ABSTRACT:
Contamination of biological products with Mycoplasma spp. represents a major problem for laboratories and vaccine industry. Herein, we investigated Mycoplasma spp. contamination in cell cultures and viral strains maintained at the Virology Section of the Universidade Federal de Santa Maria and evaluated drugs and protocols for decontamination. Among 25 cell lines and primary cultures tested by PCR, 16 (64%) were contaminated. Fourteen bovine viral strains were also found contaminated, including three bovine viral diarrhea virus 1 (BVDV-1), two BVDV-2, four bovine alphaherpesvirus 1 (BoHV-1), one each: HoBiPeV, BoHV-2, BoHV-5, bovine parainfluenza virus 3 (bPI-3V) and bovine respiratory syncytial virus (BRSV). Two drugs (Plasmocin ® [P] and gentamicin [G]) were used individually or mixed for decontamination. Bovine (MDBK and CRIB cells), porcine (PK-15), rabbit (RK-13) and hamster (BHK-21) cell lineages were maintained in media containing the drugs and tested by PCR at weekly intervals. The combined P + G treatment was effective in eliminating Mycoplasma spp. from four cultures between days 35 and 42, followed by treatment with Plasmocin ® (3/4) and gentamicin alone (1/4). The CRIB cell line could not be decontaminated. After, a decontamination protocol of viral seeds was carried out, consisting of amplification in cell culture, centrifugation of the viral suspension, filtration, limiting dilution and culture in mycoplasma-free cells. The fourteen viral strains were decontaminated after 1 to 4 cycles of the protocol. Overall, we detected a high frequency of Mycoplasma spp. contamination in cell cultures and viral strains and successfully applied drugs and protocols for decontamination.
Key words:
contamination; cell cultures; mycoplasma; virus; decontamination
RESUMO:
A contaminação de produtos biológicos com Mycoplasma spp. representa um grande problema para laboratórios e indústria de vacinas. Este trabalho investigou contaminação por Mycoplasma spp. em cultivos celulares e cepas virais do Setor de Virologia da Universidade Federal de Santa Maria e avaliou drogas e protocolos de descontaminação. Dentre 25 cultivos celulares testados por PCR, 16 (64%) estavam contaminados. Quatorze cepas virais também estavam contaminadas, incluindo três do vírus da diarreia viral bovina 1 (BVDV-1), dois BVDV-2, quatro do alfaherpesvírus bovino tipo 1 (BoHV-1) e um de HoBiPeV, BoHV-2, BoHV-5, vírus parainfluenza bovino 3 (bPI-3V) e vírus sincicial respiratório bovino (BRSV). Duas drogas (Plasmocin ® [P] e gentamicina [G]) foram utilizadas individualmente ou combinadas para a descontaminação celular. Linhagens celulares bovinas (MDBK e CRIB), suínas (PK-15), de coelho (RK-13) e de hamster (BHK-21) foram mantidas em meio contendo as drogas e testadas por PCR a intervalos semanais. O tratamento combinado P + G foi eficaz na eliminação de Mycoplasma spp. de quatro cultivos entre os dias 35 e 42, seguido pelo tratamento com Plasmocin ® (3/4) e gentamicina (1/4). A linhagem CRIB não pôde ser descontaminada. Posteriormente, um protocolo de descontaminação de cepas virais foi realizado, consistindo em amplificação em cultivo celular, centrifugação, filtração, diluição limitante e amplificação em células livres de Mycoplasma spp. As quatorze cepas virais foram descontaminadas após 1 a 4 ciclos do protocolo. Em conclusão, detectou-se uma alta frequência de contaminação por Mycoplasma spp. em cultivos celulares e cepas virais e aplicou-se com sucesso drogas e protocolos de descontaminação.
