Open-access Transcriptome analysis of resistant soybean roots infected by Meloidogyne javanica

Abstract

Soybean is an important crop for Brazilian agribusiness. However, many factors can limit its production, especially root-knot nematode infection. Studies on the mechanisms employed by the resistant soybean genotypes to prevent infection by these nematodes are of great interest for breeders. For these reasons, the aim of this work is to characterize the transcriptome of soybean line PI 595099-Meloidogyne javanica interaction through expression analysis. Two cDNA libraries were obtained using a pool of RNA from PI 595099 uninfected and M. javanica (J2) infected roots, collected at 6, 12, 24, 48, 96, 144 and 192 h after inoculation. Around 800 ESTs (Expressed Sequence Tags) were sequenced and clustered into 195 clusters. In silico subtraction analysis identified eleven differentially expressed genes encoding putative proteins sharing amino acid sequence similarities by using BlastX: metallothionein, SLAH4 (SLAC1 Homologue 4), SLAH1 (SLAC1 Homologue 1), zinc-finger proteins, AN1-type proteins, auxin-repressed proteins, thioredoxin and nuclear transport factor 2 (NTF-2). Other genes were also found exclusively in nematode stressed soybean roots, such as NAC domain-containing proteins, MADS-box proteins, SOC1 (suppressor of overexpression of constans 1) proteins, thioredoxin-like protein 4-Coumarate-CoA ligase and the transcription factor (TF) MYBZ2. Among the genes identified in non-stressed roots only were Ser/Thr protein kinases, wound-induced basic protein, ethylene-responsive family protein, metallothionein-like protein cysteine proteinase inhibitor (cystatin) and Putative Kunitz trypsin protease inhibitor. An understanding of the roles of these differentially expressed genes will provide insights into the resistance mechanisms and candidate genes involved in soybean-M. javanica interaction and contribute to more effective control of this pathogen.

gene expression; root knot nematode; transcriptome


RESEARCH ARTICLE

Transcriptome analysis of resistant soybean roots infected by Meloidogyne javanica

Maria Eugênia Lisei de SáI,V; Marcus José Conceição LopesII,III; Magnólia de Araújo CamposII,III; Luciano Vilela PaivaIII; Regina Maria Santos de Amorim; Magda Aparecida BeneventiV; Alexandre Augusto Pereira FirminoIV,V; Maria Fátima Grossi de SáV

IEmpresa de Pesquisa Agropecuária de Minas Gerais, Uberaba, MG, Brazil

IIUniversidade Federal de Campina Grande, Centro de Educação e Saúde, Cuité, PB, Brazil

IIIUniversidade Federal de Lavras, Lavras, MG, Brazil

IVUniversidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil

VLaboratório Interação Molecular Planta-Praga, Embrapa Recursos Genéticos e Biotecnologia, Brasília, DF, Brazil

Send correspondence to

ABSTRACT

Soybean is an important crop for Brazilian agribusiness. However, many factors can limit its production, especially root-knot nematode infection. Studies on the mechanisms employed by the resistant soybean genotypes to prevent infection by these nematodes are of great interest for breeders. For these reasons, the aim of this work is to characterize the transcriptome of soybean line PI 595099-Meloidogyne javanica interaction through expression analysis. Two cDNA libraries were obtained using a pool of RNA from PI 595099 uninfected and M. javanica (J2) infected roots, collected at 6, 12, 24, 48, 96, 144 and 192 h after inoculation. Around 800 ESTs (Expressed Sequence Tags) were sequenced and clustered into 195 clusters. In silico subtraction analysis identified eleven differentially expressed genes encoding putative proteins sharing amino acid sequence similarities by using BlastX: metallothionein, SLAH4 (SLAC1 Homologue 4), SLAH1 (SLAC1 Homologue 1), zinc-finger proteins, AN1-type proteins, auxin-repressed proteins, thioredoxin and nuclear transport factor 2 (NTF-2). Other genes were also found exclusively in nematode stressed soybean roots, such as NAC domain-containing proteins, MADS-box proteins, SOC1 (suppressor of overexpression of constans 1) proteins, thioredoxin-like protein 4-Coumarate-CoA ligase and the transcription factor (TF) MYBZ2. Among the genes identified in non-stressed roots only were Ser/Thr protein kinases, wound-induced basic protein, ethylene-responsive family protein, metallothionein-like protein cysteine proteinase inhibitor (cystatin) and Putative Kunitz trypsin protease inhibitor. An understanding of the roles of these differentially expressed genes will provide insights into the resistance mechanisms and candidate genes involved in soybean-M. javanica interaction and contribute to more effective control of this pathogen.

