SciELO - Scientific Electronic Library Online

 
vol.91 issue1Reproductive biology of a viviparous lizard (Mabuya dorsivittata) from the subtropical Wet Chaco of Argentina: geographical variations in response to local environmental pressuresDistribution, diversity, and habitat partitioning of Scolecitrichidae species (Copepoda: Calanoida) down to 1,200 m in the Southwestern Atlantic Ocean author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Anais da Academia Brasileira de Ciências

Print version ISSN 0001-3765On-line version ISSN 1678-2690

An. Acad. Bras. Ciênc. vol.91 no.1 Rio de Janeiro  2019  Epub Mar 21, 2019

https://doi.org/10.1590/0001-3765201920180459 

Biological Sciences

6-Bromoindirubin-3’-oxime promotes osteogenic differentiation of canine BMSCs through inhibition of GSK3β activity and activation of the Wnt/β-catenin signaling pathway

XIAO-E ZHAO1 

ZHENSHAN YANG1 

ZHEN GAO1 

JUNBANG GE1 

QIANG WEI1 

BAOHUA MA1 
http://orcid.org/0000-0002-8332-4275

1Key Laboratory of Animal Biotechnology, Ministry of Agriculture, College of Animal Veterinary Medicine, Northwest A&F University, Yangling 712100, China


ABSTRACT

This study aimed to investigate how 6-bromoindirubin-3’-oxime (BIO) increases the osteogenic differentiation of canine bone mesenchymal stem cells (BMSCs) and the role of the Wnt/β-catenin signaling pathway in this process. We mimicked the effect of Wnt by adding BIO to the culture medium of BMSCs and examined whether canonical Wnt signaling positively affects the differentiation of these cells into osteoblasts. Canine BMSCs were cultured with 0.5 and 1.0 μM BIO under osteogenic conditions and then differentiation markers were investigated. It was found that BIO significantly increased the activity of alkaline phosphatase (ALP), the number of ALP-positive cells, the mineralization level and calcium deposits. Moreover, cells cultured with 0.5 and 1.0 μM BIO exhibited detectable β-catenin expression in their nuclei, and showed upregulated β-catenin and glycogen synthase kinase 3 beta(GSK3β) phosphorylation compared to untreated cells. In addition, BIO enhanced the mRNA expression of osteoblast differentiation markers such as ALP, runt-related transcription factor 2, collagen I, osteocalcin, and osteonectin. In conclusion, BIO upregulated GSK3β phosphorylation and inhibited its activity, thereby activating the Wnt/β-catenin signaling pathway and promoting the osteogenic differentiation of canine BMSCs. The effect of 1.0 μM BIO on BMSCs differentiation was stronger than that of 0.5 μM BIO.

Key words Bone mesenchymal stem cells; bromoindirubin oxime; osteogenetic differentiation; canine

INTRODUCTION

Bone marrow mesenchymal stem cells (BMSCs) are non-hematopoietic pluripotent stem cells derived from the bone marrow that are capable of differentiating into a wide variety of cells such as neuronal, cardiac, skeletal muscle, epithelial, and pancreatic islet cells (Schwartzet al. 2002 , Zhao et al. 2016, Özdal-Kurt et al. 2016, Zhang et al. 2017). Bone marrow mesenchymal stem cells have been widely applied as seed cells for bone tissue engineering (Augello and De-Bari 2010, Deschaseaux et al. 2010, Kilinc et al. 2014, Liang et al. 2016, Duan et al. 2017). However, the ability of BMSCs to differentiate into osteoblasts is weak, which limits their clinical application in the treatment of orthopedic diseases. Thus, the key aim of the present study was to increase the differentiation ability of BMSCs. In veterinary clinics, pet fractures arising from bone disease, malnutrition, harmful (non-benign) arthropathy, and liver/kidney failure have gradually become serious obstacles affecting the quality of life and survival of pets, especially dogs and cats. Consequently, veterinary medical researchers and doctors are providing increasing attention to research around causes and possible treatments of pet fractures and/or bone diseases. However, conventional treatments of many bone-associated diseases, especially necrotic bone diseases, are characterized by long duration and unsatisfactory treatment outcomes, as they are mainly based on surgical debridement and fixation, and self-recovery following anti-inflammatory treatment. In order to improve the treatment outcome of these diseases, new methods capable of inducing the differentiation of BMSCs into osteoblasts are required. Therefore, a good understanding of the differentiation mechanisms of BMSCs is of great importance for the treatment of pet bone diseases. Since BMSCs are the source of osteoblast precursors (Pham et al. 2011, Park et al. 2010, Zhu et al. 2016), their differentiation in vivo is strictly controlled in terms of time and direction by an extremely complex set of signaling molecules and pathways, such as the Wnt, transforming growth factor beta, and bone morphogenetic protein signaling pathways (Augello and De-Bari 2010, Müller-Deubert et al. 2017, Long et al. 2017). Previous research has shown that the Wnt signaling pathway plays an important role in the differentiation, proliferation, and migration of osteoblasts (Ling et al. 2009, Robinson et al. 2006, Zhu et al. 2016, Zhou et al. 2016). Activation of the Wnt/β-catenin signaling pathway stimulates osteogenic differentiation (Bennett et al. 2007, Su et al. 2015). In addition, the enhancement of Wnt signaling either by overexpression of Wnt ( et al. 2007) or shortage of Wnt antagonists (Morvanet al. 2006 , ten Dijke et al. 2008) increases bone formation in humans and mice. Moreover, Wnt signaling promotes the differentiation of mouse mesenchymal stem cells (MSCs) towards the osteoblastic lineage (Gaur et al. 2005). 6-Bromoindirubin-3’-oxime (BIO), a specific inhibitor of glycogen synthase kinase 3 beta (GSK3β), is known to activate the Wnt/β-catenin signaling pathway (Meijer et al. 2003, Sato et al. 2004). In this study, we mimicked the effect of Wnt by adding BIO to canine BMSCs and investigated whether canonical Wnt signaling positively affects the differentiation of these cells into osteoblasts.

