Colletotrichum spp. and other fungi associated with anthracnose on Coffea arabica L. in Mérida State, VenezuelaABSTRACT
In tropical and subtropical regions worldwide, diseases can be major limiting factors to coffee (Coffea arabica) production, a highly valued crop internationally. Our aim was to identify Colletotrichum spp. and other fungal species associated with Coffee Berry Disease (CBD) and anthracnose on coffee twigs, which can greatly inhibit crop production. Concatenated phylogenetic analyses of ApMat and GS loci were used to identify two Colletotrichum species. Colletotrichum siamense was isolated from symptomatic mature and green berries that were both infested and uninfected with Coffee Berry Borer (CBB) and from twigs displaying anthracnose symptoms. Colletrotrichum alienum was isolated from twigs showing anthracnose symptoms. Along with these two Colletotrichum species, association of Fusarium incarnatum (= Fusarium semitectum) and Fusarium solani was found. Identification of Fusarium species was obtained through combined datasets of partial TEF1 and RPB2. Fusarium isolates came from ripe coffee fruits displaying symptoms of CBD, infested or not with CBB, and coffee twigs. In addition, concatenation of four gene regions (ITS, TEF1, CAL, TUB2) allowed the identification of another fungus, together with isolates from coffee twigs with anthracnose, Diaporthe pseudomangiferae. This is the first report of Colletotrichum siamense and Colletotrichum alienum, along with the fungi Fusarium solani and Diaporthe pseudomangiferae, associated with berry diseases on Coffea arabica in the state of Mérida, Venezuela.
Keywords
Coffee Berry Disease;
Diaporthe pseudomangiferae
;
Fusarium incarnatum
;
Fusarium solani
RESUMEN
En las regiones tropicales y subtropicales de todo el mundo, las enfermedades pueden ser factores limitantes importantes para la producción de café (Coffea arabica), un cultivo muy valorado a nivel internacional. Nuestro objetivo era identificar Colletotrichum spp., y otras especies de hongos asociadas con la enfermedad de las Bayas o Cerezas del café (CBD) y de la antracnosis en las ramitas de café, que pueden inhibir en gran medida la producción de cultivos. Se utilizaron análisis filogenéticos, concatenando los locus ApMat y GS para identificar dos especies de Colletotrichum. Se aisló Colletotrichum siamense desde bayas verdes y maduras sintomáticas que estaban infestadas y no por Broca del fruto del cafeto (CBB) y desde ramitas que presentaban síntomas de antracnosis. Colletrotrichum alienum se aisló de ramitas que mostraban síntomas de antracnosis. Junto con estas dos especies de Colletotrichum, se encontraron asociados Fusarium incarnatum (= Fusarium semitectum) y Fusarium solani. La identificación de la especie Fusarium se realizaron utilizando conjuntos de datos combinados del parcial TEF1 y RPB2. Los aislamientos de Fusarium provinieron de frutos de café maduros que mostraban síntomas de CBD, infestados o no con CBB y ramitas de café. Asimismo, mediante la concatenación de cuatro regiones genéticas (ITS, TEF1, CAL, TUB2) se identificó otro hongo junto con aislamientos de ramitas de café con antracnosis, Diaporthe pseudomangiferae. Este es el primer reporte de Colletotrichum siamense y Colletotrichum alienum, junto con los hongos Fusarium solani y Diaporthe pseudomangiferae, asociados con enfermedades de las bayas en Coffea arabica en el estado de Mérida, Venezuela.
Palabras Claves
Enfermedad de las Bayas o Cerezas del Café;
Diaporthe pseudomangiferae
;
Fusarium incarnatum
;
Fusarium solani
RESUMO
Nas regiões tropicais e subtropicais do mundo todo, as enfermidades podem ser fatores limitantes importantes para a produção do café (Coffea arabica), que possui grande valor no mercado internacional. O objetivo do presente trabalho foi identificar as espécies de Colletotrichum spp. e de outros fungos associados a queda dos dos frutos do café (QFC) e a antracnose dos ramos que podem reduzir a produtividade. Foram utilizados análises filogenéticas, de locos ApMat e GS. Foi identificado Colletotrichum siamense nos frutos verdes e maduros sintomáticos infestados ou não pela broca do café (BFC) como também nos ramos com sintomas de antracnose onde se isolou Colletotrichum alienum. Associados a outras espécies de Colletotrichum, foi isolado do fungo Fusarium incarnatum (= Fusarium semitectum e Fusarium solani), identificados com a combinação TEF e RPB2. Mediante a amplificação de regiões genéticas (ITS, TEF1, CAL, TUB2), foi possível identificar outro fungo nos ramos com antracnose: Diaporthe pseudomangiferae. Este é o primeiro relato da ocorrência de Colletotrichum siamense e Colletotrichum alienum, junto com os fungos Fusarium solani e Diaporthe pseudomangiferae, associados com os frutos de Coffea arabica no estado de Mérida, Venezuela.
Palavras Chaves
Quadra dos frutos de café;
Diaporthe pseudomangiferae
;
Fusarium incarnatum
;
Fusarium solani
Coffea arabica L. is considered one of the most important crops worldwide, contributing significantly to the economy of different countries. The largest global producers of green Coffea arabica include Brazil, Colombia, Ethiopia and Honduras; meanwhile, in Venezuela, Coffea arabica production has faced a steady decline since 2007 (18). Biotic agents, particularly fungal agents, are known as major limiting factors to coffee production. Increased fungal pressure can greatly impact food security in certain countries, especially those where coffee is a major income source for small-scale growers concerning purchase of food and supplies for grain cultivation (1).
