Open-access First occurrence of bidens mottle virus in Brazil: biological and molecular characterization of isolates infecting Zinnia sp. and Bidens pilosa

ABSTRACT

Zinnia sp. and hairy beggartick (Bidens pilosa) plants exhibiting symptoms of possible virus infection were found in the municipality of Santa Bárbara d’Oeste, São Paulo State, Brazil. Flexuous filamentous particles and cytoplasmatic inclusions typical of potyvirus infection were observed by transmission electron microscopy, respectively, in leaf extracts and cells of symptomatic leaves. Infection of both plants with bidens mottle virus (BiMoV) was confirmed by RT-PCR using potyvirus universal primers, followed by nucleotide sequencing of the amplicons. The nearly complete genome sequence of the Brazilian isolate, named BiMoV-BR, is 9700 nucleotides long and shares 95.6 % identity with the corresponding nucleotide sequence of a BiMoV isolate from the United States. BiMoV-BR was mechanically transmitted and caused systemic infection on plants of Zinnia sp., hairy beggarstick, sunflower (Helianthus annuus), and lettuce (Lactuca sativa). Myzus persicae transmitted the virus to Zinnia sp. plants with efficacy of 8 % and 42 %, using one and ten aphids per plant, respectively. This is the first detection of BiMoV in Brazil. Further studies are necessary to evaluate the distribution of this potyvirus in the country.

BiMoV; Potyvirus; high-throughput sequencing

Bidens mottle virus (BiMoV) is a member of the species Bidens mottle virus, genus Potyvirus, and the family Potyviridae. BiMoV was first identified causing mottling in plants of Bidens spp. and Lepidium spp. in the United States of America (USA) (Christie et al., 1968). In the early 1970s, this potyvirus was considered a limiting factor in the production of lettuce (Lactuca sativa L.) and endive (Cichorium endivia L.) (Purcifull and Zitter, 1973). Besides the United States, the virus has been reported only in Taiwan (Huang and Jan, 2011; Youssef et al., 2008).

Some BiMoV hosts include plants of Ammi majus L., Calendula officinalis L., Chrysanthemum coronarium L., Helianthus annuus L., Lupinus angustifolius L., Solanum viarum Dunal, Vicia faba L., and Zinnia elegans Jacq. (Baker et al., 2008, 2007, 2001; Chen and Lee, 2012; Edwardson et al., 1976; Huang and Jan, 2011; Liao et al., 2009; Logan and Zettler, 1984). BiMoV can be transmitted by the aphids Acyrthosiphon pisum Harris, Aphis craccivora Koch, A. spiraecola Patch, Lipaphis pseudobrassicae Davis, and Myzus persicae Sulzer in a non-persistent virus-vector relationship (Christie et al., 1968; Sastry et al., 2019). All these aphid species occur in Brazil (Cunha et al., 2016; Garcêz et al., 2015; Resende et al., 2006). Seeds do not transmit BiMoV (Christie et al., 1968; Sastry et al., 2019).

Zinnia sp. and hairy beggarticks (Bidens pilosa L.) are species of the family Asteraceae and their center of diversification is Mexico (Ballard, 1986; Stimart and Boyle, 2006). Zinnia plants are globally cultivated as ornamentals due to the diversity and color of their flowers (Stimart and Boyle, 2006). Hairy beggartick is a weed that colonizes different ecosystems worldwide and can negatively affect agricultural production. It is commonly found infesting crops, such as maize (Zea mays L.), sugarcane (Saccharum officinarum L.), sorghum (Sorghum bicolor (L.) Moench), rice (Oryza sativa L.), cotton (Gossypium hirsutum L.), vegetables, and pastures (Chauhan et al., 2019).

During the years 2020 and 2021, three plants of Zinnia sp. exhibiting mosaic, leaf deformation, and flower variegation (Figures 1A and 1B) and two plants of hairy beggarticks with symptoms of leaf mottle (Figures 1C and 1D) were found near a passion fruit orchard (22°51’26.7” S 47°24’34.8” W, altitude 588 m) in the municipality of Santa Bárbara d’Oeste, state of São Paulo, Brazil. Foliar samples of the symptomatic plants were collected and taken to the laboratory to identify the causal agent.

