T., MAREE, H.J., MARTELLI, G.P., MELZER, M.J., MENZEL, W., MINAFRA, A., SABANADZOVIC, S. and REPORT CONSORTIUM, I., 2020. ICTV virus taxonomy profile: closteroviridae. The Journal of General Virology, vol. 101, no. 4, pp. 364-365. https://doi.org/10.1099/jgv.0.001397 PMid:32134375.
  » https://doi.org/10.1099/jgv.0.001397
• GAAFAR, Y.Z.A. and ZIEBELL, H., 2020. Comparative study on three viral enrichment approaches based on RNA extraction for plant virus/viroid detection using high-throughput sequencing. PLoS One, vol. 15, no. 8, pp. e0237951. https://doi.org/10.1371/journal.pone.0237951 PMid:32841302.
  » https://doi.org/10.1371/journal.pone.0237951
• GALAXY COMMUNITY, 2024. The Galaxy platform for accessible, reproducible, and collaborative data analyses: 2024 update. Nucleic Acids Research, vol. 52, no. W1, pp. W83-W94. https://doi.org/10.1093/nar/gkae410 PMid:38769056.
  » https://doi.org/10.1093/nar/gkae410
• GONZALES-LLONTOP, M.J., 2016. Standardization of molecular techniques (RT-PCR and IC-RT-PCR) for the diagnosis of infection by the main viruses affecting pisco grapevines in Peru. Lima: Universidad Peruana Cayetano Heredia.
• HABILI, N., WU, Q., RINALDO, A. and CONSTABLE, F., 2023. A chronological study on Grapevine leafroll-associated virus 2 in Australia. Viruses, vol. 15, no. 5, pp. 1105. https://doi.org/10.3390/v15051105 PMid:37243191.
  » https://doi.org/10.3390/v15051105
• HARRISON, B.D. and MURANT, A.F. 1977. Nepovirus group Kew: Commonwealth Mycological Institute/Association of Applied Biologists. Descriptions of Plant Viruses, no. 185.
• INTERNATIONAL COMMITTEE ON TAXONOMY OF VIRUSES – ICTV, 2024 [viewed 14 August 2026]. Genus: Closterovirus. ICTV report: family Closteroviridae [online]. Available from: https://ictv.global/report/chapter/closteroviridae/closteroviridae/closterovirus
  » https://ictv.global/report/chapter/closteroviridae/closteroviridae/closterovirus
• JARUGULA, S., ALABI, O.J., MARTIN, R.R. and NAIDU, R.A., 2010. Genetic variability of natural populations of Grapevine leafroll-associated virus 2 in Pacific Northwest vineyards. Phytopathology, vol. 100, no. 7, pp. 698-707. https://doi.org/10.1094/PHYTO-100-7-0698 PMid:20528188.
  » https://doi.org/10.1094/PHYTO-100-7-0698
• KATOH, K. and STANDLEY, D.M., 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution, vol. 30, no. 4, pp. 772-780. https://doi.org/10.1093/molbev/mst010 PMid:23329690.
  » https://doi.org/10.1093/molbev/mst010
• KEARSE, M., MOIR, R., WILSON, A., STONES-HAVAS, S., CHEUNG, M., STURROCK, S., BUXTON, S., COOPER, A., MARKOWITZ, S., DURAN, C., THIERER, T., ASHTON, B., MEINTJES, P. and DRUMMOND, A., 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics (Oxford, England), vol. 28, no. 12, pp. 1647-1649. https://doi.org/10.1093/bioinformatics/bts199 PMid:22543367.
  » https://doi.org/10.1093/bioinformatics/bts199
• KREUZE, J.F., PÉREZ, A., UNTIVEROS, M., QUISPE, D., FUENTES, S., BARKER, I. and SIMON, R., 2009. Complete viral genome sequence and discovery of novel viruses by deep sequencing of small RNAs: a generic method for diagnosis, discovery and sequencing of viruses. Virology, vol. 388, no. 1, pp. 1-7. https://doi.org/10.1016/j.virol.2009.03.024 PMid:19394993.
  » https://doi.org/10.1016/j.virol.2009.03.024
