Accessibility / Report Error

Estudo caso-controle do polimorfismo do gene receptor da vitamina D em pacientes paquistaneses com artrite reumatoide

Peter John Attya Bhatti Noor ul Ain Tahir Iqbal Tayyaba Sadaf Javed Mehmood Malik Sobre os autores

Introdução

Artrite reumatoide (AR) é a doença inflamatória crônica mais comum. Caracteriza-se pela formação de autoanticorpos e destruição progressiva das articulações. Em pacientes com AR, a membrana sinovial fica primariamente afetada, mas a doença também pode afetar outros órgãos.11 Maalej A, Petit-Teixeira E, Michou L, Rebai A, Cornelis F, Ayadi H. Association study of VDR gene with rheumatoid arthritis in the French population. Genes Immun. 2005;6:707-11. AR é uma doença devastadora e de comum ocorrência, com prevalência de aproximadamente 1% na população mundial e de 0,14-0,3% na população paquistanesa; as mulheres são afetadas três vezes mais frequentemente do que os homens.22 Dai SE, Han XH, Zhao DB, Shi YQ, Liu Y, Meng JM. Prevalence of rheumatic symptoms, rheumatoid arthritis, ankylosing spondylitis, and gout in Shanghai, China: a Copcord study. J Rheumatol. 2003;30:2245-51. Ainda se desconhece a etiologia exata da AR, mas depende da interação de uma série de fatores ambientais e genéticos.33 Klareskog L, Padyukov L, Ronnelid J, Alfredsson L. Genes, environment and immunity in the development of rheumatoid arthritis. Curr Opin Immunol. 2006;18:650-5. Nos últimos anos, foi observado um papel crucial da vitamina D, um hormônio secosteroide que desempenha atividades através do VDR, e do próprio VDR na imunomodulação; assim, selecionamos o gene VDR com o objetivo de investigar seu impacto na suscetibilidade à AR. A proteína VDR é translacionada do gene VDR, que é extremamente polimórfico. As quatro variantes do gene VDR, rs2228570 no éxon 2, rs1544410, rs7975232 no íntron 8 e rs731236 no éxon 9, já foram amplamente estudadas; sabe-se também que essas variantes estão associadas a doenças autoimunes, como lúpus eritematoso sistêmico, doença de Addison, diabete do tipo I e AR.44 Kiran G, Debashish D. Vitamin D and rheumatoid arthritis: is there a link?. Int J Rheum Dis. 2008;11:206-11.

O estudo das diferenças na distribuição genotípica ajudaria a identificar as consequências da variação étnica dos alelos, por causa de diferentes backgrounds genéticos, e, além disso, dos elementos ambientais dissimiles. Este estudo também ajuda na interpretação e detecção da variabilidade fenotípica em termos de gravidade da doença. Com base nas distinções genotípicas, seria possível uma interpretação biológica por estudos de associação da doença. O polimorfismo rs1544410, localizado no íntron nas proximidades da região 3′ UTR, afeta o nível de transcrição do gene VDR, a estabilidade do transcripto e as modificações pós-transcricionais.55 Uitterlinden AG, Fang Y, Van Meurs JB, Pols HA, Van Leeuwen JP. Vitamin D receptor gene polymorphisms in relation to Vitamin D related disease states. J Steroid Biochem Mol Biol. 2004;89-90:187-93. Alguns dados previamente publicados demonstraram significância funcional na distribuição do genótipo rs1544410; em continuidade, nosso estudo pretendeu avaliar a associação do polimorfismo do VDR com AR em nossa população. É premente a necessidade de descobrir marcadores de risco genéticos potenciais de suscetibilidade à AR em nossa população paquistanesa, mas tal trabalho ainda não tinha sido feito para pacientes paquistaneses com AR.