Figure 1
– Plants of Zinnia sp. (A and B) infected with bidens mottle virus (BiMoV-BR) showing symptoms of mosaic, leaf deformation, and flower variegation. Plants of hairy beggarsticks (C and D) infected with BiMoV-BR showing symptoms of leaf mottle.

Transmission electron microscopy (TEM) was used to detect viral particles in symptomatic leaf extracts of both plants, negatively stained with 1 % uranyl acetate. Ultra-thin sections of symptomatic foliar tissues were prepared following procedures described by Kitajima and Nome (1999). Leaf fragments were fixed in modified Karnovsky’s buffer (2.5 % glutaraldehyde, 2 % formaldehyde in 0.05 M cacodylate buffer, pH 7.2) for 2 h and post-fixed in 1 % osmium tetroxide solution for 1 h. The samples were dehydrated in an increasing series of acetone (30, 50, 70, 90, and 100 %). Subsequently, the samples were infiltrated and embedded in low-viscosity Spurr resin. The blocks were sectioned on a Leica UC6 ultramicrotome, and the ultra-thin sections obtained were contrasted with 3 % uranyl acetate and 0.5 % lead citrate. The analyses were performed on a JEOL JEM 1011 TEM.

Total RNA was extracted separately from the leaf tissues of Zinnia sp. and hairy beggartick symptomatic plants using the Purelink Viral DNA/RNA kit (Thermo Fisher Scientific), according to the manufacturer’s recommendations. The extracted RNA was used for virus detection by reverse-transcription polymerase chain reaction (RT-PCR) using the potyvirus universal primers WCIEN/PV1 (Maciel et al., 2011), which amplifies a fragment of 800 bp containing part of the coat protein (CP) gene and the 3’ non-translated region. An amplicon obtained from each host plant was sent to Macrogen Inc. for nucleotide sequencing. The nucleotide sequences obtained were compared to corresponding sequences deposited in the GenBank using the BLASTn algorithm, available at https://www.ncbi.nlm.nih.gov/blast.

For diagnostic purposes, a pair of primers was designed based on nucleotide sequences of BiMoV isolates deposited in GenBank using the Primer-Blast program, available at Primer designing tool – NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi). The primers BiMoV-CP F (GGAACAATGACAGTGCCACG) and BiMoV-CP R (CGGTTGGGTGTACGAGAAGT) amplify a fragment of 513 bp of the CP gene of BiMoV. The reactions were performed with 3 μL of total RNA, 12.5 μL of GoTaq Green Master Mix (Promega), 6.8 μL of nuclease-free water, 1.25 μL of each primer at a concentration of 20 μM, and 0.2 μL of the reverse transcription enzyme AMV (Promega). The amplification conditions were 42 °C for 50 min for reverse transcription, followed by 94 °C for 3 min for initial denaturation, 35 cycles of 94 °C for 30 s, 55 °C for 45 s, 72 °C for 45 s, and a final extension at 72 °C for 10 min. The RT-PCR product was subjected to agarose gel electrophoresis and the amplicons were visualized under a UV transilluminator. An amplicon obtained from each host was sent to Macrogen Inc. for nucleotide sequencing.

To obtain the complete genome sequence of the BiMoV isolate from Brazil, total RNA was extracted from an infected Zinnia sp. plant using the RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions. The extracted RNA was sent to Macrogen Inc. for high throughput sequencing (HTS). Libraries of cDNA were prepared with TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina). Transcriptome sequencing was performed on the Illumina NovaSeq 6000 platform with 101-base paired-end reads mode. The raw reads obtained were trimmed and assembled de novo using CLC Genomics Workbench v. 9.0.3 software (QIAGEN). Contigs were extended and genome coverage depth was calculated using Geneious 11.1.6 (Biomatters). The nucleotide sequence of a BiMoV isolate (EU250214) was used as a reference for mapping HTS data.