Pathogens of the genus Colletotrichum are responsible for anthracnose diseases on several economically important crops, and Colletotrichum gloeosporioides Penz. is the predominant pathogen in tropical and subtropical regions (5, 8, 35, 42, 53). Colletotrichum species have been reported on coffee as endophytes, epiphytes or pathogens (42) capable of causing leaf necrosis, coffee berry diseases and dieback (35).
Colletotrichum kahawae subsp. kahawae has been reported in multiple African countries, including Kenya, Angola, Cameroon and Malawi (54), causing Coffee Berry Disease (CBD), damaging green berries and inducing premature fruit drop and/or fruit mummification (37). This disease reduces yields by as much as 70-80% (14).
Even though C. kahawae is most virulent, sixteen Colletotrichum species have been identified on Coffea arabica, and six of them are presently reported in Vietnam and Mexico (5, 35). There are reports of Colletotrichum asianum Prihastuti, L. Cai & K.D. Hyde, C. fructicola Prihastuti, L. Cai & K.D. Hyde, C. siamense Prihastuti, L. Cai & K.D. Hyde, and C. cordylinicola Phoulivong, L. Cai & K.D. Hyde causing diseases on green and red berries in Laos and Thailand (41, 42); Colletotrichum acutatum Simmonds also causes minor disease on ripening berries (31). In Mexico, at least six Colletotrichum species were identified causing anthracnose on fruits and leaves of C. arabica, including C. gloeosporioides, C. siamense, C. gigasporum E.F. Rakotoniriana & F. Munauton, C. theobromicola Delacr., C. karstii Y.L. Yang, Zuo Y. Liu, K.D. Hyde & L. Cai and one Colletotricum sp. (5). In Costa Rica, Colletotrichum costaricense Damm, P.F. Cannon & Crous was isolated as pathogenic/endophytic on berries of C. arabica (6, 19). In Brazil, Colletotrichum boninense Moriwaki, Toy, Sato & Tsukib., and C. gloeosporioides have been reported on C. arabica and Coffea canephora L. trees, producing dieback and necrosis on leaves and berries (9). Furthermore, Colletotrichum coffeanum Noak & Pflanzenk. and C. gloeosporioides have also been reported as endophytic on healthy leaves of C. arabica in Brazil (36). In Colombia, Colletotrichum gigasporum was reported as an endophytic fungus on C. arabica (43).
For Venezuelan coffee production, there is little information about the involved diseases. In 1984 and 1985, C. arabica fields were surveyed in Lara and Portuguesa States, Venezuela, to determine the causal agent of leaf and branch anthracnose, fruit diseases and tree dieback. Colletotrichum gloeosporioides was identified, at altitudes between 700 and 1300 m, as the causal agent of anthracnose (29, 30). Colletotrichum capsici (Syd.) E. J. Butler & Bisby and a species similar to C. gossypii Southworth were reported as the causal agents of basal rot on coffee plants in Trujillo State (51). The aim of the present study was to characterize Colletotrichum species and fungal species associated with anthracnose and CBD in Venezuela using both morphological and genetic species identifications.
Coffee plant with anthracnose symptom. (A) Dead coffee plant due to anthracnose; (B) Berries with anthracnose symptoms or coffee berry disease (CBD); (C, D) CBD on ripe berries; (E) CBD on unripe or green berries; (F) Coffee berry borer (CBB); (G, H) Black acervuli on coffee twig with anthracnose.
MATERIALS AND METHODS
Isolation of fungal species from infected coffee berries and twigs
Samples were collected in two parishes from Antonio Pinto Salina Municipality (8°24′33.12″ N, 71°39′5.4″ W), Mesa de Las Palmas parish and Agropecuaria Las Canales farm, Santa Cruz de Mora parish, both belonging to Mérida State, Venezuela. Fungi were isolated from green and mature fruits symptomatic of CBD, infested or not with CBB, and from twigs with anthracnose (Figure 1). Samples were transferred to the Phytopathology Laboratory of the School of Forestry Engineering, University of Los Andes (ULA), Mérida State, Venezuela. Fungi were isolated from anthracnose lesions on infected berries and twigs by excising 5×5mm margins of infected tissue. The tissues were then dipped in 1% sodium hypochlorite for 1 minute, immersed in 70% ethanol for 1 minute, rinsed three times with sterile water and finally dried in sterile tissue paper. Samples were placed on water-agar and incubated at room temperature, 25-28°C. The growing edges of any fungal hyphae, developing from the tissues, were then transferred aseptically to potato dextrose agar (PDA; 20 g potato dextrose agar in 1L distilled water; Difco Laboratories, Detroit, MI). Fungi were identified following sporulation. Single spore subcultures were obtained according to the procedure described by Choi et al. (4). After overnight room temperature incubation, single germinated spores were picked up with a sterile needle, transferred to PDA and incubated at 25°C for 7 days or until mycelia were observed growing from the samples. Fungal mycelium was sub-cultured onto PDA and hyphal tipping methods were performed to obtain pure cultures.
Morphological analyses
Mycelial plugs (5-mm diameter) were taken from the periphery of actively growing cultures and transferred to 9-cm Petri dishes containing PDA and malt extract agar (MEA, Difco Laboratories, Detroit, MI, USA). Following incubation at room temperature (25°C) for 7 days, colony characteristics and pigment production were noted; colony diameters were measured after 7-to-10-day growth. Colony coloration was rated according to Rayner (45). Cultures were examined periodically for ascoma development. Conidia produced on PDA and MEA were mounted in lactophenol to obtain dimensions and perform morphological analyses. If a fungus was not sporulating on PDA and MEA, morphological characteristics were described from synthetic nutrient-poor agar (SNA). Hyphal appressoria were observed on colonies grown on PDA. At least 50 measurements per structure were taken at x1000 magnification under a compound light microscope (Nikon Eclipse Ci).