Key words: gene expression, root knot nematode, transcriptome.

Introduction

Soybean is the most important agricultural commodity in the world, both in terms of value and quantity. Besides, it is an attractive crop for the production of renewable fuels such as biodiesel. Root-knot nematode (RKN-Meloidogyne spp.) is a serious constraint for many crops, and can significantly affect crop productivity worldwide. In Brazil, this pathogen was responsible for economic losses of over US$52.2 million during the 1999/2000 harvest (Yorinori, 2000).

The use of nematode-resistant cultivars is the most economical and environmentally friendly management strategy for the control of the pathogen (Boerma and Hussey, 1992). The Plant Introduction (PI) 595099, a soybean genotype that is highly resistant to RKN species and to the soybean cyst nematode (SCN) Heterodera glycines (Davis et al., 1998), has been successfully used as a new source of nematode resistance in Brazilian breeding programs (Silva, 2001).

Many physiological changes associated with stress response in plants are controlled at the transcriptional level. Several studies of gene expression have contributed to elucidate the physiological response to infection of soybean roots with Heterodera glycines (Alkharouf et al., 2004, 2005; Khan et al., 2004; Klink et al., 2005; Ithal et al., 2007a,b). Through microarray analysis, it was possible to identify 429 differentially expressed genes during susceptible soybean-H. glycines interaction (Ithal et al., 2007a). These included genes encoding enzymes involved in plant secondary metabolism, such as the biosynthesis of phenolic compounds, lignin, and flavonoids that were up-regulated early during nematode infection and remained overexpressed throughout nematode development. Similarly, genes related to stress and defense responses like pathogenesisrelated proteins (PR), cell wall modification enzymes, cellular signaling proteins, and transcriptional regulation factors were consistently up-regulated. Transcript profiling analysis of developing syncytia induced in susceptible soybean by SCN showed interplay among phytohormones that likely regulate synchronized changes in the expression of genes encoding cell wall-modifying proteins. This process appears to be tightly controlled and coordinated with cell wall rigidification processes that may involve lignification of feeding cell walls (Ithal et al., 2007b).

Expressed sequence tags analyzed in other plants inoculated with Meloidogyne spp. identified several genes similar to the ones found in compatible soybean-Heterodera interaction. For instance, in susceptible Arachis spp. inoculated with M. arenaria, arp (auxin-repressed protein) genes were up-regulated whereas cytokynine oxygenase, metallothionein and resveratrol synthase were downregulated (Proite K, 2007, Doctoral thesis, Universidade de Brasília). The characterization of the transcriptional profile of a compatible tomato response to Javanese nematode demonstrated significant changes in the steady-state transcript levels of several functional categories, including pathogenesis-related genes, hormone-associated genes and development-associated transcription factors (Bar-Or et al., 2005). Responses to M. incognita infection in roots of a resistant cowpea (Vigna unguiculata L. Walp.) genotype and a susceptible near-isogenic line showed that a greater number and proportion of genes were down-regulated in the resistant than in the susceptible genotype, whereas more genes were up-regulated in the susceptible than in the resistant genotype (Das et al., 2010).

In this work we used EST sequence analysis from cDNA libraries of soybean PI 595099 roots at 6, 12, 24, 48, 96, 144 and 192 h after infection (h.a.i.) with M. javanica to assess the gene expression changes during this interaction. This study could lead to new target genes for nematode control and identify candidates for broadening plant resistance to this pathogen through over-expression or gene silencing.

Material and Methods

Nematode inoculum

M. javanica eggs cultured on susceptible tomato host plants were extracted from roots using 0.5% bleach solution (Boneti and Ferraz, 1981) and cleaned with caulim (Coolen and D'Herde, 1972). Eggs were hatched at room temperature and J2 were collected in fresh deionized water.

Root infections for microarray analysis

Soybean PI 595099 seeds were surface sterilized using 10% (v/v) bleach solution, sown in sterilized sand and maintained under controlled environmental conditions at 26.7 ± 2.0 ºC temperature and a 16-h photoperiod. After three days, the seedlings were transplanted to seedling growth pouches with sterilized substrate. Eight days after transplant each plantlet was inoculated with 500 J2 M. javanica larvae in 5 mL of deionized water. Five repetitions of inoculated and non-inoculated roots (mock control) were collected at 0, 6, 12, 24, 48, 96, 144 and 192 h after inoculation (h.a.i.). Infected and non-infected plants were arranged in a completely randomized design under greenhouse conditions.