The identity of the consensus nucleotide sequence obtained was determined using BLASTn. Polyprotein cleavage sites were identified by comparison with those described for a BiMoV isolate from Taiwan (GenBank EU250214) and deduced amino acid sequences were obtained using Geneious 11.1.6. A pairwise comparison of nucleotide and amino acid sequences of BiMoV isolates was performed using Muscle 5.1 alignment within Geneious 11.1.6. The sizes of the proteins were predicted using the Protein Molecular Weight program (https://www.bioinformatics.org/sms/prot_mw.html). Phylogenetic relationships were inferred using the Maximum Likelihood method and Tamura-Nei model (Tamura and Nei, 1993), implemented in MEGA 11 (Tamura et al., 2021), with 1000 bootstraps.

The isolate of BiMoV sequenced was used for biological studies. The leaf tissues of a symptomatic Zinnia sp. plant were macerated in 0.02 M phosphate buffer, pH 7. The extract obtained was used for mechanical inoculation of the following plants: hairy beggarstick, sweet pepper (Capsicum annuum L. cv. Dahra), Chenopodium amaranticolor Coste & Reyn, endive (Cichorium endivia L.), zucchini (Cucurbita pepo L. cv. Caserta), cucumber (Cucumis sativus L.), Datura stramonium L., sunflower (Helianthus annuus L.), lettuce (Lactuca sativa L. types ‘americana’, ‘japonesa’, ‘lisa’, and ‘romana’), common bean (Phaseolus vulgaris L.), tomato (Solanum lycopersicum L. cv. Compack), and Zinnia sp. One plant of each species was mock-inoculated as a negative control.

The aphid Myzus persicae, reared on plants of D. stramonium, was used on transmission assays of BiMoV to Zinnia sp. plants. Virus-free apterous adults were removed from the colony, fasted for 30 min, and transferred to BiMoV-infected Zinnia sp. leaves for a 10-min acquisition access period (AAP). After virus acquisition, the aphids were transferred to healthy Zinnia sp. plants for a 24-h inoculation access period (IAP). Twelve Zinnia sp. plants were inoculated using one aphid and the other 12 plants were inoculated using ten aphids.

Elongated and flexuous particles were seen by transmission electron microscopy (TEM) in the extracts obtained from the Zinnia sp. (Figure 2A) and hairy beggarticks symptomatic plants. Potyvirus-like particles and potyvirus-cytoplasmic inclusion bodies were observed in epidermal and mesophyll cells of ultra-thin sections of infected tissues (Figure 2B), typical of viruses of the family Potyviridae (Inoue-Nagata et al., 2022).

Figure 2
– Transmission electron micrograph of leaf samples of Zinnia sp. infected by bidens mottle virus (BiMoV). A) Negatively stained leaf extract shows an elongated, flexuous, potyvirus-like particle. B) Thin section of a leaf palisade parenchyma cell showing type 2 cylindrical inclusions (CI), forming a pinwheel configuration. C = chloroplast; CW = cell wall; M = mitochondrion; N = nucleus; Vc = vacuole.

The infection of the three Zinnia sp. and two hairy beggartick plants with a potyvirus was confirmed by RT-PCR with the universal primers WCIEN/PV1. The nucleotide sequence of the amplicons obtained from hairy beggartick (785 bp) and Zinnia sp. plants (747 bp) showed 95.3 % and 95.7 % identity, respectively, with the corresponding nucleotide sequence of an isolate (GenBank AB601905) of BiMoV identified in infected Eustoma grandiflorum (Raf.) Shinn. plants in Taiwan (Chen et al., 2016).