Palavras-chave:
contaminação; cultivos celulares; micoplasma; vírus; descontaminação
INTRODUCTION
Mycoplasma spp. represents a large group of bacteria characterized by their small size (0.15 - 0.3 µm) and absence of cell wall. These bacteria are found in a wide range of hosts, from plants to humans and are frequent contaminants of cell cultures, being a major problem for research laboratories and pharmaceutical companies as well (ROTTEM et al., 2012; HUANG et al., 2023). These contaminations may affect several aspects of cell physiology and growth and, thus, potentially interfere with procedures using cell cultures and the purity of biologicals produced in cultured cells, especially viral vaccines (HUANG et al., 2023). Some factors contribute for the frequent contamination of cell cultures with Mycoplasma spp., including multiple origins of contamination, resistance to most antibiotics routinely used in cell culture, invisibility to light microscopy and usually do not affect cell growth or appearance or cause medium turbidity (GARNER et al., 2000; DREXLER & UPHOFF, 2002). In addition, these agents are not easily detected by routine laboratory requiring specific tests for their detection (MCGARRITY, 1982; RAWADI & DUSSURGET, 1995). In this aspect, the molecular detection of Mycoplasma spp. DNA by polymerase chain reaction (PCR) or real time quantitative PCR (qPCR) are earning more space because is more sensitive, specific and rapid than other specific tests (CARRILLO-ÁVILA et al., 2023). Once detected, contaminated cultures and/or viral seeds should be ideally replaced (DREXLER & UPHOFF, 2002). However, certain cell lines and viral seeds are unique, and their discard may not be an option. Thus, some protocols for decontamination of cell cultures have been used, but most are laborious and time-consuming and may result in loss of viral infectivity (WOLFORD & HETRICK, 1972; SIMPSON et al., 1983). In this sense, a simple and effective protocol for decontamination of viral seeds has been described, bypassing the above problems (BARONTI et al., 2013). This research was motivated by a demand from the vaccine industry for bovine viruses for use in vaccines, which should be free of adventitious agents, including Mycoplasma spp. Thus, we investigated Mycoplasma spp. contamination in cell cultures and viral strains/seeds in our lab and, once detected, we evaluated drugs and protocols of for decontamination.
MATERIALS AND METHODS
Cells and viruses
The cell cultures used in the present study included primary cells and lineages belonging to the cell bank of the Virology Section (SV/UFSM). Additional cell lines were obtained from Ouro Fino Animal Health (MDBK-OF), Panaftosa (MDBK-Pan), Federal University of Pelotas (MDBK-UFPEL) (Table 1). Cell cultures were maintained in minimal essential medium (MEM, Gibco®) supplemented with 5 - 10% fetal bovine serum (FBS, Cripion®), penicillin (1%) (Sigma®), amphotericin B (2.5%) (Vitrocell®) and cultured at 37ºC in a 5% CO2 incubator. During the process of decontamination of viral seeds, MDBK-Pan were maintained in culture medium as described above supplemented Plasmocin ® (25µg/mL) and gentamicin (50µg/mL). The viral isolates and strains used herein belong to the SV/UFSM collection, except for a bovine parainfluenza virus 3 (bPI-3V) and a bovine respiratory syncytial virus (BRSV) gently provided by Laboratory Biovet/Vaxxinova LTDA (Várzea Grande Paulista, SP) (Table 2). All procedures of virus amplification and quantitation before decontamination were performed in MDBK cells; the procedures of decontamination of viral seeds were performed in MDBK-Pan (mycoplasma-free), cultured in medium supplemented with Plasmocin ® (25 µg/mL) and gentamicin (50µg/mL). During maintenance and decontamination process, MDBK-Pan were monitored for Mycoplasma spp. contamination at weekly intervals.
Detection of Mycoplasma spp. in cell cultures and viral seeds
DNA extraction
For investigation of Mycoplasma spp. contamination in cell cultures, cells grown in T25cm2 flasks were individualized by trypsin and resuspended in culture medium, followed by centrifugation 12,000 x g for 15 min and collection of the cell pellet for DNA extraction. The cell pellets (containing 104 - 105 cells) plus 200 µL of the supernatant were submitted to total DNA extraction for PCR. For viral seeds, total DNA was extracted from culture supernatants of cell cultures inoculated with each strain enriched by infected cells, as described above. Total DNA was extracted by a column (PureLink™ Genomic DNA Mini Kit, Invitrogen™) and quantified by spectophotometry (NanoDrop™, Thermo Fisher Scientific™).