RNA isolation

Total RNA from nematode infected and non-infected roots was isolated using Trizol (Invitrogen) reagent and cleaned with RNeasy Mini Kit for RNA cleanup (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's protocol. RNA was treated with RNase-Free DNase (Qiagen) to digest any remaining genomic DNA. RNA was quantified using a UV-spectrophotometer and its quality and integrity was examined in 1.2% agarose gel containing ethidium bromide.

cDNA cloning

Two cDNA libraries were constructed comprising the control and the pooled infected root tissues from all intervals. The libraries were prepared using the SMART cDNA Library Construction Kit (Clontech Laboratories, Palo Alto, CA, USA) according to the manufacturer's instructions. Briefly, the double-stranded cDNAs were fractioned and cloned in the pTriplEx 2 vector of the same kit according to the manufacturer's protocol. The library was amplified in Escherichia coli DH-5 cells (Invitrogen), placed on LB agar and grown overnight at 37 ºC. Plasmid preparations of the individual transformants were performed in 96-well plates.

EST sequencing

cDNA inserts were sequenced using specific primers PTR2 (5'CCGCATGCATAAGCTTGCTC3' -Reverse) and PTF2 (5'GCGCCATTGTGTTGGTACCC3' -Forward) at Embrapa Genetic Resources and Biotechnology, Brazil. Nucleotide sequences and predicted amino acid sequences were analyzed using the SisGen software (Pappas et al., 2008) and Fisher (1932) statistical tests to reveal differential gene expression (Table 1). The criteria applied were a minimum of 30-base similarity between sequences and at least 90% identity. Semiautomatic annotation was performed by BlastX 2.2.3 (Altschul et al., 1990), SwissProt (Bairoch and Apweiler, 1997) and sequences were clustered according to their putative functions by using COG (Clusters of Orthologous Groups of Proteins) (Tatusov et al., 2003). The sequences were grouped into contigs. The EST database is housed at the Soybean Genome Project Database (SGPD).

Results

EST validation

Throughout the analysis of the two (RKN-infected and mock control) sequenced cDNA libraries a total of 2,112 sequence reads were obtained and 877 accepted (41%). The valid ESTs were distributed in 195 clusters, these being 79 contigs, and 116 singletons. From these, 55 contigs originated from inoculated (Table 2) and 24 from non-inoculated (Table 3) roots. In silico comparison of the two libraries using the statistical tests of Stekel et al. (2000), Audic andClaverie (1997) and Fisher (1932) (p < 0.005) revealed 11 contigs with significant variation in their transcript levels (Table 1). These transcriptional changes might result from the up-regulation of transcription level or from reduced mRNA expression due to nematode infection.

Functional classification of ESTs homologous to genes of known function

Overall, the most abundant transcripts observed in PI 595099 roots included ESTs encoding genes involved in cell communication/signal transduction [(zinc finger, AN1-type; A20-type); (Nuclear transport factor 2 (NTF-2)], followed by hormonal regulation (Auxin-repressed protein), cellular metabolism [(SLAH4 (SLAC1 Homologue 4); SLAH1 (SLAC1 Homologue 1)], regulation of cell-environment interaction, cellular defense (metallothionein-like proteins), protein synthesis (60S ribosomal proteins) and resistance metabolism (thioredoxin) (Figure 1 and Table 1).


Discussion

In general, the onset of responses governing pest resistance in plants depends on the genotype/species, magnitude and rapidity in which the genes are expressed during the infection. Recently modulated transcript abundance was demonstrated in resistant and susceptible soybean roots during SCN interactions (Mazarei et al., 2011) and also during susceptible soybean-RKN interaction (Ibrahim et al., 2011). The goal of this work was to describe transcriptional changes in PI 595099 resistant soybean line roots during the early stages (6, 12, 24, 48, 96, 144 and 192 h) of infection with M. javanica. The in silico functional characterization of the transcribed reads from both libraries revealed a number of genes related either to biotic or abiotic stresses. Here, among the defense responses of PI 595099 towards M. javanica are included up-regulated genes encoding for zinc finger, AN1-type; A20-type; Nuclear transport factor 2 (NTF-2); Auxin-repressed protein; SLAH4 (SLAC1 Homologue 4); SLAH1 (SLAC1 Homologue 1); metallothionein-like proteins, 60S ribosomal proteins and thioredoxin.