• KUTNJAK, D., TAMISIER, L., ADAMS, I., BOONHAM, N., CANDRESSE, T., CHIUMENTI, M., DE JONGHE, K., KREUZE, J.F., LEFEBVRE, M., SILVA, G., MALAPI-WIGHT, M., MARGARIA, P., MAVRIČ PLEŠKO, I., MCGREIG, S., MIOZZI, L., REMENANT, B., REYNARD, J.S., ROLLIN, J., ROTT, M. and HAEGEMAN, A., 2021. A primer on the analysis of high-throughput sequencing data for detection of plant viruses. Microorganisms, vol. 9, no. 4, pp. 841. https://doi.org/10.3390/microorganisms9040841 PMid:33920047.
  » https://doi.org/10.3390/microorganisms9040841
• LANGMEAD, B. and SALZBERG, S.L., 2012. Fast gapped-read alignment with Bowtie 2. Nature Methods, vol. 9, no. 4, pp. 357-359. https://doi.org/10.1038/nmeth.1923 PMid:22388286.
  » https://doi.org/10.1038/nmeth.1923
• LI, H. and DURBIN, R., 2009. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics (Oxford, England), vol. 25, no. 14, pp. 1754-1760. https://doi.org/10.1093/bioinformatics/btp324 PMid:19451168.
  » https://doi.org/10.1093/bioinformatics/btp324
• MAINA, S., DONOVAN, N.J., PLETT, K., BOGEMA, D. and RODONI, B.C., 2024. High-throughput sequencing for plant virology diagnostics and its potential in plant health certification. Frontiers in Horticulture, vol. 3, pp. 1388028. https://doi.org/10.3389/fhort.2024.1388028
  » https://doi.org/10.3389/fhort.2024.1388028
• MARTELLI, G.P., 2014. Directory of virus and virus-like diseases of the grapevine and their agents. Journal of Plant Pathology, vol. 96, suppl. 1, pp. 1-136.
• MARTELLI, G.P., ABOU GHANEM-SABANADZOVIC, N., AGRANOVSKY, A.A., AL RWAHNIH, M., DOLJA, V.V., DOVAS, C.I., FUCHS, M., GUGERLI, P., HU, J.S., JELKMANN, W., KATIS, N.I., MALIOGKA, V.I., MELZER, M.J., MENZEL, W., MINAFRA, A., ROTT, M.E., ROWHANI, A., SABANADZOVIC, S. and SALDARELLI, P., 2012. Taxonomic revision of the family Closteroviridae with special reference to the grapevine leafroll-associated members of the genus Ampelovirus and the putative species unassigned to the family. Journal of Plant Pathology, vol. 94, no. 1, pp. 7-19. https://doi.org/10.4454/jpp.fa.2012.022
  » https://doi.org/10.4454/jpp.fa.2012.022
• MARTIN, D.P., MURRELL, B., GOLDEN, M., KHOOSAL, A. and MUHIRE, B., 2015. RDP4: detection and analysis of recombination patterns in virus genomes. Virus Evolution, vol. 1, no. 1, pp. vev003. https://doi.org/10.1093/ve/vev003 PMid:27774277.
  » https://doi.org/10.1093/ve/vev003
• MASSART, S., CHIUMENTI, M., DE JONGHE, K., GLOVER, R., HAEGEMAN, A., KOLONIUK, I., KOMÍNEK, P., KREUZE, J., KUTNJAK, D., LOTOS, L., MACLOT, F., MALIOGKA, V.I., MAREE, H.J., OLIVIER, T., OLMOS, A., POOGGIN, M.M., REYNARD, J.S., RUIZ-GARCÍA, A.B., ŠAFÁŘOVÁ, D. and CANDRESSE, T., 2019. Virus detection by high-throughput sequencing of small RNAs: large-scale performance testing of sequence analysis strategies. Phytopathology, vol. 109, no. 3, pp. 488-497. https://doi.org/10.1094/PHYTO-02-18-0067-R PMid:30070618.
  » https://doi.org/10.1094/PHYTO-02-18-0067-R
• MENG, B., LI, C., GOSZCZYNSKI, D.E. and GONSALVES, D., 2005. Genome sequences and structures of two biologically distinct strains of Grapevine leafroll-associated virus 2 and sequence analysis. Virus Genes, vol. 31, no. 1, pp. 31-41. https://doi.org/10.1007/s11262-004-2197-0 PMid:15965606.