MATERIALS AND METHODS

MATERIALS

Chemicals were obtained from Sigma-Aldrich Chemical (St.Louis, MO, USA) unless otherwise specified.

BMSCs ISOLATION AND CULTURE

The current protocol for experimentation on beagle dogs (two-months-old, 1.5 kg, obtained from Wu Gong County) was approved by the Institutional Animal Care and Use Committee of Northwest A&F University. Dogs were injected with 10 mg/kg ketamine. Then, 10 ml of the bone marrow was extracted from the iliac crest of each dog under sterile conditions according to previously reported methods (Sun et al. 2010). To obtain BMSCs, bone marrow cells were incubated in culture dishes (diameter, 60 mm) with 4 mL of alpha minimum essential medium (α-MEM, Gibco) containing 10% fetal bovine serum (FBS, Gibco) and 100 U/mL penicillin/streptomycin (North China Pharmaceutical Co., Ltd., Shijiazhuang, China). Cultures were maintained at 37 °C and 5% CO2. After 24 h, non-adherent cells were removed by replacing the medium with fresh α-MEM containing 10% FBS. The medium was replaced with fresh medium every 3 d. When cells reached 80-90% confluence, the medium was discarded, and 0.5 ml of 0.1% trypsin (Sigma) was added for 2 min at room temperature. Trypsin was neutralized by the addition of α-MEM containing 10% FBS, and the cell suspension was centrifuged at 1000 × g for 6 min. Then, the supernatant was discarded, and the cells were resuspended and passaged at 1:3 ratio.

IDENTIFICATION OF CELL SURFACE ANTIGENS BY FLOW CYTOMETRY

After the third passage BMSCs (P3 BMSCs) were harvested and fixed with 4% paraformaldehyde solution until further processing. For identification of cell surface antigens, cells were washed twice with phosphate-buffered saline (PBS) and directly labeled with fluorescein isothiocyanate (FITC)-conjugated CD34 (FITC Rat anti-Mouse CD34; BD Pharmingen), CD45 (FITC Rat Anti-Mouse CD45; BD Pharmingen), CD90 (PE Mouse Anti-Human CD90; BD Pharmingen), and CD105 (PerCP-Cy™5.5 Mouse anti-Human CD105; BD Pharmingen). Flow cytometry was performed using a FACS Calibur (BD Biosciences, San Diego, USA) and forward and side scatter profiles were adjusted to gate out debris and dead cells. Data were analyzed using Cell Quest software (BD Biosciences).

DETERMINATION OF SUITABLE BIO CONCENTRATION

To determine the BIO concentration needed to stimulate osteogenic differentiation of canine BMSCs, P3 BMSCs were cultured with different concentrations of BIO, and its effect on the cells was analyzed by cell proliferation detection and JC-1 assay.

Cell proliferation detection: P3 BMSCs were seeded at a density of 5.0 × 104 cells/mL into 24-well plate (400 µL/well) in osteogenic medium containing (control group), and osteogenic medium containing 0.5, 1.0, and 2.5 μM BIO. After 4 d, cells were counted using a red blood cell count plate (Qiujing, China) and proliferation was expressed as the number of population doublings per day (PDD). Average PDD values for each BIO concentration were calculated and results were analyzed by paired Student’s t-test relative to cells grown in basic medium without BIO.