Metallothioneins belong to a family of cysteine-rich low molecular weight metal-binding proteins in which the presence of thiol groups promotes its high affinity to heavy metal ions, such as zinc and copper (Inácio AF, 2006, Master's thesis, Escola Nacional de Saúde Pública - FIOCRUZ). Plants expressing metallothioneins better tolerate soils and substrates that are rich in heavy metal ions and are capable of mitigating the damage caused by reactive oxygen species (ROS) (Chiang et al., 2006), which is associated with hypersensitive response (Wong et al., 2004). In Arachis spp., metallothionein-3 expression was observed only in roots inoculated with M. arenaria race 1 (Proite K, 2007, Doctoral thesis, Universidade de Brasilia). Infected roots of PI 595099 over-expressing the metallothionein gene might use its protein product as a defense mechanism, acting directly in the cell, affecting ROS concentration, in order to avoid damage to the cell wall and even nucleic acids.

SLAC1 (Slow Anion Channel-Associated 1) has been shown to be essential for stomata closure in response to CO2, abscisic acid, ozone, light/dark transitions, humidity, calcium ions, hydrogen peroxide and nitric oxide (Negi et al., 2008). The two SLAC1 genes (SLAH4 and SLAH1), expressed only in inoculated root libraries, are possibly involved in ionic regulation, suggested as a defense mechanism of this genotype.

The gene that encodes a 60S ribosomal protein was also significantly regulated in stressed PI 595099 roots. This gene plays an important role in the elongation step of protein synthesis and in this study it might be related to an increase in protein synthesis from genes involved in the defense response to M. javanica.In Poncirus trifoliata its expression was up-regulated when infected by Citrus tristeza virus (Cristofani-Yaly et al., 2007).

There are other transcripts that might be induced in resistant soybean roots during nematode infection, such as the zinc finger protein (Zinc finger, AN1-type, A20-type), which belongs to the gene superfamily SAP (Stress Associated Proteins). Members of this family have been classified according to the number of Cys-His residues that bind the zinc ion (Ciftci-Yilmaz and Mittler, 2008) and are involved in DNA recognition, RNA packaging, transcriptional activation, regulation of apoptosis, protein folding and assembly, and lipid binding (Laity et al., 2001). In cDNA libraries of Poncirus trifoliata infected with Citrus tristeza virus (CTV), zinc finger genes were up-regulated, suggesting the importance of this gene in the plant response to viral infection (Cristofani-Yaly et al., 2007). The exclusive expression of this gene in PI 595099 inoculated roots may indicate the activation of cellular metabolism related to stress in an attempt to control larvae development.

Two arp (Auxin Repressed Protein) genes were differentially expressed in response to nematode infection (Table 1). These genes were previously described in strawberry (Reddy and Poovaiah, 1990), tobacco (Steiner et al., 2003) and pepper (Hwang et al., 2005). They are very similar to genes involved in a dormancy mechanism, with dormancy gene expression being repressed by auxin (Reddy and Poovaiah, 1990; Brinkler et al., 2004; Shimizu et al., 2006). The expression of arp genes is associated with several stresses, such as water stress (Kohler et al., 2003), salt and low temperature (Hwang et al., 2005), fungus (Coram and Pang, 2006), as well as nematode infection (Alkharouf et al., 2004; Proite K, 2007, Doctoral thesis, Universidade de Brasília), among others. Nevertheless, little is known of the importance of arp genes during plant-nematode interaction (de Almeida-Engler et al., 1999). This study provides insights into the arp gene as a possible target of future investigation during plant stress responses, especially in nematode-interactions, since root knot formation is controlled by plant hormones such as auxin (Kim et al., 2007)

In addition to the genes mentioned previously, two Thioredoxin (Trxs) genes were found exclusively in the cDNA libraries from stressed soybean roots. Trxs are small proteins with a redox-active disulfide bridge and are important regulatory elements in plant metabolism (Gelhaye et al., 2005). Two new Trxs isoforms were found specifically in legume with redox potential values similar to those of the classical Trxs, and one of them was shown to act as a substrate for the Medicago truncatula NADP-Trx reductase (Alkhalfioui et al., 2008). In tomato, it was first demonstrated that a CITRX (Cf-9-interacting binding thioredoxin) plays a role in the regulation of plant disease resistance induced through Cf-9 (Rivas et al., 2004). The Trx gene revealed herein as differentially expressed in soybean infected roots may exert negative regulation on plant metabolism and then enhance defense and hypersensitive response (HR).

Gene transcripts with homology to Nuclear Transport Factor 2 ( NTF2) were significantly up-regulated in infected soybean roots. A previous study has shown that the overexpression of an NTF2 (IAtNF2a) blocked the nuclear import of a plant transcription factor in Nicotiana benthamiana leaves, indicating that the excess of AtNTF2a disrupted nuclear import of a small multifunctional GTPase (Ran) involved in nucleo-cytoplasmic transport, mitotic spindle assembly, and nuclear envelope formation, in a Ran-binding dependent manner (Zhao et al., 2006). The NTF2 gene was up-regulated threefold in PI595099 stressed roots, and this gene is probably contributing to an occasional abnormal cellular disorganization associated with nematode infection observed in these roots (data not shown).