All symptomatic Zinnia sp. and hairy beggartick plants tested positive for BiMoV when analyzed by RT-PCR using specific primers for this potyvirus. The nucleotide sequences of one amplicon obtained from total RNA extracted from plants of each species showed 96.3 % and 96.5 % identity, respectively, with the BiMoV isolate (GenBanK EU078960) identified in Bidens alba (L.) DC. in the United States (Youssef et al., 2008). The partial nucleotide sequences of BiMoV isolates from Zinnia sp. and infected hairy beggartick plants shared 100 % identity. The fact that the infected Zinnia sp. and hairy beggartick plants were within less than 2 m from each other suggests the potential transmission of the virus by a common aphid vector.

After the transcriptome sequencing was performed on the Illumina NovaSeq 6000 platform, a total of 47,862,488 readings were generated for the total RNA extracted from symptomatic leaves of Zinnia sp. plant. After trimming and adapter sequences removal, 45,618,008 (average length 145.9) paired readings were retained. After mapping the trimmed readings, the near complete nucleotide sequence of BiMoV was determined with a mean coverage depth of 31756.4. The near complete genome is 9700 nucleotides long and shares 95.6 % identity with the corresponding nucleotide sequence of a BiMoV isolate (GenBank ON398504) identified in infected Bidens sp. plants in the United States (unpublished). Therefore, the potyvirus infecting Zinnia sp. corresponds to an isolate of bidens mottle virus named BiMoV-BR.

The nucleotide sequence of BiMoV-BR is nearly complete, with some missing nucleotides in the 5’ and 3’ untranslated regions and excluding the poly-A tail. The genome of the BiMoV-BR isolate (GenBank OQ656764) contains an open reading frame (ORF) with 9,216 nucleotides that encodes a putative polyprotein of 3,072 amino acids with a molecular weight of 349.16 kDa. The polyprotein is potentially cleaved into ten mature proteins: P1, HC-Pro, P3, 6K1, CI, 6K2, VPg, NIa-Pro, NIb, and CP (Figure 3). Nine putative cleavage sites were identified based on alignment of the BiMoV genome sequence with genome sequences of other BiMoV isolates available in the GenBank (Figure 3). The small Pretty Interesting Potyviridae ORF (PIPO) was also found in the genome of the BiMoV-BR isolate. The PIPO is located inside the gene encoding the P3 protein and encodes a putative protein of 80 amino acids (aa) with 9 kDa (Figure 3).

Figure 3
– Organization of the BiMoV-BR genome and predicted polyprotein cleavage sites. White boxes indicate the 5’ and 3’ untranslated regions and the yellow box shows the polyprotein open reading frame (ORF). Green boxes indicate the ten putative mature proteins and their sizes and the blue box indicates the putative PIPO protein. The location of each putative cleavage site in the polyprotein amino acid sequence is indicated in red. Figure created using Geneious v. 11.1.6.

The pairwise comparison of nucleotide and amino acid sequences of the polyprotein of the BiMoV-BR isolate with corresponding sequences from other BiMoV isolates available in the GenBank is presented in Table 1. The highest percentages of nucleotide and amino acid sequences identities of the BiMoV-BR isolate were 92.6 % and 93.3 %, respectively, with the BiMoV isolate from the United States. In the phylogenetic analysis, the nucleotide sequence of BiMoV-BR was distantly related to that of other BiMoV isolates (Figure 4). The BiMoV isolates from Taiwan formed a group that can be divided into two subgroups. The first subgroup consisted of BiMoV isolates (GenBank EU250212, EU250211, and EU250210) identified in infected Bidens sp. plants. The second subgroup was composed of isolates (GenBank EU250214, EU250213, and AF538686) identified in infected lettuce and sunflower plants. The BiMoV isolate from the United States (GenBanK ON398504), identified in Bidens sp. plants was more closely related to the BiMoV isolates from Taiwan than the BiMoV-BR isolate (Figure 4).

Table 1
– Pairwise comparison of the polyprotein nucleotide (above diagonal) and deduced amino acid (below) sequences of bidens mottle virus (BiMoV) isolates.