  » https://doi.org/10.1007/s11262-004-2197-0
• MENG, B., MARTELLI, G.P., GOLINO, D.A. and FUCHS, M., 2017. Grapevine viruses: molecular biology, diagnostics and management Cham: Springer. https://doi.org/10.1007/978-3-319-57706-7
  » https://doi.org/10.1007/978-3-319-57706-7
• MINISTERIO DE DESARROLLO AGRARIO Y RIEGO DEL PERÚ – MIDAGRI, 2025. La uva en el Perú: su producción, exportación y perspectivas de sus precios Lima: Dirección de Estudios Económicos, Dirección General de Políticas Agrarias.
• MUJICA, M.V., MORA, R., ROSALES, M. and SANDOVAL, C., 2013. Variation over time in the prevalences of three viruses of the grapevine leafroll complex in a commercial vineyard in south-central Chile. Ciencia e Investigación Agraria, vol. 40, no. 1, pp. 139-147.
• NAIDU, R.A., ROWHANI, A., FUCHS, M., GOLINO, D. and MARTELLI, G.P., 2014. Grapevine leafroll: a complex viral disease affecting a high-value fruit crop. Plant Disease, vol. 98, no. 9, pp. 1172-1185. https://doi.org/10.1094/PDIS-08-13-0880-FE PMid:30699617.
  » https://doi.org/10.1094/PDIS-08-13-0880-FE
• NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION – NCBI, 2026 [viewed 14 August 2026]. Open Reading Frame Finder [online]. Bethesda: National Library of Medicine, National Institutes of Health. Available from: https://www.ncbi.nlm.nih.gov/orffinder/
  » https://www.ncbi.nlm.nih.gov/orffinder/
• PECMAN, A., KUTNJAK, D., GUTIÉRREZ-AGUIRRE, I., ADAMS, I., FOX, A., BOONHAM, N. and RAVNIKAR, M., 2017. Next generation sequencing for detection and discovery of plant viruses and viroids: comparison of two approaches. Frontiers in Microbiology, vol. 8, pp. 1998. https://doi.org/10.3389/fmicb.2017.01998 PMid:29081770.
  » https://doi.org/10.3389/fmicb.2017.01998
• POOJARI, S., ALABI, O.J. and NAIDU, R.A., 2013. Molecular characterization and impacts of a strain of Grapevine leafroll-associated virus 2 causing asymptomatic infection in a wine grape cultivar. Virology Journal, vol. 10, no. 1, pp. 324. https://doi.org/10.1186/1743-422X-10-324 PMid:24171725.
  » https://doi.org/10.1186/1743-422X-10-324
• PRJIBELSKI, A., ANTIPOV, D., MELESHKO, D., LAPIDUS, A. and KOROBEYNIKOV, A., 2020. Using SPAdes de novo assembler. Current Protocols in Bioinformatics, vol. 70, no. 1, pp. e102. https://doi.org/10.1002/cpbi.102 PMid:32559359.
  » https://doi.org/10.1002/cpbi.102
• RAMBAUT, A., 2018 [viewed 14 August 2026]. FigTree v1.4.4 [software]. Edinburgh: Institute of Evolutionary Biology, University of Edinburgh. Available from: http://tree.bio.ed.ac.uk/software/figtree/
  » http://tree.bio.ed.ac.uk/software/figtree/
• RAMBAUT, A., DRUMMOND, A.J., XIE, D., BAELE, G. and SUCHARD, M.A., 2018. Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Systematic Biology, vol. 67, no. 5, pp. 901-904. https://doi.org/10.1093/sysbio/syy032 PMid:29718447.
  » https://doi.org/10.1093/sysbio/syy032
• RIENTH, M., VIGNERON, N., WALKER, R.P., CASTELLARIN, S.D., SWEETMAN, C., BURBIDGE, C.A., BONGHI, C., FAMIANI, F. and DARRIET, P., 2021. Modifications of grapevine berry composition induced by main viral and fungal pathogens in a climate change scenario. Frontiers in Plant Science, vol. 12, pp. 717223. https://doi.org/10.3389/fpls.2021.717223 PMid:34956249.