Many compounds involved in plant defense are synthesized in the phenylpropanoid biosynthesis pathway, such as lignin and phytoalexins. Several stress-induced phenylpropanoids can lead to cell wall polymerization, which is the first physical barrier for pathogen resistance (Dixon and Paiva, 1995). MYB represents the largest transcription factor family in Arabidopsis thaliana (Chen et al., 2005) and is reported to contribute to defense response and regulatory processes in higher plants (Yanhui et al., 2006). The expression patterns herein observed for MYB TFs might be indirectly involved in soybean cell wall resistance, and we infer that they may prevent larvae from penetrating, and therefore would reduce and/or delay gall formation, as observed in PI 595099 roots (data not shown).

An important gene encoding a NAC-domain protein (such as NAM, ATAF1 and CUC2 genes) was detected in the stressed PI 595099 libraries only (Contig73, Table 2). Members of this superfamily of transcription factors possess an N-terminal conserved amino acid sequence named NAC domain and are widely distributed in the plant genomes. The importance of this protein family in a range of biological processes has been reviewed by Olsen et al. (2005). These processes include embryonic, floral and vegetative development, lateral root formation, senescence and auxin signaling, as well as defense and wounding stresses. Members of this family were extensively studied in A. thaliana, which contains more than 90 representatives of NAC domain proteins (AtNAC). It has been also reported that the AtNAC2 gene plays a role in the ethylene and auxin signaling pathways, and is involved in the salt stress response and lateral root development (He et al., 2005).

Another member of this family, the SND1 gene (Secondary wall-associated NAC Domain proteins), is a key regulator compound in the secondary wall of A. thaliana fibers (Zhong et al., 2006). In studies based on the Afimettrix soybean GeneChip, NAC transcription factor probe sets were consistently induced in the resistant TN02 line and suppressed in the susceptible soybean TN02-275 line sister during SCN race 2-interaction (Mazarei et al., 2011). The role of this gene in the resistance response to M. javanica infection in soybean is unknown, but it might be induced by ethylene during injuries caused in the roots by larvae, or in cell-wall strengthening during J2 penetration.

Aquaporin transcripts, such as PIP (plasma membrane intrinsic protein), one of the four groups of plant aquaporins, were also represented in the RKN-infected roots. Aquaporin is a water channel protein that shows increased expression levels in cell membranes and has an important function in cell expansion and division (Okubo-Kurihara et al., 2009). Aquaporin genes have been demonstrated to be associated with H. glycines-inoculated soybean roots (Klink et al., 2005) and rice leaves resistant to Magnaporthe grisea (Jantasuriyarat et al., 2005), indicating that these genes might have relevant roles in plant defense responses. We infer that the presence of aquaporin PIP in PI 595099 stressed roots may elicit the plant defense machinery via water deficit signaling.

Many other genes encoding proteins involved in plant defense were identified in this study, such as the DAD1 (defender against cell death 1) protein, MADS-box protein SOC 1 (suppressor of overexpression constans 1) protein, cytochrome C reductase, SAP (Stress Associated Proteinsdomain), glutathione-S-transferase, as well as proteins related to secondary metabolism pathways, such as chalcone synthase and 4-coumarate-CoA. Further studies on these genes will certainly contribute considerably to the understanding of the PI 595099 resistance mechanisms to M. javanica.

It was expected that the gene expression pattern in non-stressed roots would reflect normal root development, and not surprisingly, several ESTs encoding proteins that are involved in plant stress response, including Ser/Thr protein kinase, putative Kunitz trypsin protease inhibitor, cysteine proteinase inhibitor, ethylene-responsive family protein and Metallothionein-like protein 1, were represented in the libraries (Table 3). Apparently, the presence of these genes at a low level might indicate an efficient basal resistance, or an injury response due to root development. Provided that these genes have been described to be involved in both injury and insect attack response (Singh et al., 2008; Luo et al., 2009), certain features of the PI 595099 resistance mechanism are probably present in the plant even before pathogen penetration, and the genes discussed in this study (and probably others) are up-regulated so as to to fully express the resistance phenotype.

In conclusion, this study provided a global profile of gene expression changes in soybean PI 595099 during RKN attack, elucidating some elements involved in an incompatible interaction with M. javanica. Validation of the most relevant genes by quantitative PCR should provide a better understanding of RKN parasitism of soybean and aid in the identification of potential targets for genetic improvement of several crops. In addition, histological characterization studies, by monitoring various time points in the penetration and development of M. javanica juveniles (J2) in soybean PI 595099 roots, will provide insights by associating these plant resistance responses with the RKN interaction, and this is the subject of our current studies.