Materiais e métodos

Foram recrutados para este estudo de caso-controle 100 pacientes e 100 controles saudáveis (indivíduos assintomáticos) equiparados para idade e gênero (tabela 1). Os pacientes que atendiam aos critérios de classificação de 2011 do American College of Rheumatology (ACR-2011) foram diagnosticados por reumatologistas da Rehmat Noor Clinic, Rawalpindi, que trabalharam em colaboração com nosso grupo de pesquisa. O estudo foi aprovado pelo Comitê de Ética em Pesquisa da ASAB-NUST e seguiu as orientações da Declaração de Helsinque; foi obtido consentimento informado. Amostras de sangue de todos os pacientes com AR e também dos controles saudáveis foram coletadas em tubos contendo 0,5 M EDTA (ácido etilenodiaminotetracético). Investigamos o polimorfismo de nucleotídeo único (single nucleotide polymorphism - SNP) causador de troca de nucleotídeo único, de guanina (G) do alelo de maior frequência para adenina (A) do alelo de menor frequência, com o objetivo de verificar a presença de polimorfismo em nossa população.

Tabela 1
Características gerais da população estudada

O DNA genômico foi extraído das amostras de sangue coletadas com o uso do método do fenol-clorofórmio, com quantificação por nanogotas (Eppendorf™ Biophotometer Plus). Foram usados dois forward primers e um primer reverso comum (VDR-F1- 5′GCCACAGACAGGCCTGCG3′, VDR-F2-5′GCCACAGACAGGCCTGCA3′, VDR-R- 5′GTCACTGCACATTGCCTCCAA3′) manualmente desenhados para a genotipagem da variante não codificante do gene VDR (rs1544410) e foram amplificados por reação em cadeia da polimerase (PCR) e amplificação pelo sistema de mutação refratária (ARMS-PCR). Os produtos da PCR foram visualizados em agarose gel a 2% em seguida à amplificação em um termociclador 2.720 de 96 poços (Applied Biosystems). A análise estatística foi feita com o software Graphpad Prism 6 V; os testes do qui-quadrado (X2) e exato de Fisher bicaudal foram aplicados para uma análise da associação do polimorfismo rs1544410 em nossa população. Calculamos a odds ratio (OR) com um intervalo de confiança de 95%; e um valor de p <0,05 foi considerado estatisticamente significativo.

Resultados

Os cálculos para o teste de equilíbrio de Hardy-Weinberg (EHW) feitos para o grupo de controle não revelaram diferença significativa entre os valores observados e os valores esperados, com um valor de p = 0,0034, o que demonstra inserção em EHW. Isso sugere que não ocorreu desvio significativo nas frequências dos alelos observados nos pacientes, em comparação com os controles; portanto, os dois grupos se mostraram apropriados para uma análise mais aprofundada e para estudos associativos. A frequência de todos os genótipos possíveis também não demonstrou qualquer diferença em pacientes e indivíduos saudáveis (tabela 2 e figura 1A). Chegou-se a um valor de X 2 = 5,662 com uma probabilidade de erro (valor p = 0,0590). As frequências alélicas para pacientes com AR também não foram significativamente diferentes dos controles (tabela 2 e figura 1B). Os resultados observados indicaram a não existência de uma associação significativa entre SNP e AR. Portanto, nossos dados nulificaram qualquer associação significativa do polimorfismo do gene VDR com AR em nossa população. Também foi estudada uma associação específica para gênero com rs1544410, mas não foi demonstrada associação significativa entre mulheres e homens com AR (dados não mostrados).

Tabela 2
Distribuição das frequências de genótipos e alelos em casos e controles

Figura 1
A, Gráfico que ilustra a distribuição genotípica do polimorfismo do VDR (rs1544410) em pacientes com AR e em controles saudáveis. B, Gráfico que ilustra a distribuição alélica do polimorfismo do VDR (rs1544410) em pacientes com AR e em controles saudáveis.