DNA extraction, amplification and sequencing
DNA was extracted from 7-day-old axenic cultures, grown on half-strength potato dextrose agar medium (1/2 PDA: 10 g potato dextrose agar in 1L distilled water; Difco Laboratories, Detroit, MI) added of 0.1 g streptomycin sulphate (Sigma-Aldrich, USA). Cultures were grown on sterile MF-Millipore membrane filters (Millipore Sigma, Burlington, MA) and incubated at 25°C. DNA was extracted, using the ZR Fungal/Bacterial DNA MiniPrep (Zymo Research, Irvine, CA), following the manufacturer’s protocol. Polymerase chain reactions (PCR) were performed with a reaction mixture that consisted of 30 ng fungal genomic DNA, 2.5 μl of 10x Standard Tag Reaction Buffer (New England BioLabs (NEB), Ipswich, MA), 0.5 μl of 10 mM dNTP (Roche Applied Science, Penzberg, Germany), 1 μl of each of 10 μM primer, 0.125 μl Taq DNA polymerase (NEB), and sterile deionized water for a total volume of 25 μl. For certain fungal genera, 1.5 μl MgCl2 had to be included in the PCR reaction mixture for amplification (Roche Diagnostics, Mannheim, Germany). PCR products were cleaned with ExoSAP-IT PCR Product Cleanup (Thermo Fisher Scientific, Grand Island, NY) and sequenced at Eurofins Scientific (www.eurofinsus.com).
Several genes were amplified and sequenced for phylogenetic species recognition considering the isolates within each genus, including 5.8S rDNA and two flanking internal transcribed spacers (ITS), partial sequence of the translation elongation factor 1-α (TEF1), glutamine synthetase (GS), Apn2-Mat1-2 intergenic spacer and partial mating type (Mat1-2) gene (ApMat), calmodulin (CAL), β-tubulin (TUB2), and RNA polymerase II second largest subunit (RPB2). Primer pairs were used for the following genera: Colletotrichum sp.: GS: GSLF2 (TACACGAGSAAAAGG ATACGC) and GSLR1 (AGRCGCACATTGTCAGTATCG) (25); ApMAT: AMF1 (TCATTCTACGTATGTGCCCG) and AMR1 (CCAGAAATACACCGAACTTGC) (50); Fusarium sp.: TEF1: EF1 (ATGGGTAAGGA(A/G)GACAAGAC) and EF2 (GGA(G/A)GTA CCAGT(G/C)ATCATGTT) (38); RPB2: fRPB2-5f2 (GGGGWGAYCAGAAGAAGGC) and fRPB2-7cr (CCCATRGCTTGYTTRCCCAT) (27); Diaporthe sp.: ITS: ITS1F (CTTGGTCATTTAGAGGAAGTAA) (11) and ITS4 (TCCTCCGCTTATTGATATGC) (55); TEF1: EF1-728F (CATCGAGAAGTTCGAGAAGG) and EF1-986R (TACTTGAAGGAACCCTTACC) (2); CAL: CAL-228F (GAGTTCAAGGAGGCCTTCTCCC) and CAL-737R (CATCTTTCTGGCCATCATGG) (2); TUB2: Bt2a (GGTAACCAAATCGGTGCTGCTTTC) and Bt2b (ACCCTCAGTGTAGTGACCCTTGGC) (12), respectively.
PCR thermal cycle programs were performed as described by each previous author. The optimum annealing temperatures were: ApMat, GS, ITS, TEF1 (EF1-728F+ EF1-986R): 55°C; TUB2: 55 or 60°C; TEF1 (EF1+EF2) and CAL: 61°C; RPB2: 62°C. Some isolates required a change in the annealing temperatures due to either excessive or no bands amplified at the original annealing temperature.
Phylogenetic analyses
Phylogenetic analyses compared the sequenced isolates from the current study with holotypes and ex-types of closely related taxa. Preliminary sequence alignments for each locus and genus were completed using either ClustalX v. 2.1 (22) or BioEdit version 7.2.5 (15). Sequence data for closely related species considering genus were obtained from GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Manual adjustments and concatenation of loci were conducted using MAFFT for final alignments (20, 21) within Geneious Pro v. 9.0.5.
Maximum likelihood (ML) and Bayesian inference (BI) algorithms were used to reconstruct phylogenies for alignments using PhyML and MrBayes v. 3.2.1 (46) in Geneious v6.1.3 (Biomatters Inc.). A best-fit substitution model for each dataset was selected using the Bayesian Information Criterion (BIC) implemented in DT ModSel (33). Models HKY+G, SYM+I+G and TrN+I+G were chosen for the combined loci for Colletotrichum, Fusarium and Diaporthe, respectively. For ML analyses within PhyML, phylogenies were run with 1000 bootstraps. Bayesian Markov Chain Monte Carlo analyses were carried out using MrBayes (17). Six chains were run for 2000000 generations and trees were sampled every 100 generations. The first 25000 trees were discarded as burn-in, the remaining trees were used to estimate posterior probabilities (PP) for the majority rule consensus tree. Phylogenies were estimated for each locus separately and multiple loci together for each genus.