Acknowledgments

This work received financial support from Fundação de Amparo à Pesquisa do Estado de Minas Gerais (Fapemig) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq).

Internet Resources

Soybean Genome Project Database (SGPD, http://bioinfo03.ibi.unicamp.br/soja/ (September 21, 2011).

License information: This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

ERRATA

Maria Eugênia Lisei de Sá, Marcus José Conceição Lopes, Magnólia de Araújo Campos, Luciano Vilela Paiva, Regina Maria Amorim dos Santos, Magda Aparecida Beneventi, Alexandre Augusto Pereira Firmino and Maria Fátima Grossi de Sá. Transcriptome analysis of resistant soybean roots infected by Meloidogyne javanica. Genetics and Molecular Biology 35(Suppl. 1), 272-282, 2012.

The correct name of the fifth author is: Regina Maria Santos de Amorim.

References

  • Alkhalfioui F, Renard M, Frendo P, Keichinger C, Meyer Y, Gelhaye E, Hirasawa M, Knaff DB, Ritzenthaler C and Montrichard F (2008) Novel type of thioredoxin dedicated to symbiosis in legumes. Plant Physiol 148:424-435.
  • Alkharouf N, Khan R and Matthews B (2004) Analysis of expressed sequence tags from roots of resistant soybean infected by the soybean cyst nematode. Genome 47:380-388.
  • Alkharouf NW, Klink VP, Chouikha IB, Beard HS, MacDonald MH, Meyer S, Knap HT, Khan R and Matthews BF (2005) Time course microarray analyses reveal global changes in gene expression of susceptible Glycine max (soybean) roots during infection by Heterodera glycines (soybean cyst nematode). Planta 224:838-852.
  • Altschul SF, Gish W, Miller W, Myers EW and Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403-410.
  • Audic S and Claverie JM (1997) The significance of digital gene expression profiles. Genome Res 7:986-995.
  • Bairoch A and Apweiler R (1997) The SWISS-PROT protein sequence data bank and its supplement TREMBL. Nucleic Acids Res 25:31-36.
  • Bar-Or C, Kapulnik Y and Koltai H (2005) A broad characterization of the transcriptional profile of the compatible tomato response to the plant parasitic root knot nematode Meloidogyne javanica Eur J Plant Pathol 111:181-192.
  • Boerma D and Hussey RS (1992) Breeding plants for resistance to nematodes. J Nematol 24:242-252.
  • Boneti JIS and Ferraz S (1981) Modificação do método de Hussey e Barker para extração de ovos de Meloidogyne exigua de cafeeiro. Fitopatol Bras 6:553.
  • Brinkler M, Van-ZYL L, Liu W, Craig D, Sederoff RR, Clapham DH and von Arnould S (2004) Microarray analysis of gene expression during adventitious root development in Pinus contorta Plant Physiol 135:1-13.
  • Chen R, Ni Z, Nie X, Qin Y, Dong G and Sun Q (2005) Isolation and characterization of genes encoding Myb transcription factor in wheat (Triticum aestivum L.). Plant Sci 169:11461154.
  • Chiang HC, Lo JC and Yeh KC (2006) Genes associated with heavy metal tolerance and accumulation in Zn/Cd hyperaccumulator Arabdopsis halleri: A genomic survey with cDNA microarray. Environ Sci Technol 40:6792-6798.
  • Ciftci-Yilmaz S and Mittler R (2008). The zinc finger of network of plants. Cell Mol Life Science 65:1150-1160.
  • Coram TE and Pang EC (2006) Expression profiling of chickpea genes differentially regulated during a resistance response to Ascochytarabiei Plant BioJ 4:647:666.
  • Cristofani-Yaly M, Berger IJ, Targon MLPN, Takita MA, De Dorta S, Freitas-Astúa J, De Souza AA, Boscoriol-Camargo RL, Reis MS and Machado MA (2007) Differenttial expression of genes identified from Poncirustrifoliata tissue inoculated with CTV analysis and in silico hybridization. Genet Mol Biol 30(Suppl 3):972-979.
  • Coolen WA and D'Herde CJ (1972) A Method for the Quantitative Extraction of Nematodes from Plant Tissue Culture. State Agriculture Research Centre, Ghent, 77 pp.
  • Das S, Ehlers JD, Close TJ and Roberts PA (2010) Transcriptional profiling of root-knot nematode induced feeding sites in cowpea (Vigna unguiculata L. Walp.) using a soybean genome array. BMC Genomics 11:e480.