Discussão

Nos últimos anos, o polimorfismo genético tem sido um dos mais discutidos tópicos nas variações genômicas. AR é uma doença inflamatória sistêmica que afeta ossos e cartilagens. A vitamina D exerce vários efeitos imunomoduladores e, portanto, pode desempenhar algum papel no curso das doenças autoimunes. 66 Kaleta B, Bogaczewicz J, Robak E, Sysa-Jędrzejowska A, Wrzosek M, Szubierajska W, et al. Vitamin D receptor gene BsmI polymorphism in Polish patients with systemic lupus erythematosus. ISRN Endocrinol. 2013. Foi determinada considerável associação entre insuficiência de vitamina D e aumento da ocorrência de transtornos autoimunes.77 Adorini L, Penna G. Control of autoimmune diseases by the vitamin D endocrine system. Nat Clin Pract Rheumatol. 2008;4:404-12. Foi observado que, em pacientes com AR, os linfócitos expressam VDR.88 Manolagas SC, Provvedini DM, Tsoukas CD. Interactions of 1,25-dihydroxyvitamin D3 and the immune system. Mol Cell Endocrinol. 1985;43:113-22. No citoplasma, a forma hidroxilada da vitamina D (1,25[OH2]D) se liga ao VDR e prossegue então em direção ao núcleo, onde irá aumentar a transcrição de genes dependentes da vitamina D, que é essencial para o metabolismo do cálcio e dos ossos,99 Khazai N, Judd SE, Tangpricha V. Calcium and vitamin D: skeletal and extraskeletal health. Curr Rheumatol Rep. 2008;10:110-7. e também inibirá a proliferação dos linfócitos T e a liberação de citocinas Th1, como IL-2, IFN-γ e TNF-α.1010 Lemire JM. Immunomodulatory role of 1,25-dihydroxyvitamin D3. J Cell Biochem. 1992;49:26-31. Diversos estudos demonstraram que o risco de doença autoimune vem aumentando devido à deficiência de vitamina D; além disso, foi observada melhoria clínica considerável em pacientes com AR tratados com vitamina D.1111 Andjelkovic Z, Vojinovic J, Pejnovic N, Popovic M, Dujic A, Mitrovic D, et al. Disease modifying and immunomodulatory effects of high dose 1 alpha (OH) D3 in rheumatoid arthritis patients. Clin Exp Rheumatol. 1999;17:453-6. Em nosso estudo, a investigação do polimorfismo rs1544410 do gene VDR não revelou diferenças estatisticamente significativas nas frequências genotípicas e alélicas de pacientes com AR e de controles saudáveis. Nossas observações estão em concordância com os achados de Maalej et al.,11 Maalej A, Petit-Teixeira E, Michou L, Rebai A, Cornelis F, Ayadi H. Association study of VDR gene with rheumatoid arthritis in the French population. Genes Immun. 2005;6:707-11. que demonstraram não haver associação do polimorfismo rs1544410 com a ocorrência de AR em populações francesas e tunisinas. No entanto, esse polimorfismo foi associado a outras doenças autoimunes, como a diabete do tipo 1 (T1D) em muitos países, inclusive em populações diferentes como as de Hungria, Japão, Grécia, Bangladesh, Taiwan e Chile.1212 Chakhtoura M, Azar ST. The role of vitamin D deficiency in the incidence, progression, and complications of type 1 diabetes mellitus. Int J Endocrinol. 2013. Article ID 148673. Também foi observada uma associação significativa entre o polimorfismo rs1544410 e osteoporose.1313 Pouresmaeili F, Jamshidi J, Azargashb E, Samangouee S. Association between vitamin D receptor gene BsmI polymorphism and bone mineral density in a population of 146 Iranian women. Cell J. 2013;15:75-82. Além disso, foram conduzidos estudos em outras doenças autoimunes, como cirrose, hepatite, doença de Crohn, doença de Graves e esclerose múltipla. Foi observada associação de lúpus eritematoso sistêmico em pacientes japoneses e chineses com o polimorfismo rs1544410. Assim, o polimorfismo pode ser investigado em associação com outras doenças imunes.1414 Vogel A, Strassburg CP, Manns MP. Genetic association of vitamin D receptor polymorphism with primary biliary cirrhosis and autoimmune hepatitis. Hepatology. 2002;35:126-31. Foi observado que polimorfismos no gene VDR estão associados a um modo dependente de gênero, i. é, com maior prevalência em mulheres afetadas com AR.1515 Garcia-Lozano JR, Gonzalez-Escribano MF, Valenzuela A, Garcia A, Nunez-Roldan A. Association of vitamin D receptor genotypes with early onset rheumatoid arthritis. Eur J Immunogenet. 2001;28:89-93. Uma associação específica para gênero com rs1544410 em nosso grupo indicou que o polimorfismo não tem efeito dependente de gênero no caso de AR; e que não há ligação entre esse polimorfismo e aumento de incidência de AR entre mulheres.