JC-1 assay: P3 BMSCs were treated as described above. After 4 d, a JC-1 apoptosis detection kit (Keygen) was used to measure the mitochondrial transmembrane potential (Δψm). After washing, the JC-1 working solution was added to each well, and cells were incubated at 37 °C and 5% CO2 for 20 min, then the nuclei were stained with Hoechst33342 (Sigma, USA) for 5 min at room temperature. After washing with PBS, the images were captured using a fluorescence microscope (Olympus, Tokyo, Japan).

ALKALINE PHOSPHATASE STAINING

P3 BMSCs were seeded at a density of 5 × 104 cells/mL into 35-mm dishes (1 mL/ dish) with osteogenic medium containing different concentrations (0, 0.5 and 1.0 μM) of BIO for 5 d. Alkaline phosphatase (ALP) activity was determined using an ALP kit (Nanjing Jiancheng Bioengineering Institute). The cells were washed 3 times with PBS, then fixed with 4% formaldehyde (Sigma, USA) for 30 min and washed with PBS again. Cells were stained with the ALP reagent [33 μL BCIP (300×) and 66 μL NBT (150×) were added to the alkaline phosphatase staining buffer] for 1-2 h at room temperature, then images were captured using an inverted microscope (Olympus, Tokyo, Japan), and the number of positive cells was obtained by randomly counting the number of positive cells in 3 fields of vision, repeating 3 times and averaging.

ALIZARIN RED STAINING

P3 BMSCs were seeded at a density of 1 × 104 cells/mL into 35-mm dishes (1 mL/ dish) for each group. After attachment, cells were cultured with an osteogenesis-inducing medium with or without BIO. On day 14, the cells were washed 3 times with PBS, fixed with 95% ethanol for 10 min, dried at room temperature, and then stained with 0.1% Alizarin Red (pH 4.2; Sigma, USA) for 1-2 h at room temperature. Then, the Alizarin Red solution was removed, and cells were rinsed with PBS and dried at room temperature. Images were captured using an inverted microscope (Olympus, Tokyo, Japan).

IMMUNOFLUORESCENCE STAINING

P3 BMSCs were seeded at a density of 5 × 104 cells/mL into 35-mm dishes (1 mL/ dish) with osteogenic medium containing different concentrations (0, 0.5 and 1 μM) of BIO for 4 d. Then, β-catenin was detected by immunofluorescence (IF) staining as follows: After discarding the culture medium, cells were washed 3 times with PBS and fixed with 4% paraformaldehyde (Sigma) for 1 h at room temperature, then washed 3 times with PBS again. The cells were dialyzed against 0.2% triton X-100 (Sigma, USA) for 10 min at room temperature, then washed 3 times with PBS and blocked with 1% bovine serum albumin (BSA, Sigma) in PBS at 4 °C for 1 h. After washing and draining, the cells were incubated overnight at 4 °C with the β-catenin primary antibody (1:100, Abcam, UK), washed 3 times with PBS, incubated with secondary donkey anti-rabbit antibody (1:100, Santa Cruz, USA) at 37 °C for 1 h, and then washed 3 times with PBS again. The nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Sigma, USA) for 2 min at room temperature. After washing with PBS, the images were captured using a fluorescence microscope (Olympus, Tokyo, Japan).

WESTERN BLOT ANALYSIS

P3 BMSCs were seeded at a density of 5 × 104 cells/mL into 35-mm dishes (1 mL/ dish) with osteogenic medium containing different concentrations (0, 0.5 and 1 μM) of BIO. After 6 h, GSK3β and phosphorylated GSK3β (p-GSK3β) were detected by western blotting, while β-catenin was detected after 4 d, also by western blotting. Cells were lysed with radioimmunoprecipitation assay buffer (CW Bio, China) and protein concentrations were determined using the BCA Protein Assay Kit (Heart, China). Cell lysate was added to the loading buffer (CW Bio, China), boiled for 10 min, and then resolved on 10% sodium dodecyl sulfate-polyacrylamide gel. After electrophoresis, the gel was transferred to polyvinylidene difluoride membrane and blocked with 3% BSA (MP Biomedicals, France) in TBST buffer (0.1% (v/v) Tween-20 in TBS) for at least 2 h at room temperature. The following primary antibodies were used: anti-β-actin (No. 4970, Cell Signaling Technology; 1:4000), anti-β-catenin (ab32572, abcam; 1:2000), anti-GSK3β (ab32391, abcam; 1:2000), and anti-p-GSK3β (ab75814, abcam; 1:2000). Blots were incubated overnight with primary antibody in TBST at 4 °C. After rinsing, the membrane was incubated at room temperature with horseradish peroxidase-conjugated secondary antibody (Yeasen Bio, China) for at least 2 h. After washing for 3 times, the blots were visualized by enhanced chemiluminescence (Bio-Rad, USA).