  • Davis EL, Meyers DM, Burton JW and Barker KR (1998) Resistance to root-knot, reniform, and soybean cyst nematodes in selected soybean breeding lines. J Nematol 30:530-541.
  • de Almeida-Engler J, Vleesschauwer VDE, Burssens S, Celenza-Junior JL, Inzé D, Montagu MV, Engler G and Gheysen G (1999) Molecular markers and cell cycle inhibtors show the importance of cell cycle progression in nematode-induced galls and syncytia. Plant Cell 11:793-808.
  • Dixon RA and Paiva NL (1995) Stress-induced phenylpropanoid metabolism. Plant Cell 7:1085-1097.
  • Fisher RA (1932) Statistical Methods for Research Workers. 4th edition. Oliver & Boyd, London, 307 pp.
  • Gelhaye E, Rouhier N, Navrot N and Jacquot JP (2005) The plant thioredoxin system. Cell Mol Life Sci 62:24-35.
  • He X-J, Um RL, Cao W-H, Zhang Z-G, Zhang J-S and Chen S-Y (2005) AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development. Plant J 44:903-916.
  • Hwang EW, Kim KA, Park SC, Jeong MJ, Byun MO and Kwon HB (2005) Expression profiles of hot pepper (Capsicum annuum) genes under cold stress conditions. J Biosci 30:101-111.
  • Ibrahim HMM, Hosseini P, Alkharouf NW, Hussein EHA, El-Din AEKYG, Aly MAM and Matthews BF (2011) Analysis of gene expression in soybean (Glycine max) roots in response to the root-knot nematode Meloidogyne incognita using microarrays and KEGG pathways. BMC Genomics 12:e220.
  • Ithal N, Recknor J, Nettleton D, Hearne L, Maier T, Baum TJ and Mitchum MG (2007a) Parallel genome-wide expression profiling of host and pathogen during soybean cyst nematode infection of soybean. Mol Plant-Microbe Interact 20:293-305.
  • Ithal N, Recknor J, Nettleton D, Maier T, Baum TJ and Mitchum MG (2007b) Developmental transcript profiling of cyst nematode feeding cells in soybean roots. Mol Plant-Microbe Interact 20:510-525.
  • Jantasuriyarat C, Gowda M, Haller K, Hatfiel J, Lu G, Stahlberg E, Zhou B, Li H, Kim H, Yu Y, et al. (2005) Large-scale Identification of expressed sequence tags involved in rice and rice blast fungus interactions genome analysis. Plant Physiol 138:105-115.
  • Khan R, Alkharouf N, Beard H, Mcdonald M, Chouikha I, Meyer S, Grefenstette J, Knap H and Matthews B (2004) Microarray analysis of gene expression in soybean roots susceptible to the soybean cyst nematode two days post invasion. J Nematol 36:241-248.
  • Kim HB, Lee H, Oh CJ, Lee NH and An CS (2007) Expression of EuNOD-ARP1 encoding auxin-repressed protein homolog is upregulated by auxin and localized to the fixation zone in root nodules of Elaeagnus umbellate Mol Cells 23:115-121.
  • Klink VP, Alkharouf N, Macdonald M and Mahews B (2005) Laser capture microdissection (LCM) and expression analyses of Glycine max (soybean) syncytium containing root regions formed by the plant pathogen Heterodera glycines (soybean cyst nematode). Plant Mol Biol 59:965-979.
  • Kohler A, Delaruelle C, Martin D, Encelot N and Martin F (2003) The poplar root transcriptome: Analysis of 7000 expressed sequence tags. FEBS Lett 542:37-41.
  • Laity JH, Lee BM and Wright PE (2001) Zinc finger proteins: New insights into structural and functional diversity. Curr Opin Struct Biol 11:39-46.
  • Luo ZB, Janz D, Jiang X, Göbel C, Wildhagen H, Tan Y, Rennenberg H, Feussner I and Polle A (2009) Upgrading root physiology for stress tolerance by ectomycorrhizas: Insights from metabolite and transcriptional profiling into reprogramming for stress anticipation. Plant Physiol 151:1902-1917.
  • Mazarei M, Liu W, Al-Ahmad H, Arelli PR, Pantalone VR and Stewart Jr CN (2011) Gene expression profiling of resistant and susceptible soybean lines infected with soybean cyst nematode. Theor Appl Genet 123:1193-1206.
  • Negi J, Matsuda O, Nagasawa T, Oba Y, Takahashi H, Kawai-Yamada M, Uchimiya H, Hashimoto M and Iba K (2008) CO2 regulator SLAC1 and its homologues are essential for anion homeostasis in plant cells. Nature 452:483-486.