Figure 4
– Phylogenetic tree constructed with the nucleotide sequences of the polyprotein of different isolates of bidens mottle virus (BiMoV) and other potyviruses reported in Brazil. Bootstrap values in 1000 replicates are printed in the nodes. Potyviruses used: passiflora virus Y (PaVY); cowpea aphid-borne mosaic virus (CABMV); catharanthus mosaic virus (CatMV); johnsongrass mosaic virus (JGMV); papaya ringspot virus – type W (PRSV-W); apium virus Y (ApVY); lettuce mosaic virus (LMV); arracacha mottle virus (AMoV); pepper yellow mosaic virus (PepYMV); bidens mosaic virus (BiMV); potato virus Y (PVY). Country abbreviations: Brazil (BR); United States of America (USA); Taiwan (TW). The corresponding GenBank accession number of each virus sequence is given in the figure. Bar = number of substitutions per site. BiMoV BR is highlighted in red in the tree.

The partial host range of BiMoV-BR was evaluated by monitoring symptoms after sap inoculation to plants of different species, RT-PCR with specific primers, and nucleotide sequencing of the amplicons. BiMoV-BR isolate was transmitted and infected systemically only plants of the family Asteraceae (Table 2). Infected plants of Zinnia sp., hairy beggarticks, and sunflower showed symptoms of vein clearing and leaf mottle after 10-16 days post-inoculation (DPI), similar to descriptions by Baker et al. (2007). Lettuce plants type ‘Romana’ showed leaf mottling 12 DPI, and endive-infected plants remained asymptomatic. C. amaranticolor plants reacted with chlorotic local lesions on the inoculated leaves eight DPI. The remaining mechanically inoculated plants tested negative in RT-PCR assays with the specific primer for BiMoV. Nucleotide sequences obtained from amplicons of experimentally infected Zinnia sp., hairy beggarticks, sunflower, lettuce type ‘Romana’, and endive plants shared 100 % identity with the nucleotide sequence of the BiMoV-BR isolate.

Table 2
– Reaction of plants of different species mechanically inoculated with bidens mottle virus (BiMoV-BR)

Myzus persicae transmitted BiMoV-BR to Zinnia sp. plants. Transmission efficacies were 8 % (1/12) and 42 % (5/12) using, respectively, one and ten aphids to inoculate each plant.

In Brazil, Zinnia elegans has already been identified as naturally infected with the potyviruses bidens mosaic virus (BiMV) and sunflower chlorotic mottle virus (SuCMoV), the tobamovirus tobacco mosaic virus (TMV), and the orthotospovirus groundnut ringspot virus (GRSV) (Oliveira et al., 2022; Kitajima, 2020). Hairy beggartick plants have been reported in the country infected with the nucleorhabdovirus sowthistle yellow vein virus (SYVV), the polerovirus potato leafroll virus (PLRV), and the potyviruses BiMV and potato virus Y (PVY) (Kitajima, 2020).

Here, we presented the first near-complete genome sequence of a Brazilian isolate of BiMoV. This is also the first detection of BiMoV in Brazil. Studies are needed to verify the occurrence of BiMoV in other crops, such as endive, lettuce, and sunflower, to better evaluate the distribution and importance of this potyvirus in the country.