Phylogenies for multiple loci datasets were estimated using Bayesian analyses, implemented in Bayesian Evolutionary Analysis Sampling Trees (BEAST v1.7.5) (7). BEAST does not use concatenation, but rather co-estimates the individual gene trees embedded inside the summary species tree. Bayesian Evolutionary Analysis Utility (BEAUti), version 1.7.5, was used to create XML-formatted input files for BEAST v1.7.5. In BEAST, a Markov Chain Monte Carlo algorithm was used to sample the posterior distribution of trees by conducting five independent runs of 100 million generations each using a constant size tree prior, strict molecular clock, and uniform priors. Trees were sampled every 1000 generations and the first 20% were discarded as burn-in. Post burn-in trees were combined with the program Log Combiner (BEAST v1.7.5), and chains were assumed to converge when the average standard deviation of split frequencies was < 0.01. The maximum clade credibility tree with posterior probability of each node was computed with the program Tree Annotator (BEAST v 1.7.5). Log files and tree files were visualized in Tracer v1.5 (http://tree.bio.ed.ac.uk/software/tracer/) and FigTree v1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/), respectively.
Results and Discussion
Isolates were divided into five groups according to mycelium growth, color on culture media, and conidial shape and size after 8 days. Two groups of Colletotrichum and Fusarium and one Diaporthe were separated.
Colletotrichum Corda
Sixteen isolates of Colletotrichum spp. (CSM 143-1, CSM 143-2, CSM 144, CSM 148, CSM 149, CSM 150, CSM 151, CSM 152, CSM 153, CSM 154, CSM 155, CSM 158, CSM 159, CSM 163, CSM 166, CSM 167) presented colonies white to pale brown, reverse pale yellow, aerial mycelium greyish white, dense, cottony; conidia one-celled, smooth-walled, guttulate, hyaline, fusiform with obtuse to slightly rounded ends, sometimes oblong, 8-18.5 x 4-8.5 μm (mean = 12.7 x 5.5 μm, n = 50). Other five isolates (CSM 145, CSM 146, CSM 147, CSM 156, CSM 157) had colonies cottony, grey aerial mycelium and orange conidial ooze, reverse dark grey to pale orange in center; conidia were one-celled, cylindric with broadly rounded ends, 13-21 x 3-6 μm (mean = 15.5 x 5.0 μm, n = 50) (54) (Table 1).
GenBank and culture collection accession numbers of Colletotrichum spp. included in the current study.
Bayesian and maximum likelihood phylogenetic trees were generated for a concatenated dataset of ApMat and GS loci with 1838 base pairs. The phylogenies included 21 isolates of Colletotrichum species from the present study and 26 additional closely-related taxa and were rooted with C. xanthorrhoeae CBS 127831 (Table 1). Sixteen C. siamense isolates and five Colletotrichum alienum B. Weir & P.R. Johnst. isolates formed two separate and well-supported clades with values of BS/PP = 78/0.98 for Colletotrichum siamense and BS/PP = 94/0.97 for C. alienum (Figure 2).
Phylogenies generated from Bayesian analysis based on combined ApMat and GS sequences of Colletotrichum species. The phylogenies were rooted with C. xanthorrhoeae CBS 127831. Bootstrap test ≥ 50%: 1000 replicates and Bayesian posterior probabilities ≥ 0.50 (BS/PP) are highlighted by arrows. The isolates included in the current is study are in oblique and coffee isolates are in bold and oblique. The phylogeny includes annotation of species boundaries for taxa that belong to the C. gloeosporioides complex. Bootstrap (BS) values below 50% are marked with a hyphen (-) on the phylogenetic trees.
Coffee production has often been limited by CBD, which is caused by Colletotrichum kahawae in Kenya and other countries of Eastern Africa. At high altitudes, CBD is particularly devastating, damaging green berries and inducing premature fruit drop and fruit mummification, leading to production losses of 50 to 80% (16, 34). Interestingly, Colletotrichum siamense was isolated from symptomatic CBD in green and mature fruits, infested or not with CBB, and from twigs with anthracnose symptoms, whereas C. alienum was only isolated from twigs with anthracnose. Colletotrichum siamense was first identified and reported in isolates from lesions in healthy berry tissues, as well as from the surface of coffee berries in northern Thailand (42). In three municipalities in Puebla State, Mexico, C. siamense was isolated from leaves showing typical and atypical Cercospora lesions, as well as from symptomatic unripe fruits of coffee trees (5). In Chiapas, Mexico, 21 fungal genera were isolated from coffee berries infested with CBB by Hypothenemus hampei; however, Colletotrichum was not present in these isolates (40). In the current study, C. siamense was found associated with CBB in coffee grown in Venezuela.
Colletotrichum alienum was isolated and identified for the first time on ripe fruit rot from Persea americana in Australia (54), later in Israel (47), on Malus domestica fruit rot in New Zealand (54), associated with anthracnose diseases on Proteaceae in Australia, South Africa and Europe (24), and on Nerium oleander in Australia (48). This is the first report of such a species affecting coffee in Venezuela; however, as this species was recently named and separated from the C. gloeosporioides complex, it will likely be found in numerous regions where species within the C. gloeosporioides complex have been found (54). Recently, 80 Colletotrichum isolates from an Australian culture collection were analyzed on a molecular phylogenetic level, and C. alienum was distinguished from other species within the C. gloeosporioides species complex using GS sequences (49, 54).
Sequence data of the concatenated ApMat and GS loci have served as a barcode for species identification of isolates belonging to the C. gloeosporioides species complex. Recently, Lui et al. (26) used these loci to re-construct a phylogenetic tree of Colletotrichum species from Camellia spp., highlighting that the topology of ApMat-GS phylogram was similar to that of a phylogram encompassing sequence data from 8 loci (25). Mating-related genes have been suggested to evolve at a faster rate and have a higher sequence variability, which dominates the topology of the multi-locus phylogram (25), allowing ApMat-GS to be informative for species identification.