  • Okubo-Kurihara E, Sano T, Higati T, Kutsuna N and Hasezawa S (2009) Acceleration of vacuolar regeneration and cell growth by overexpression of an aquaporin NtTIP1; in tocabacco BY-2 cells. Plant Cell Physiol 50:151-160.
  • Olsen AN, Ernst HA, Leggio LL and Skriver K. (2005) Transcriptional networks in plants NAC transcription factors: Structurally distinct, functionally diverse. Trends Plant Sci 10:79-87.
  • Pappas GR, Miranda RP, Martins NF, Fogawa RC and Costa MMC (2008) SisGen; A CORBA based data managenent program for DNA sequencing projects. Lect NotesComp Sci 5109:116-123.
  • Reddy ASN and Poovaiah BW (1990) Molecular cloning and sequencing of a cDNA for an auxin-repressed mRNA: Correlation between fruit growth and repression of the auxin regulated gene. Plant Mol Biol 14:127-136.
  • Rivas S, Rougon-Cardoso A, Smoker M, Schauser L, Yoshioka H and Jones JDG (2004) CITRX thioredoxin interacts with the tomato Cf-9 resistance protein and negatively regulates defence. EMBO J 23:2156-65.
  • Shimizu M, Suzuki K and Miyazawa Y (2006) Differential accumulation of the mRNA of the auxin-repressed gene CsGRP1 and the auxin induced peg formation during gravimorphogenesis of cumcuber seedlings. Planta 225:13-22.
  • Silva JFV (2001) Relações Parasito-Hospedeiro nas Meloidoginoses da Soja. Sociedade Brasileira de Nematologia e Embrapa Soja, Londrina, 227 pp.
  • Singh A, Singh IK and Verma PK (2008) Differential transcript accumulation in Cicerarietinum L. in response to a chewing insect Helicoverpa armigera and defence regulators correlate with reduced insect performance. J Exp Bot 59:2379-2392.
  • Steiner C, Bauer J, Amrhein N and Bucher M (2003) Two novel genes are differentially expressed during early germination of the male gametophyte of Nicotiana tabacum Biochim Biophys Acta 1625:123-133.
  • Stekel DJ, Git Y and Falciani F (2000) The comparison of gene expression from multiple cDNA libraries. Genome Res 10:2055-2061.
  • Tatusov R, Federova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov DM, Mazumder R, Mekhedov SL, Nikolskya AN, et al. (2003) The COG database: An updated version includes eukaryotes. BMC Bioinformatics 4:e41.
  • Wong HL, Sakamoto T, Kawasaki T, Umemura K and Shimamoto, K (2004) Down-regulation of metallothionein, a reactive oxygen scavenger, by the small GTPase OsRac1 in rice. Plant Physiol 135:1447-1456.
  • Yanhui C, Xiaoyuan Y, Kun H, Meihua L, Jigang L, Zhaofeng G, Zhiqiang L, Yunfei Z, Xiaoxiao W, Xiaoming Q, et al. (2006) The MYB transcription factor superfamily of Arabidopsis: Expression analysis and phylogenetic comparison with the rice MYB family. Plant Mol Biol 60:107-124.
  • Yorinori JT (2000) Riscos de surgimento de novas doenças na cultura da soja. In: Anais do Congresso de Tecnologia e Competitividade da Soja no Mercado Global, Fundação MT, Cuiabá, pp 165-169.
  • Zhao Q, Leung S, Corbett A and Meier I (2006) Identificaton and characterization of the Arabidopsis orthologs of Nuclear Transport Factor 2, the nuclear import factor of Ran1. Plant Physiol 140:869-878.
  • Zhong R, Demura T and Ye ZH (2006) SND1, a NAC domain transcription factor, is a key regulator of secondary wall synthesis in fibers of Arabidopsis Plant Cell 18:3158-3170.
  • Send correspondence to:
    Maria Eugênia Lisei de Sá
    Parque Estação Biológica Av. W5 Norte (final)
    70770-917 Brasília, DF, Brazil
    E-mail:
  • Publication Dates

    • Publication in this collection
      01 June 2012
    • Date of issue
      2012
    location_on
    Sociedade Brasileira de Genética Rua Cap. Adelmio Norberto da Silva, 736, 14025-670 Ribeirão Preto SP Brazil, Tel.: (55 16) 3911-4130 / Fax.: (55 16) 3621-3552 - Ribeirão Preto - SP - Brazil
    E-mail: editor@gmb.org.br
    rss_feed Stay informed of issues for this journal through your RSS reader
    Go to top Report error