Polymerase chain reaction (PCR)
The PCR for Mycoplasma spp. detection was carried out as described by Timenetsky et al. (2006). The amplification target is the 16S region of ribosomal DNA, a well-conserved genetic region of Mycoplasma spp., producing a 270 bp amplicon. After DNA extraction, PCR was performed using the Taq DNA Polymerase, Recombinant (Thermo Fisher Scientific) to a final volume of 10μL: 6.2 µL of H2O, 1µL of buffer (10X), 0.2 µL of dNTPs (10 mM stock), 0.5 µL of MgCl2 (50 mM stock), 0.5 µL of forward primer (at 10 µM) (GPO3 5’ GGGAGCAAACACGATAGATACCCT 3’), and 0.5 µL of reverse primer (at 10 µM) (MGSO 5’ TGCACCATCTGTCACTCTGTTAACCTC 3’), 0.1µL of Taq DNA Polymerase Recombinant (5U/µL), and 1µL of DNA (100 ng/µL). Confirmed Mycoplasma spp. samples were used as positive controls. The PCR conditions were as follows: Stage 1: 1 cycle at 94 °C for 2 min; Stage 2: 35 cycles at 94 °C for 30 sec, 55 °C for 30 sec, and 72 °C for 30 sec; Stage 3: 1 cycle at 72 °C for 5 min. Subsequently, electrophoresis was performed on a 2% agarose gel stained with Gel Red® (Biotium).
Decontamination of cell cultures
After detection of contamination, five cell lineages of special interest at SV/UFSM were selected for decontamination: MDBK, PK-15, RK-13, BHK-21 and CRIB. Briefly, the cultures were maintained in triplicates in 6-well plates. Each well was submitted to one treatment: medium supplemented with Plasmocin ® (P) (final concentration 25µg/mL), gentamicin (G) (50µg/mL), or both (P + G). The cells were subcultured 1:3 or 1:4 at week intervals and tested for Mycoplasma spp. by PCR at each time-point. The process followed until two successive tests were negative in the PCR. In other words, cells were considered decontaminated upon two weekly negative tests. Once the decontamination was achieved, cells were further propagated and cryopreserved (UPHOFF & DREXLER, 2011). Figure 1 illustrates the protocol of cell decontamination.
Protocol for decontamination of cell cultures. P: Plasmocin ®. G: gentamicin. MDBK: Madin-Darby bovine kidney. CRIB: MDBK resistant to infection with BVDV-1. PK - 15: Porcine kidney. RK - 13: Rabbit kidney. BHK - 21: Baby hamster kidney.
Decontamination of viral seeds
The supernatants of cultured cells inoculated with each of the viral strains were initially tested for Mycoplasma spp. by PCR according to the protocol described above. Once contamination was detected, the viral seeds were submitted to a decontamination protocol adapted from BARONTI et al. (2013) (Figure 2), using MDBK-Pan cells. Briefly, the viral strains were initially amplified in MDBK cells for one to three passages until reaching a titer of approximately 106 TCID50/mL Then, infected cultures were submitted to two cycles of freeze thawing at -80 °C, centrifuged (12,000 xg for 15 min) and the supernatant filtered through 0.10µm (BVDV-1, BVDV-2 and HoBiPeV) or 0.22µm (the other viruses) filters. The filtered suspension was then submitted to limiting dilution (10-1 to 10-5) and each dilution was inoculated in triplicate in MDBK-Pan cells grown in 12-well plates (three wells/dilution) with medium containing P (25µg/mL) + G (50µg/mL). After 72 - 96h, cell cultures grown in the plates were observed for cytopathic effect (CPE) or submitted to fluorescent antibody assay (non-cytopathic BVDV or HoBiPeV) to identify the highest dilutions resulting in CPE (or positive fluorescence). The supernatants of these cultures were then amplified in MDBK-Pan cells for a second round of decontamination. At the end of each cycle, infected cells were monitored by PCR to check the contamination status. All procedures of decontamination of viral strains were performed in mycoplasma-free MDBK-Pan cells maintained in medium containing P + G (Plasmocin ® + gentamycin). As to ensure the quality of the process, all reagents routinely used in the decontamination protocol (cells, medium, trypsin and FBS) were periodically checked for Mycoplasma spp. In addition, 12 batches of commercial FBS available at SV/UFSM were also tested for Mycoplasma spp.