Fusarium Link ex Grey
Four isolates of Fusarium spp. (CSM 134, CMS 135, CMS 137, CMS 138) had cultures showing dense aerial mycelia, initially white to beige or brown with age; Chlamydospores present; Macroconidia 3 to 5 septate, apical cell curved and tapering to a point, basal cell foot-shaped, 20-41.5 x 2.0-4.5 μm (mean = 19.3 x 3.1 μm, n = 50). Other cultures of five isolates (CSM 136, CMS 139, CSM 140, CSM 141, CSM 142) usually are white to cream with sparse mycelium; Chlamydospores abundant; Macroconidia 5 to 7 septate, wide and straight, apical cell blunt and rounded, basal cell straight to almost cylindrical, 13.5-44 x 3.0-6 μm (mean = 20.5 x 3.6 μm, n = 50); Microconidia oval to ellipsoid, 0 or 1 septum (23, 28) (Table 2).
_GenBank and culture collection accession numbers of Fusarium spp. included in the current study.
The combined datasets of the partial TEF1 and RPB2 was comprised of 1659 base pairs from 27 taxa collected from this study and 43 reference species (Table 2). Fusarium lyarnte RBG5331 served as the outgroup. Four F. incarnatum (Roberge) Sacc (= Fusarium semitectum Berk. & Ravenel) isolates clustered together with reference species, forming a Fusarium incarnatum-equiseti species complex (FIESC). Five Fusarium solani (Mart.) Sacc)/ sexual morph Neocosmospora solani (Mart.) L. Lombard & Crous isolates clustered together. The BS and PP values for each F. incarnatum and F. solani well-support clades were BS/PP = 100/1 (Figure 3).
Phylogenies generated from Bayesian analysis based on combined EF1 and RPB2 sequences of Fusarium species. The phylogenies were rooted with Fusarium lyarnte (RBG 5331). Bootstrap test ≥ 50%:1000 replicates and Bayesian posterior probabilities ≥ 0.70 (BS/PP) are highlighted by arrows. The new coffee isolates included in the current study are in oblique and bold.
Fusarium species have long been known as latent pathogens of different tree species, existing as endophytes before causing disease (3). Numerous Fusarium species have previously been reported on coffee, as an endophyte or as a pathogen. The present study found Fusarium incarnatum and F. solani associated with anthracnose and as endophytes. In Colombia, Hawaii, Mexico and Puerto Rico, Fusarium sp. was the second most common endophyte out of 843 isolated fungi, while Colletotrichum sp. was the most commonly isolated species (52). A survey conducted from 1979 to 1981 in Puerto Rico, to evaluate anthracnose incidence and severity, found that Fusarium stilboides (Wollenw.), F. oxysporum (Schltdl.) and F. semitectum were associated with anthracnose symptoms (32), indicating that multiple Fusarium are capable of causing anthracnose on coffee. In Minas Gerais, Brazil, Fusarium equiseti (Corda) Sacc. and F. semitectum were found to be associated with the mycobiota, both internally and externally, on four coffee bean cultivars (C. arabica) without observable symptoms (39) and, similar to our study, Fusarium incarnatum was reported on coffee beans in Campo Elias Municipality, Trujillo State, Venezuela (51).
Fusarium solani and Fusarium sp. have been reported as part of the mycobiota associated with the cuticle, gut, feces and galleries of CBB, Hypothenemus hampei, in coffee plantations in Chiapas, Mexico (40). Interestingly, in the current study, Fusarium incarnatum and F. solani were isolated from ripe coffee fruits, with or without CBD infestations in Mérida, Venezuela, indicating that there may not be a close association of these Fusarium species with CBB.
Diaporthe Nitschke (asexual morph Phomopsis (Sacc.) Bubák).
Three isolates (CSM 133, CSM 222, CSM 224) with similar characteristics to genus Phomopsis/sexual morph Diaporthe produced cultures with a surface dirty white to ochreous, reverse umber, very large, coalescing stromata with lodged, elongated pycnidia necks forming dense, cream-colored droplets of conidia. Alpha conidia abundant, base truncate, smooth, aseptate, hyaline, guttulate, fusiform, tapering towards both ends, apex acutely rounded, 5.5-10 x 2-3 μm (mean = 8.0 x 2.5 μm, n = 50), beta conidia not seen (13) (Table 3).
GenBank and culture collection accession numbers of Diaporthe spp. included in the current study.
A concatenated dataset of four gene regions was used for Diaporthe species identification. The ITS, TEF1, CAL and TUB2 data had 2095 base pairs and included 03 taxa isolated in the current study plus 31 reference species of Diaporthe. Diaporthella corylina was included as an outgroup CBS 121124 (Table 3). Three Diaporthe pseudomangiferae R.R. Gomes, C. Glienke & Crous isolates were clustered with BS/PP = 76/0.99 (Figure 4).
Phylogenies generated from Bayesian analysis based on combined ITS, TEF1, CAL and TUB2 sequences of Diaporthe species. The phylogenies were rooted with Diaporthella corylina CBS 121124. Bootstrap test ≥ 75%:1000 replicates and Bayesian posterior probabilities ≥ 0.99 (BS/PP) are highlighted by arrows. The new coffee isolates included in the current study are in oblique and bold.