  » https://doi.org/10.3389/fpls.2021.717223
• SÁNCHEZ-MONCADA, B. and ÁLVAREZ, L.A., 2025. Occurrence of grapevine Pinot gris virus in commercial table grapes in Peru. New Disease Reports, vol. 51, no. 1, pp. e70014. https://doi.org/10.1002/ndr2.70014
  » https://doi.org/10.1002/ndr2.70014
• SCHOELZ, J., VOLENBERG, D., ADHAB, M., FANG, Z., KLASSEN, V., SPINKA, C. and AL RWAHNIH, M., 2021. A survey of viruses found in grapevine cultivars grown in Missouri. American Journal of Enology and Viticulture, vol. 72, no. 1, pp. 73-84. https://doi.org/10.5344/ajev.2020.20043
  » https://doi.org/10.5344/ajev.2020.20043
• SIDHARTHAN, V.K., SEVANTHI, A.M., JAISWAL, S. and BARANWAL, V.K., 2020. Robust virome profiling and whole genome reconstruction of viruses and viroids enabled by use of available mRNA and sRNA-seq datasets in grapevine (Vitis vinifera L.). Frontiers in Microbiology, vol. 11, pp. 1232. https://doi.org/10.3389/fmicb.2020.01232 PMid:32582126.
  » https://doi.org/10.3389/fmicb.2020.01232
• SONG, Y., HANNER, R.H. and MENG, B., 2021. Probing into the effects of grapevine leafroll-associated viruses on the physiology, fruit quality and gene expression of grapes. Viruses, vol. 13, no. 4, pp. 593. https://doi.org/10.3390/v13040593 PMid:33807294.
  » https://doi.org/10.3390/v13040593
• STACE-SMITH, R. and RAMSDELL, D.C., 1987. Nepoviruses of the Americas. In: K.F. HARRIS, ed. Current topics in vector research New York: Springer-Verlag, vol. 3, pp. 131-166. https://doi.org/10.1007/978-1-4612-4688-6_5
  » https://doi.org/10.1007/978-1-4612-4688-6_5
• UNITED STATES DEPARTMENT OF AGRICULTURE – USDA. FOREIGN AGRICULTURAL SERVICE, 2025 [viewed 14 August 2026]. Fresh deciduous fruit annual: Peru Report no. PE2025-0027. [online]. Washington, DC: USDA Foreign Agricultural Service. Available from: https://www.fas.usda.gov/data/gain/2025/12/peru-fresh-deciduous-fruit-annual
  » https://www.fas.usda.gov/data/gain/2025/12/peru-fresh-deciduous-fruit-annual
• UNTERGASSER, A., CUTCUTACHE, I., KORESSAAR, T., YE, J., FAIRCLOTH, B.C., REMM, M. and ROZEN, S.G., 2012. Primer3: new capabilities and interfaces. Nucleic Acids Research, vol. 40, no. 15, pp. e115. https://doi.org/10.1093/nar/gks596 PMid:22730293.
  » https://doi.org/10.1093/nar/gks596
• UYEMOTO, J.K., ROWHANI, A., LUVISI, D. and KRAG, C.R., 2001. New closterovirus in ‘Redglobe’ grape causes decline of grafted plants. California Agriculture, vol. 55, no. 4, pp. 28-31. https://doi.org/10.3733/ca.v055n04p28
  » https://doi.org/10.3733/ca.v055n04p28
• VELASCO, L. and PADILLA, C.V., 2021. High-throughput sequencing of small RNAs for the sanitary certification of viruses in grapevine. Frontiers in Plant Science, vol. 12, pp. 682879. https://doi.org/10.3389/fpls.2021.682879 PMid:34367209.
  » https://doi.org/10.3389/fpls.2021.682879
• VENIOS, X., KORKAS, E., NISIOTOU, A. and BANILAS, G., 2020. Grapevine responses to heat stress and global warming. Plants, vol. 9, no. 12, pp. 1754. https://doi.org/10.3390/plants9121754 PMid:33322341.
  » https://doi.org/10.3390/plants9121754

*

e-mail: [e-mail]

Editor:

Takako Matsumura Tundisi

Publication Dates

• Publication in this collection
  19 Oct 2026
• Date of issue
  2026

History

• Received
  14 June 2026
• Accepted
  25 Aug 2026