Protocol for decontamination of viral strains. TCID50: 50% tissue culture infectious dose. CPE Cytopathic effect. P: Plasmocin ® . G: gentamicin. MDBK-Pan: Madin - Derby bovine kidney from Centro Pan-Americano de Febre Aftosa.
RESULTS
Mycoplasma spp. detection in cell cultures
A total of 25 cell cultures tested for Mycoplasma spp. by PCR. Sixteen (16; 64%) were positive, including primary cultures and cell lineages of different origins (Table 1). In these numbers we excluded MDBK-Pan, which has been obtained from Panaftosa due to the mycoplasma-free status. Some of these cultures (ED, VERO, CEO and OFTU) were positive/negative in different batches/passage number according to the table 1. CEO and OFTU are primary cells obtained from ovine turbinates and, possibly, their mycoplasma-free status is, in part, to the low number of passages. Interestingly, some MDBK-Pan became contaminated after a few passages in the lab, confirming the high risk of cross-contamination from previously contaminated cultures.
Mycoplasma spp. decontamination from cell cultures
Five cell lineages found contaminated were submitted to a protocol of decontamination, according the Plasmocin ® manufacturer. Four of these cultures (MDBK, PK-15, RK-13 and BHK-21) were treated in paralel with Plasmocin ® (P), gentamicin (G) or both (P + G). CRIB cells were submitted only to the combined P + G treatment, the one showing higher efficacy. Cells under treatment were tested by PCR at weekly intervals upon subculture and were considered free of Mycoplasma spp. after two negative tests. As shown in table 2, decontamination was achieved after day 35 in the individual and combined (P + G) treatments. As the objective was to find a treatment that was effective and to avoid antibiotic resistance, treatment with P or G alone were discontinued after 42 days in PK-15 and BHK-21 cells, since treatment with P+G was the most effective. Likewise, the CRIB cell that was the last to go through the protocol received only P + G treatment. The CRIB cells treated with P + G remained positive until day 70, when the treatment was discontinued. One cell lineage (CRIB) could not be decontaminated after 70 days of combined treatment.
Detection and decontamination of Mycoplasma spp. from viral seeds
Fourteen bovine virus strains were tested for Mycoplasma spp. and subsequently submitted to a protocol of decontamination adapted from BARONTI et al. (2013) (Table 3). Decontamination was obtained for all strains after 1 to 4 rounds/cycles of decontamination. The number of cycles necessary for decontamination was largely dependent of the viral titers obtained after each round of amplification. After decontamination, viral strains were cultured for 2 to 4 passages and tested for Mycoplasma spp., confirming the negative status. Thus, all viral strains were successfully decontaminated from Mycoplasma spp. using drugs and protocols of decontamination (Table 3, Figure 3).
Agarose gel with PCR products for Mycoplasma spp. performed on DNA extracted from cell lines and viral strains subjected to decontamination protocol. 1: 50bp molecular weight marker. 2: Positive control. 3: Original MDBK cells. 4: MDBK cells subjected to decontamination protocol. 5: Singer BVDV viral strain before decontamination protocol. 6: Singer BVDV viral strain after decontamination protocol. 7: Negative control (water).
DISCUSSION
The present study investigated contamination of cell cultures and viral seeds with Mycoplasma spp. and successfully employed drugs and protocols for decontamination. Sixteen out of 25 cell cultures (64%), including primary cells and lineages, and all 14 viral strains tested were found contaminated with Mycoplasma spp. As these strains have been amplified cultivated in MDBK cells (subsequently found to be contaminated), their consequent contamination was not a surprise. In this sense, contamination of cell cultures (and viral strains) with Mycoplasma spp. is indeed very frequent and represents a major problem for laboratories handling cultures for several purposes (DREXLER & UPHOFF, 2002; ROTTEM et al., 2012; HUANG et al., 2023).