Diaporthe species (asexual morph = Phomopsis) have been previously isolated from coffee as both pathogens and endophytes around the globe; however, Diaporthe species have varied depending on location. In the present study, Diaporthe pseudomangiferae could be isolated from coffee twigs with anthracnose symptoms in Venezuela. Phomopsis sp. was previously isolated in Venezuela from a coffee leaf spot in Trujillo (51). In Puerto Rico, Phomopsis sp. was found on branches and dead nodes of coffee trees with C. gloeosporioides and mummified berries (32). Furthermore, Diaporthe acutispora Y.H. Gao & L. Cai and Diaporthe yunnanensis Y.H. Gao & L. Cai were also isolated from healthy leaves of Coffea sp. in Yunnan Province of China (10).
In Kenya, Rayner (44) isolated and reported Phomopsis sp. as a coffee endophyte after having sterilized the surfaces of healthy leaves, pedicels, stems, and green berries; an endophyte was also isolated from asymptomatic coffee tissues of berries and leaves in Colombia, Hawaii, Mexico and Puerto Rico (52). Diaporthe liquidambaris (C.Q. Chang, Z.D. Jiang & P.K. Chi) Udayanga & Castl., and D. phaseolorum (Cooke & Ellis) Sacc. are endophytic fungi which have been isolated from mature healthy leaves of Coffea Arabica, in both conventional and organic coffee production systems, in the municipality of Garanhuns, Pernambuco, Brazil (36). Diaporthe acutispora Y.H. Gao & L. Cai and Diaporthe yunnanensis Y.H. Gao & L. Cai were also isolated from healthy leaves of Coffea sp. in Yunnan Province of China (10). It is not entirely clear whether Diaporthe spp. play a role as latent pathogens in Coffea spp., but species in these genera are known as endophytes and pathogens (13).
Although CBD caused by C. kahawae is so far restricted to Africa, in 1986 and 1994 isolates similar to C. gloeosporioides that cause coffee berry diseases were reported in the states of Lara, Portuguesa and Trujillo States, Venezuela, based on morphological identification. This species has been reported as the cause of anthracnose on leaves and branches, fruit diseases and dieback in coffee crops (29, 30, 51). In the current study, both morphological and molecular species identification detected absence of C. gloeosporioides but presence of other Colletotrichum species, including C. siamense and C. alienum. These reported Colletotrichum species are capable of and known for causing berry diseases and anthracnose on Coffea spp. shoots. Thus, appropriate management measures for pathogen control must be adopted to prevent the introduction of this disease to other coffee growing areas, specially to neighboring regions in South America. The current study is the first report of D. pseudomangiferae associated with anthracnose in coffee plantations in Venezuela. The pathogen can be considered an endophyte or a latent pathogen together with Fusarium species in the global trade market.
ACKNOWLEDGEMENTS
We are grateful to the U. S. Department of State Fulbright Scholar Program for supporting a one-year exchange visit and providing financial support to Prof. Sari R. Mohali Castillo, ID assigned: PS00236102, as researcher in the Department of Agricultural Biology, Colorado State University. We also thank Kristen Otto for excellent laboratory assistance.
REFERENCES
- 1 Avelino, J.; Cristancho, M.; Georgiou, S.; Imbach, P.; Aguilar, L.; Bornemann, G.; Morales, C. The coffee rust crises in Colombia and Central America (2008-2013): impacts, plausible causes and proposed solutions. Food Security, Springer Netherlands, v.7, n.2, p.303-321, 2015.
- 2 Carbone, I.; Kohn, L. M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia, USA, v.91, n.3, p.553-556, 1999.
- 3 Carroll, G. Fungal endophytes in stems and leaves: from latent pathogen to mutualistic symbiont. Ecology, Washington, DC, USA, v.69, n.1, p.2-9. 1998.
- 4 Choi, Y.W.; Hyde, K.D.; Ho, W. Single spore isolation of fungi. Fungal Diversity, Kunming, China, v.3, p.29-38, 1999.
- 5 Cristóbal-Martínez, A.L.; Yáñez-Morales, M.; Solano-Vidal, R.; Segura-León, O.; Hernández-Anguiano, A.M. Diversity of Colletotrichum species in coffee (Coffea arabica) plantations in Mexico. European Journal of Plant Pathology, Springer Netherlands, v.147, n.3, p.605-614, 2017.
- 6 Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Crous, P.W. The Colletotrichum acutatum species complex. Studies in Mycology, Utrecht, v.73, p.37-113, 2012.
- 7 Drummond, A.J.; Suchard, M.A.; Xie, D.; Rambaut, A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, Oxford, v.29, n.8, p.1969-1973, 2012.
- 8 Freeman, S. Genetic diversity and host specificity of Colletotrichum species on various fruits. In: Prusky, D.; Freeman, S.; Dickman, M.B. (ed.). Colletotrichum, host specificity, pathology, and host-pathogen interaction, St Paul: APS Press, 2000. p.131-144.
- 9 Freitas, R.L.; Maciel-Zambolim, E.; Zambolim, L.; Lelis, D.T.; Caixeta, E.T.; Lopes, U.P.; Pereira, O.L. Colletotrichum boninense causing anthracnose on coffee trees in Brazil. Plant Disease, St. Paul, v.97, n.9, p.1255, 2013.
- 10 Gao, Y.; Liu, F.; Duan, W.; Crous, P. W.; Cai, L. Diaporthe is paraphyletic. IMA FUNGUS, USA, v.8, n.1, p.153-187, 2017.
- 11 Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes application to the identification of mycorrhizae and rusts. Molecular Ecology, United Kingdom, v.2, n.2, p.113-118, 1993.