References

  • Baker CA, Raid RN, Scully BT. 2001. Natural infection of Vicia faba by Bidens mottle virus in Florida. Plant Disease 85: 1290. https://doi.org/10.1094/PDIS.2001.85.12.1290C
    » https://doi.org/10.1094/PDIS.2001.85.12.1290C
  • Baker CA, Kamenova I, Raid R, Adkins S. 2007. Bidens mottle virus identified in tropical soda apple in Florida. Plant Disease 91: 905. https://doi.org/10.1094/PDIS-91-7-0905A
    » https://doi.org/10.1094/PDIS-91-7-0905A
  • Baker CA, Rosskopf EN, Irey MS, Jones L, Adkins S. 2008. Bidens mottle virus and Apium virus Y identified in Ammi majus in Florida. Plant Disease 92: 975. https://doi.org/10.1094/PDIS-92-6-0975A
    » https://doi.org/10.1094/PDIS-92-6-0975A
  • Ballard R. 1986. Bidens pilosa complex (Asteraceae) in North and Central America. American Journal of Botany 73: 1452-1465. https://doi.org/10.1002/j.1537-2197.1986.tb10891.x
    » https://doi.org/10.1002/j.1537-2197.1986.tb10891.x
  • Chauhan BS, Ali HH, Florentine S. 2019. Seed germination ecology of Bidens pilosa and its implications for weed management. Scientific Reports 9: 16004. https://doi.org/10.1038/s41598-019-52620-9
    » https://doi.org/10.1038/s41598-019-52620-9
  • Chen YK, Lee JY. 2012. First report of Bidens mottle virus causing mosaic and leaf deformation in garland chrysanthemum and lettuce in Taiwan. Plant Disease 96: 64. https://doi.org/10.1094/PDIS-08-11-0709
    » https://doi.org/10.1094/PDIS-08-11-0709
  • Chen YK, Lee JY, Chang YS, Wu MY. 2016. First report of Bidens mottle virus causing chlorotic hollow spots on Lisianthus in Taiwan. Plant Disease 100: 1250. https://doi.org/10.1094/PDIS-12-15-1419-PDN
    » https://doi.org/10.1094/PDIS-12-15-1419-PDN
  • Christie SR, Edwardson JR, Zettler FW. 1968. Characterization and electron microscopy of a virus isolated from Bidens and Lepidium. Plant Disease Reporter 52: 763-768.
  • Cunha SBZ, Silva CRS, Diniz FHG, Berti Filho E. 2016. Predators of the Alfalfa Aphids Acyrthosiphon pisum (Harris), Aphis craccivora Koch, and Therioaphis trifolii (Monell) (Hemiptera: Aphidoidea) as Determined by the Serological Technique. EntomoBrasilis 9: 120-123. https://doi.org/10.12741/ebrasilis.v9i2.595
    » https://doi.org/10.12741/ebrasilis.v9i2.595
  • Edwardson JR, Purcifull DE, Christie RG, Christie SR. 1976. Blue lupine, a natural host for bidens mottle virus. Plant Disease Reporter 60: 776.
  • Garcêz RM, Chaves ALR, Eiras M, Meletti LMM, Azevedo Filho JA, Silva LA, et al. 2015. Survey of aphid population in a yellow passion fruit crop and its relationship on the spread Cowpea aphid-borne mosaic virus in a subtropical region of Brazil. SpringerPlus 4: 1-12. https://doi.org/10.1186/s40064-015-1263-5
    » https://doi.org/10.1186/s40064-015-1263-5
  • Huang CH, Jan, FJ. 2011. First report of Bidens mottle virus infecting Calendula in Taiwan. Plant Disease 95: 362. https://doi.org/10.1094/PDIS-10-10-0753
    » https://doi.org/10.1094/PDIS-10-10-0753
  • Inoue-Nagata AK, Jordan R, Kreuze J, Li F, López-Moya JJ, Mäkinen K, et al. 2022. ICTV report consortium. ICTV Virus Taxonomy Profile: Potyviridae 2022. The Journal of General Virology 103: 001738. https://doi.org/10.1099/jgv.0.001738
    » https://doi.org/10.1099/jgv.0.001738
  • Kitajima EW, Nome CF. 1999. Electron microscopy in plant virology. p. 59-87. In: Campo D, Lenardon S. eds. Methods for detection of systemic pathogens. IFFYVE/INTA, Córdoba, Argentina.