Mycoplasma spp. comprises a group of small, ubiquitous bacteria found in a variety of hosts, from plants to humans, causing from inapparent infections to disease of varied severity (GERAGHTY et al., 2014). Because of their ubiquitous nature, they are frequently found contaminating biologicals of animal origin, especially cell cultures, where they find adequate conditions for propagation (ROTTEM et al., 2012). The possible origins of Mycoplasma spp. contamination of cell cultures include: i. Contamination of the original animal tissues; ii. Fetal bovine serum (FBS) used as a promotor for cell growth; iii. Contamination from laboratory personnel; iv. Cross-contamination from previously contaminated cultures or lab reagents. Hence, in addition to testing any biological introduced in the lab, routine and frequent testing, rigorous cell culture techniques, accident prevention and maintaining good laboratory practices, discarding contaminated cell cultures and other biologicals are mandatory as to minimize contamination (DREXLER & UPHOFF, 2002; BÉBÉAR & PEREYRE, 2005).
In addition to its ubiquitous nature and, thus, the wide range of possible origins of contamination, Mycoplasma spp. detection and control in tissue cultures are not easily accomplished for the reasons listed in the introduction section. Briefly, most contaminations do not cause overt changes in cell cultures nor cause turbidity in the medium; Mycoplasma spp. may pass filters routinely used to retain bacteria (0.22µm); are not visible at light microscopy; are resistant to most antibiotics used in cell cultures. Furthermore, Mycoplasma spp. is not detected by most tests routinely used for cell screening, requiring specific and, sometimes, sophisticated, expensive, cumbersome and time-consuming techniques. In this scenario, Mycoplasma spp. contamination may go unnoticed indefinitely in laboratories maintaining cell cultures for diverse purposes. Unless looked it carefully and with adequate methods, these contaminations may be perpetuated in laboratories and be source of cross-contamination for other biologicals eventually introduced in the lab (DREXLER & UPHOFF, 2002; BARONTI et al., 2013; GERAGHTY et al., 2014).
A major concern regarding Mycoplasma spp. contamination of cell culture is the myriad of its possible effects in cell physiology, metabolism, genomic integrity and gene expression (ROTTEM, 1993). Thus, inadvertent contaminations may potentially jeopardize the reliability of research results and compromise the purity and quality of biologicals produced (or derived from) in the cultures. In particular, Mycoplasma spp. contamination of viral seeds/strains represents a major challenge for the vaccine industry (ROTTEM, 1993; DREXLER & UPHOFF, 2002). In our experience, Mycoplasma spp. contaminations of cell cultures usually go unnoticed and, apparently, do not affect cell morphology and growth. In the same way, contamination appears not to affect the replication ability of viruses amplified in these cultures, thus not interfering with most routine virology research and diagnostic activities. However, inapparent effects that would affect cell physiology and their response/susceptibility to virus replication, among other effects, should not be discarded. In addition, Mycoplasma spp. contamination of viral seeds used for several purposes may be detrimental for the reliability consistency of the results and quality of the products obtained thereof. Hence, maintaining mycoplasma-free cultures in any activity involving viral diagnostic, research and biological production manufacturing is mandatory as to maintain high standards of results reliability and product purity and quality.
Another element that contributes for the frequent contamination is that mycoplasmas are not easily detected by most routine tests used for monitoring cell cultures such as light microscopy examination, most immunological-based tests, differential staining and bacterial culture/isolation (NIKFARJAM & FARZANEH, 2012). Thus, some tests have been adapted to detect Mycoplasma spp. such as DAPI and Hoechst stains, and molecular detection by DNA hybridization and PCR (RAWADI & DUSSURGET, 1995). Among the available tests, we chose a PCR using primers that amplify the ribosomal 16S gene of class Mollicutes (that would cover all mycoplasmas) due to its sensitivity, specificity, rapid execution and coverage (TIMENETSKY et al., 2006). Our PCR uses preferentially total DNA extracted from the pellet of cells obtained upon subculture rather than culture supernatants, due to its higher sensitivity (not shown).