- 12 Glass, N.L.; Donaldson, G. Development of primer sets designed for use with PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology, USA, v.61, n.4, p.1323-1330, 1995.
- 13 Gomes, R.R.; Glienke, C.; Videira, S.I.R.; Lombard, L.; Groenewald, J.Z.; Crous, P.W. Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia, Leiden, Netherlands, v.31, p.1-41, 2013.
- 14 Griffiths, E.; Gibbs, J.N.; Waller, J.M. Control of coffee berry disease. Annals of Applied Biology, United Kingdom, v.67, n.1, p.45-74, 1971.
- 15 Hall, T.A. BIOEDIT: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, Oxford, v.41, n.2, p.95-98, 1999.
- 16 Hindorf, H.; Omondi, C.O. A review of three major fungal diseases of Coffea arabica L. in the rainforests of Ethiopia and progress in breeding for resistance in Kenya. Journal of Advanced Research, Egypt, v.2, n.2, p.109-120, 2011.
- 17 Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogeny. Bioinformatics, Oxford, v.17, n.8, p.754-755, 2001.
-
18 Index Mundi. Green Coffee Arabica Production by Country in 1000, 60 KG BAGS [S. l]: Index Mundi, 2022. Available at: <https://www.indexmundi.com/agriculture/?Commodity=green-coffee&graph=arabica-production>. Accessed on: 15 Nov. 2022, USA.
» https://www.indexmundi.com/agriculture/?Commodity=green-coffee&graph=arabica-production - 19 Jayawardena, R.S.; Hyde, K.D.; Damm, U.; Cai, L.; Liu, M.; Li, X. H.; Zhang, W.; Zhao, W.S.; Yan. J.Y. Notes on currently accepted species of Colletotrichum Mycosphere, Guangzhou, China, v.7, n.8, p.1192-1260, 2016.
- 20 Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: improvements in program usability. Molecular Biology and Evolution, Oxford, v.30, n.4, p.772-780, 2013.
- 21 Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; Thierer, T.; Ashton, B.; Mentjies, P.; Drummond, A. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, Oxford, v.28, n.12, p.1647-1649, 2012.
- 22 Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; Thompson, J. D.; Gibson, J.; Higgins, D.G. Clustal W and Clustal X v. 2.0. Bioinformatics, Oxford, v.23, n.21, p.2947-2948, 2007.
- 23 Leslie, J.F.; Summerell, B.A. The Fusarium laboratory manual Ames: Blackwell Professional, 2006. 388p.
- 24 Liu, F.; Damm, U.; Cai, L.; Crous, P. W. Species of the Colletotrichum gloeosporioides complex associated with anthracnose diseases of Proteaceae. Fungal Diversity, Kunming, China, v.61, p.89-105, 2013.
- 25 Liu, F.; Wang, M.; Damm, U.; Crous, P. W.; Cai, L. Species boundaries in plant pathogenic fungi: a Colletotrichum case study. BMC Evolutionary Biology, United Kingdom, v.16, n.81, 1-14. 2016.
- 26 Liu, F.; Weir, B.S.; Damm, U.; Crous, P.W.; Wang, Y.; Liu, B.; Wang, M.; Zhang, M.; Cai, L. Unravelling Colletotrichum species associated with Camellia: employing ApMat and GS loci to resolve species in the C. gloeosporioides complex. Persoonia, Leiden, Netherlands, v.35, p.63-86, 2015.
- 27 Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit. Molecular Biology and Evolution, Oxford, v.16, n.12, p.1799-1808, 1999.
- 28 Lombard, L.; Van der Merwe, N.A.; Groenewald, J.Z.; Crous, P.W. Generic concepts in Nectriaceae. Studies in Mycology, Utrecht, v.80, p.189-245, 2015.
- 29 Martínez de Carrillo, M.; Zambrano, C. Identificación y patogenicidad de cepas del genero Colletotrichum asociados al cultivo del café Coffea aribica L. en la región Centro Occidental de Venezuela. Agronomía Tropical, Maracay, v.44, n.4, p.567-577, 1994.
- 30 Martínez de Carrillo, M.; Zambrano, C. Variantes morfológicas de cepas del genero Colletotrichum asociadas al cultivo del café Coffea arabica L. en diferentes pisos altitudinales de la región Centro Occidental de Venezuela. Agronomía Tropical, Maracay, v.44, n.4, p.679-692, 1994.
- 31 Masaba, D.; Waller, J. M. Coffee berry disease: the current status. In: Bailey, J.A.; Jeger, M.J. (ed.). Colletotrichum: biology, pathology and control. Wallingford: CAB International, 1992. p.237-249.
- 32 Mignucci, J.S.; Hepperly, P.R.; Ballester, J.; Rodríguez-Santiago, C. Anthracnose and berry disease of coffee in Puerto Rico. The Journal of Agriculture of the University of Puerto Rico, Puerto Rico, v.69, n.1, p.107-117, 1985.
- 33 Minin, V.; Abdo, Z.; Joyce, P.; Sullivan, J. Performance-based selection of likelihood models for phylogeny estimation. Systematic Biology, Oxford, v.52, n.5, p.674-683, 2003.
- 34 Motisi, N.; Ribeyre, F.; Poggi, S. Coffee tree architecture and its interactions with microclimates drive the dynamics of coffee berry disease in coffee trees. Scientific reports, London, United Kingdom, v.9, n.2544, 1-12, 2019.
- 35 Nguyen, P.T.H.; Pettersson, O.V.; Olsson, P.; Liljeroth, E. Identification of Colletotrichum species associated with anthracnose disease of coffee in Vietnam. European Journal of Plant Pathology, Springer Netherlands, v.127, n.1, p.73-87, 2010.