  • Kitajima EW. 2020. An annotated list of plant viruses and viroids described in Brazil (1926-2018). Biota Neotropical 20. https://doi.org/10.1590/1676-0611-BN-2019-0932
    » https://doi.org/10.1590/1676-0611-BN-2019-0932
  • Liao JY, Hu CC, Chen CC, Chang CH, Deng TC. 2009. Full-length sequence analysis of a distinct isolate of Bidens mottle virus infecting sunflower in Taiwan. Archives of Virology 154: 723-725. https://doi.org/10.1007/s00705-009-0356-2
    » https://doi.org/10.1007/s00705-009-0356-2
  • Logan AE, Zettler FW. 1984. Susceptibility of Rudbeckia, Zinnia, Ageratum, and other bedding plants to Bidens mottle virus. Plant Disease 68: 260-262. https://doi.org/10.1094/PD-68-260
    » https://doi.org/10.1094/PD-68-260
  • Maciel SC, Silva RF, Reis MS, Jadão AS, Rosa DD, Giampan JS, et al. 2011. Characterization of a new potyvirus causing mosaic and flower variegation in Catharanthus roseus in Brazil. Scientia Agricola 68: 687-690. https://doi.org/10.1590/S0103-90162011000600013
    » https://doi.org/10.1590/S0103-90162011000600013
  • Oliveira FF, Favara GM, Ferro CG, Kraide HD, Carmo EYN, Kitajima EW, et al. 2022. First report of groundnut ringspot virus infecting Zinnia sp. in Brazil. Plant Disease 106. https://doi.org/10.1094/PDIS-05-21-1028-PDN
    » https://doi.org/10.1094/PDIS-05-21-1028-PDN
  • Purcifull DE, Zitter TA. 1973. A serological test for distinguishing bidens mottle and lettuce mosaic viruses. Proceedings of the Florida State Horticultural Society 86: 143-145.
  • Resende ALS, Silva EE, Silva VB, Ribeiro RLD, Guerra JGM, Aguiar-Menezes, EL. 2006. First record of Lipaphis pseudobrassicae Davis (Hemiptera: Aphididae) and its association with predator insects, parasitoids and ants in kale (Cruciferae) in Brazil. Neotropical Entomology 35: 551-555. https://doi.org/10.1590/S1519-566X2006000400019
    » https://doi.org/10.1590/S1519-566X2006000400019
  • Sastry KS, Mandal B, Hammond J, Scott SW, Briddon RW. 2019. Encyclopedia of Plant Viruses and Viroids. Springer, New Delhi, India.
  • Stimart D, Boyle T. 2006. Zinnia. p. 337-357. In: Anderson NO. ed. Flower breeding and genetics: issues, challenges and opportunities for the 21st Century. Springer, Dordrecht, Netherlands. https://doi.org/10.1007/978-1-4020-4428-1_12
    » https://doi.org/10.1007/978-1-4020-4428-1_12
  • Tamura K, Nei M. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10: 512-526. https://doi.org/10.1093/oxfordjournals.molbev.a040023
    » https://doi.org/10.1093/oxfordjournals.molbev.a040023
  • Tamura K, Stecher G, Kumar S. 2021. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular Biology and Evolution 38: 3022-3027. https://doi.org/10.1093/molbev/msab120
    » https://doi.org/10.1093/molbev/msab120
  • Youssef F, Marais A, Candresse T. 2008. Partial genome sequence of Bidens mottle virus sheds light on its taxonomy. Archives of Virology 153: 227-228 https://doi.org/10.1007/s00705-007-1087-y
    » https://doi.org/10.1007/s00705-007-1087-y

Edited by

  • Edited by: Alice Kazuko Inoue-Nagata

Publication Dates

  • Publication in this collection
    11 Dec 2023
  • Date of issue
    2024

History

  • Received
    11 Apr 2023
  • Accepted
    04 July 2023
location_on
Escola Superior de Agricultura "Luiz de Queiroz" USP/ESALQ - Scientia Agricola, Av. Pádua Dias, 11, 13418-900 Piracicaba SP Brazil, Phone: +55 19 3429-4401 / 3429-4486 - Piracicaba - SP - Brazil
E-mail: scientia@usp.br
rss_feed Acompanhe os números deste periódico no seu leitor de RSS
Ir para o topo Reportar erro