Upon Mycoplasma spp. detection in cell cultures and viral seeds/strains, the ideal situation would be to discard out the contaminated material and start over from decontaminated ones. However, available cell cultures and viral strains are sometimes unique (or are all contaminated), or difficult to obtain and, thus, discard would not be an option. Then, decontamination protocols should be tried. For decontamination of cell cultures, we used Plasmocin ®, strictly according to the manufacturer’s instruction, associated or not with Gentamicin. Plasmocin ® contains a mixture of fluorquinolone, which inhibits DNA gyrase and topoisomerase IV, and macrolids, which inhibit bacterial protein synthesis after binding to ribosomal 50s subunit (GAYNOR & MANKIN, 2003). Gentamicin also inhibits protein synthesis yet binding to the 30S ribosomal subunit (YOSHIZAWA, 1998). According to the manufacturer, decontamination of cell cultures may be obtained after two weeks of treatment in most cases. In our experience, decontamination using Plasmocin ® + gentamicin was only achieved after 35 days of treatment. In addition, decontamination of CRIB cells was not obtained even after 70 days of treatment. Hence, our results demonstrated that Mycoplasma spp. decontamination of cell cultures may be more complex and difficult than previously found. This difference may be due to Mycoplasma spp. resistance to the drugs and level of contamination (DREXLER & UPHOFF, 2002; KAZEMIHA et al., 2011).
Several novel drugs for Mycoplasma spp. treatment of cell cultures, mainly targeting mycoplasma resistant strains, have been recently released (MycoZap®, Lonza™, Huang) (MARIOTTI et al., 2012). Inadvertent mycoplasma contamination of cell cultures invariably results in contamination of viruses amplified in these cells. Although, many procedures used in virology laboratories may not be affected by the presence of Mycoplasma spp. in the viral suspensions, the purity and quality of the viral seeds are compromised for many purposes, including genome sequencing, production of antisera or monoclonal antibodies, pathogenesis studies and, especially, production of viral vaccines (ROTTEM, 1993; DREXLER & UPHOFF, 2002). When unique viral strains are found contaminated, decontamination is the way out. Among several protocols used to decontaminate viral seeds, we adapted that by BARONTI et al. (2013), which is based on enrichment of viral particles in relation to Mycoplasma spp. through cycles of centrifugation, filtration (through 0.1 or 0.22µm filters, depending on the virus), limiting dilution and culture in mycoplasma-free cells in the presence of antibiotics active against mycoplasmas. Using this protocol, we succeeded in decontaminating all 14 viral strains. Complete decontamination was confirmed by culturing the viruses for several passages in mycoplasma-free cells without the use of specific antibiotics (results not shown).
CONCLUSION
The present study detected frequent mycoplasma contamination in cultures and in all viral seeds tested and successfully employed drugs and protocols of decontamination.
ACKNOWLEDGMENTS
This work was funded by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brazil (CAPES) - Funding Code 001 and by the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq).
REFERENCES
-
BARONTI, C. et al. Mycoplasma removal: Simple curative methods for viral supernatants. Journal of Virological Methods, v.187, n.2, p.234-237, 1 fev. 2013. Available from: <Available from: https://www.sciencedirect.com/science/article/abs/pii/S0166093412003369?via%3Dihub >. Accessed: May, 22, 2023. doi: 10.1016/j.jviromet.2012.09.014.
» https://doi.org/10.1016/j.jviromet.2012.09.014.» https://www.sciencedirect.com/science/article/abs/pii/S0166093412003369?via%3Dihub -
BÉBÉAR, C. M.; PEREYRE, S. Mechanisms of drug resistance in mycoplasma pneumoniae. Current Drug Targets. Infectious Disorders, v.5, n.3, p.263-271, 1 set. 2005. Available from: <Available from: https://www.eurekaselect.com/article/35263 >. Accessed: May, 20, 2023. doi: 10.2174/1568005054880109.