- 36 Oliveira, R.; Souza, R.; Lima, T.; Cavalcanti, M. Endophytic fungal diversity in coffee leaves (Coffea arabica) cultivated using organic and conventional crop management systems. Mycosphere, Guangzhou, China, v.5, n.4, p.523-530, 2014.
- 37 Omondi, C.O.; Ayiecho, P.O.; Mwang’Ombe, A.W.; Hindorf, H. Reaction of some Coffea arabica genotypes to strains of Colletotrichum kahawae, the cause of coffee berry disease. Journal of Phytopathology, United Kingdom, v.148, n.1, p.61-63, 2000.
- 38 O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences, USA, v.95, n.5, p.2044-2049, 1998.
- 39 Pereira-Pasin, L.A.A.; Almeida, J.R.; Abreu, M.S. Fungos associados a grãos de cinco cultivares de café (Coffea arabica L.). Acta Botanica Brasilica, Brasília, Brazil, v.23, n.4, p.1129-1132, 2009.
- 40 Pérez, J.; Infante, F.; Vega, F.E.; Holguín, F.; Macías, J.; Valle, J.; Nieto, G.; Peterson, S.W.; Kurtzman, C.P.; O’Donnell, K. Mycobiota associated with the coffee berry borer (Hypothenemus hampei) in Mexico. Mycological Research, Amsterdam, The Netherlands, v.107, n.7, p.879-887, 2003.
- 41 Phoulivong, S.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Abdelsalam, K.; Hyde, K.D.; Chukeatirote, E. Colletotrichum gloeosporioides is not a common pathogen on tropical fruits. Fungal Diversity, Kunming, v.44, p.33-43, 2010.
- 42 Prihastuti, H.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Hyde, K.D. Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Diversity, Kunming, China, v.39, 89-109, 2009.
- 43 Rakotoniriana, E.F.; Scauflaire, J.; Rabemanantsoa, C.; Urveg- Ratsimamanga, S.; Corbisier, A.M.; Quetin-Leclercq, J.; Declerck, S.; Munaut, F. Colletotrichum gigasporum sp. nov., a new species of Colletotrichum producing long straight conidia. Mycological Progress, Germany, v.12, n.2, p.403-412, 2013.
- 44 Rayner, R.W. Latent infection in Coffea arabica L. Nature, Cambridge, v.161, p.245-246, 1948.
- 45 Rayner, R.W. A mycological colour chart Surrey: Commonwealth Mycological Institute, 1970. 34p.
- 46 Ronquist, F.; Teslenko, M.; Van der Mark, P.; Ayres, D.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.; Huelsenbeck, J. MrBayes v.3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, Oxford, v.61, n.3, p.539-542, 2012.
- 47 Sharma, G.; Maymon, M.; Freeman, S. Epidemiology, pathology and identifcation of Colletotrichum including a novel species associated with avocado (Persea americana) anthracnose in Israel. Scientific Reports, London, United Kingdom, v.7, n.15839, 1-16, 2017.
- 48 Schena, L.; Mosca, S.; Cacciola, S.O.; Faedda, R.; Sanzani, S.M.; Agosteo, G. E.; Sergeeva, V.; Magnano di San Lio, G. Species of the Colletotrichum gloeosporioides and C. boninense complexes associated with olive anthracnose. Plant Pathology, Sutton Bonington, v.63, n.2, p.437-446, 2014.
- 49 Shivas, R.G.; Tan, Y.P.; Edwards, J.; Dinh, Q.; Maxwell, A.; Andjic, V.; Liberato, J.R.; Anderson, C.; Beasley, D.R.; Bransgrove, K.; Coates, L.M.; Cowan, K.; Daniel, R.; Dean, J.R.; Lomavatu, M.F.; Mercado-Escueta, D.; Mitchell, R.W.; Thangavel, R.; Tran-Nguyen, L.T.T.; Weir, B.S. Colletotrichum species in Australia. Australasian Plant Pathology, Netherlands, v.45, n.5, p.447-464, 2016.
- 50 Silva, D.N.; Talhinhas, P.; Várzea, V.; Cai, L.; Paulo, O.S.; Batista, D. Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: an example from coffee (Coffea spp.) hosts. Mycologia, USA, v.104, n.2, p.396-409, 2012.
- 51 Urtiaga, R. Índice de enfermedades en plantas de Venezuela y Cuba Barquisimeto: Impresos Nuevo Siglo, 1986. 324p.
- 52 Vega, F.E.; Simpkins, A.; Aime, M.C.; Posada, F.; Peterson, S.W.; Rehner, S. A.; Infante, F.; Castillo, A.; Arnold, A.E. Fungal endophyte diversity in coffee plants from Colombia, Hawai’i, Mexico and Puerto Rico. Fungal ecology, Netherlands, v.3, n.3, p.122-138, 2010.
- 53 Waller, J.M. Colletotrichum diseases of perennial and other cash crops. In: Bailey, J.A.; Jeger, M.J. (ed.). Colletotrichum: biology, pathology and control. Wallingford: CAB International, 1992. p.131-142.
- 54 Weir, B.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Studies in Mycology, Netherlands, v.73, p.115-180, 2012.
- 55 White, T.J.; Bruns, T.; Lee, S.J.W.T.; Taylor, J.L. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.; Gelfand, D.H.; Sninsky, J.J.; White. T.J. (ed.). PCR protocols: a guide to methods and applications. London: Academic Press Inc., 1990. chap.38, p.315-322.