Embora nossos achados não tenham revelado evidência de associação entre rs1544410 e AR em nossa população, é possível que existam outros polimorfismos identificados como fatores de risco para AR. É importante que outras moléculas implicadas na via inflamatória de AR sejam investigadas para uma associação genética com a patogênese dessa doença. Outros polimorfismos no gene VDR podem ter associação significativa com relação a AR; portanto, há necessidade de estudos em populações maiores, para que tal associação seja definida.

Agradecimentos

Esse estudo foi financiado pela Higher Education Commission.

Referências bibliográficas

  • 1
    Maalej A, Petit-Teixeira E, Michou L, Rebai A, Cornelis F, Ayadi H. Association study of VDR gene with rheumatoid arthritis in the French population. Genes Immun. 2005;6:707-11.
  • 2
    Dai SE, Han XH, Zhao DB, Shi YQ, Liu Y, Meng JM. Prevalence of rheumatic symptoms, rheumatoid arthritis, ankylosing spondylitis, and gout in Shanghai, China: a Copcord study. J Rheumatol. 2003;30:2245-51.
  • 3
    Klareskog L, Padyukov L, Ronnelid J, Alfredsson L. Genes, environment and immunity in the development of rheumatoid arthritis. Curr Opin Immunol. 2006;18:650-5.
  • 4
    Kiran G, Debashish D. Vitamin D and rheumatoid arthritis: is there a link?. Int J Rheum Dis. 2008;11:206-11.
  • 5
    Uitterlinden AG, Fang Y, Van Meurs JB, Pols HA, Van Leeuwen JP. Vitamin D receptor gene polymorphisms in relation to Vitamin D related disease states. J Steroid Biochem Mol Biol. 2004;89-90:187-93.
  • 6
    Kaleta B, Bogaczewicz J, Robak E, Sysa-Jędrzejowska A, Wrzosek M, Szubierajska W, et al. Vitamin D receptor gene BsmI polymorphism in Polish patients with systemic lupus erythematosus. ISRN Endocrinol. 2013.
  • 7
    Adorini L, Penna G. Control of autoimmune diseases by the vitamin D endocrine system. Nat Clin Pract Rheumatol. 2008;4:404-12.
  • 8
    Manolagas SC, Provvedini DM, Tsoukas CD. Interactions of 1,25-dihydroxyvitamin D3 and the immune system. Mol Cell Endocrinol. 1985;43:113-22.
  • 9
    Khazai N, Judd SE, Tangpricha V. Calcium and vitamin D: skeletal and extraskeletal health. Curr Rheumatol Rep. 2008;10:110-7.
  • 10
    Lemire JM. Immunomodulatory role of 1,25-dihydroxyvitamin D3. J Cell Biochem. 1992;49:26-31.
  • 11
    Andjelkovic Z, Vojinovic J, Pejnovic N, Popovic M, Dujic A, Mitrovic D, et al. Disease modifying and immunomodulatory effects of high dose 1 alpha (OH) D3 in rheumatoid arthritis patients. Clin Exp Rheumatol. 1999;17:453-6.
  • 12
    Chakhtoura M, Azar ST. The role of vitamin D deficiency in the incidence, progression, and complications of type 1 diabetes mellitus. Int J Endocrinol. 2013. Article ID 148673.
  • 13
    Pouresmaeili F, Jamshidi J, Azargashb E, Samangouee S. Association between vitamin D receptor gene BsmI polymorphism and bone mineral density in a population of 146 Iranian women. Cell J. 2013;15:75-82.
  • 14
    Vogel A, Strassburg CP, Manns MP. Genetic association of vitamin D receptor polymorphism with primary biliary cirrhosis and autoimmune hepatitis. Hepatology. 2002;35:126-31.
  • 15
    Garcia-Lozano JR, Gonzalez-Escribano MF, Valenzuela A, Garcia A, Nunez-Roldan A. Association of vitamin D receptor genotypes with early onset rheumatoid arthritis. Eur J Immunogenet. 2001;28:89-93.

Datas de Publicação

  • Publicação nesta coleção
    Nov-Dec 2017

Histórico

  • Recebido
    13 Maio 2014
  • Aceito
    28 Jan 2015
Sociedade Brasileira de Reumatologia Av Brigadeiro Luiz Antonio, 2466 - Cj 93., 01402-000 São Paulo - SP, Tel./Fax: 55 11 3289 7165 - São Paulo - SP - Brazil
E-mail: sbre@terra.com.br