» https://doi.org/10.2174/1568005054880109.» https://www.eurekaselect.com/article/35263 -
CARRILLO-ÁVILA, J. A. et al. Development and evaluation of a new qPCR assay for the detection of mycoplasma in cell cultures. Current Issues in Molecular Biology, v.45, n.8, p. 6903-6915, 1 ago. 2023. Available from: <Available from: https://www.mdpi.com/1467-3045/45/8/435 >. Accessed: Jan. 20, 2024. doi: 10.3390/cimb45080435.
» https://doi.org/10.3390/cimb45080435.» https://www.mdpi.com/1467-3045/45/8/435 -
DREXLER, H. G.; UPHOFF, C. C. Mycoplasma contamination of cell cultures: incidence, sources, effects, detection, elimination, prevention. Cytotechnology, v.39, n.2, p.75-90, 2002 Available from: <Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3463982/ >. Accessed: May, 24, 2023.
» https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3463982/ -
GARNER, C. M. et al. Mycoplasma detection in cell cultures: a comparison of four methods. British journal of biomedical science, v.57, n.4, p.295-301, 1 jan. 2000 Available from: <Available from: https://europepmc.org/article/med/11204859 >. Accessed: May, 20, 2023.
» https://europepmc.org/article/med/11204859 -
GAYNOR, M.; MANKIN, A. Macrolide antibiotics: binding site, mechanism of Action, Resistance. Current Topics in Medicinal Chemistry, v.3, n.9, p.949-960, 1 may. 2003 Available from: <Available from: https://pubmed.ncbi.nlm.nih.gov/12678831/ >. Accessed: May 20, 2023. doi: 10.2174/1568026033452159.
» https://doi.org/10.2174/1568026033452159.» https://pubmed.ncbi.nlm.nih.gov/12678831/ -
GERAGHTY, R. J. et al. Guidelines for the use of cell lines in biomedical research. British Journal of Cancer, v.111, n.6, p.1021-1046, 12 ago. 2014. Available from: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4453835/>. doi: 10.1038%2Fbjc.2014.166.
» https://doi.org/10.1038%2Fbjc.2014.166» https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4453835/ -
HUANG, X. et al. Prevention, diagnosis and eradication of mycoplasma contamination in cell culture. Journal of Biological Methods, v.10, p.e99010005, 2023. Available from <Available from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10668599/ >. Accessed: Jan. 10, 2024.
» https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10668599/ -
MARIOTTI, E. et al. Mollicutes contamination: A new strategy for an effective rescue of cancer cell lines. Biologicals, v.40, n.1, p.88-91, jan. 2012. Available from: <Available from: https://www.sciencedirect.com/science/article/pii/S1045105611001813?via%3Dihub >. Accessed: June 2, 2023. doi: 10.1016/j.biologicals.2011.10.006.
» https://doi.org/10.1016/j.biologicals.2011.10.006.» https://www.sciencedirect.com/science/article/pii/S1045105611001813?via%3Dihub -
MCGARRITY, G. J. Detection of Mycoplasmal Infection of cell cultures. Advances in Cell Culture, v.2, p.99-131, 1982. Available from: <Available from: https://www.sciencedirect.com/science/article/abs/pii/B9780120079025500099 >. Accessed: Jun. 02, 2023. doi: 10.1016/B978-0-12-007902-5.50009-9.
» https://doi.org/10.1016/B978-0-12-007902-5.50009-9.» https://www.sciencedirect.com/science/article/abs/pii/B9780120079025500099 -
KAZEMIHA, V. M. et al. PCR-based detection and eradication of mycoplasmal infections from various mammalian cell lines: a local experience. Cytotechnology, v.61, n.3, p.117-124, 1 dez. 2009. Available from: <Available from: https://link.springer.com/article/10.1007/s10616-010-9252-6 >. Accessed: Jun. 03, 2023. doi: <Available from: https://doi.org/10.1007/s10616-010-9252-6 >.
» https://link.springer.com/article/10.1007/s10616-010-9252-6» https://doi.org/10.1007/s10616-010-9252-6 -
KAZEMIHA, V. M. et al. Efficiency of Plasmocin TM on various mammalian cell lines infected by mollicutes in comparison with commonly used antibiotics in cell culture: a local experience. Cytotechnology, v.63, n.6, p.609-620, 25 ago. 2011. Available from: <Available from: https://pubmed.ncbi.nlm.nih.gov/21866311/ >. Accessed: Aug. 22, 2023. doi: 10.1007/s10616-011-9378-1.
» https://doi.org/10.1007/s10616-011-9378-1.» https://pubmed.ncbi.nlm.nih.gov/21866311/ -
RAWADI, G.; DUSSURGET, O. Advances in PCR-based detection of mycoplasmas contaminating cell cultures. Genome Research, v.4, n.4, p.199-208, 1 fev. 1995. Available from: <Available from: https://pubmed.ncbi.nlm.nih.gov/8574187/ >. Accessed: Jun. 05, 2023. doi: 10.1101/gr.4.4.199.
» https://doi.org/10.1101/gr.4.4.199.» https://pubmed.ncbi.nlm.nih.gov/8574187/ -
ROTTEM, S. Beware of mycoplasmas. Trends in Biotechnology, v.11, n.4, p.143-151, abr. 1993. Available from: <Available from: https://www.sciencedirect.com/science/article/abs/pii/016777999390089R?via%3Dihub >. Accessed: Jan. 20 2024. doi: 10.1016/0167-7799(93)90089-R.
» https://doi.org/10.1016/0167-7799(93)90089-R.» https://www.sciencedirect.com/science/article/abs/pii/016777999390089R?via%3Dihub -
ROTTEM, S. et al. Contamination of tissue cultures by mycoplasmas, IntechOpen, 2012. Available from: <Available from: https://www.intechopen.com/chapters/40228 >. Accessed: May, 23, 2023. doi: 10.5772/51518.
» https://doi.org/10.5772/51518.» https://www.intechopen.com/chapters/40228 -
SIMPSON, E. J. et al. A simple method for the removal of mycoplasma contamination from paramyxovirus stocks. Journal of Virological Methods, v.6, n.3, p.127-134, mar. 1983. Available from: <Available from: https://www.sciencedirect.com/science/article/abs/pii/0166093483900241?via%3Dihub >. Accessed: May, 19, 2023. doi: 10.1016/0166-0934(83)90024-1.
» https://doi.org/10.1016/0166-0934(83)90024-1.» https://www.sciencedirect.com/science/article/abs/pii/0166093483900241?via%3Dihub - UPHOFF, C. C.; DREXLER, H. G. Elimination of mycoplasmas from infected cell lines using antibiotics. Methods in Molecular Biology (Clifton, N.J.), v.731, p.105-114, 2011.
-
WOLFORD, R. G.; HETRICK, F. M. Elimination of Mycoplasma Contaminants from Virus Stocks by Treatment with Nonionic Detergents. Applied Microbiology, v.24, n.1, p.18-21, 1972. Available from: <Available from: https://pubmed.ncbi.nlm.nih.gov/4341521/ >. Accessed: May, 20,2023. doi: 10.1128/am.24.1.18-21.1972.
» https://doi.org/10.1128/am.24.1.18-21.1972.» https://pubmed.ncbi.nlm.nih.gov/4341521/ -
YOSHIZAWA, S. Structural origins of gentamicin antibiotic action. The EMBO Journal, v.17, n.22, p.6437-6448, 16 nov. 1998. Available from: <Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1170992/ >. Accessed: May, 19, 2023. doi: 10.1093/emboj/17.22.6437.
» https://doi.org/10.1093/emboj/17.22.6437.» https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1170992/
Edited by
-
Editors: Leandro Souza da Silva (0000-0002-1636-6643) Juliana Felipetto Cargnelutti (0000-0002-3160-3643)