REVERSE TRANSCRIPTION-QUANTITATIVE POLYMERASE CHAIN REACTION ANALYSIS

P3 BMSCs were seeded at a density of 1 × 104 cells/mL into 35-mm dishes (1 mL/ dish) for each group. After attachment, cells were cultured with an osteogenesis-inducing medium with or without BIO. After culture for different days, total RNA was extracted from the cells using TRIzol reagent (TaKaRa) according to the manufacturer’s instructions, and quantified by spectrophotometry. Then, 2.0 μg of total RNA was treated with gDNA Eraser Buffer and gDNA Eraser to remove genomic DNA traces that might interfere with the polymerase chain reaction (PCR). First strand cDNA synthesis was carried out using the PrimeScript RT Enzyme Mix I (TaKaRa) with RT Primer Mix and 5X PrimeScript Buffer 2 at 37 °C for 15 min, then at 85 °C for 5 s. From the prepared cDNA, only 1 μL was used as a template for the reverse transcription-PCR (RT-PCR) with osteoblast-specific gene primers for ALP, runt-related transcription factor 2 (RUNX2), collagen I (COI), osteocalcin (OCN), and osteonectin (ONN). GAPDH was used as the internal reference gene for the osteoblast-specific genes. Primers for osteoblast-specific genes are listed in Table I. Primers were synthetized by Invitrogen. Polymerase chain reactions were run in a total volume of 20 µL, made by adding 10 μL SYBR Premix Ex Taq II to a mixture containing 0.4 μL ROX Reference Dye II, RNase-free dH2O and 0.8 pmol of each primer. Reaction mixtures were incubated at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and at the specific annealing temperature (Table I) for 30 s. In all cases, each PCR was performed with triplicate samples and repeated on at least 3 independent samples on an Applied Biosystems thermocycler (Thermo Fisher Scientific, USA). The fold change in the expression of each gene was calculated by the 2−ΔΔCt method.

TABLE I Primers used in the reverse transcription-quantitative polymerase chain reaction analysis. 

Gene Genbank NO Primer sequence (5’-3’) Annealing temperature (°C) Product size (bp)
RUNX2 XM_011514964 F:TGCCTCTGGCCTTCCACTCTCAG R:TGCATTCGTGGGTTGGAGAAGCG 60 131
ALP XM_005617212 F:CCAAGCTCAACAGACCCTGA R:GAGACACCCATCCCATCTCC 60 102
COL NM_001003187 F:CTATCAATGGTGGTACCCAGTTT R:TGTTTTGAGAGGCATGGTTG 60 111
OCN XM_014115322 F:ATGCGGTCCCTGATGGTC G:AGCCCAGAGTCCAGGTAGC 60 179
ONN XM_014113053 F:GAAGGTGCTGAGGAAACTGAAGAGG R:GAAGTGGCAGGAAGAGTCAAAGGT 60 207
GAPDH NM_001003142 F:ATCACTGCCACCCAGAAGAC R:TGTAGCCCAGGATGCCTTTG 60 289

F: forward; R: reverse. Marker genes of osteogenic cell - RUNX2: Runt-related transcription factor 2; ALP: alkaline phosphatase; COL: collagen I; OCN: osteocalcin; ONN: osteonectin; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

All collected data were entered in a Microsoft Excel sheet after generation of a proper template, and were calculated and analyzed by SPSS software (version 18.0) (International Business Machines (IBM) Corporation, New York, USA).

RESULTS

PHENOTYPE CHARACTERIZATION

Canine BMSCs were analyzed for their cell surface antigens by flow cytometry (Figure 1). Our results showed that isolated BMSCs were strongly positive for CD105 and CD90, which are specific antigens for non-hematopoietic bone marrow progenitor cells, and were negative for CD34 and CD45, which are common markers of hematopoietic and endothelial cells (Tuli et al. 2003). These results demonstrate the immunophenotypic MSC characteristics of canine BMSCs.

Figure 1 Detection of cell surface antigen of canine BMSCs by Flow cytometry. (n = 3). Canine BMSCs highly expressed CD105 (99.8%) and CD90 (99.2%), and lowly expressed CD45 (2.01%) and CD34 (0.811%). 

EFFECT OF BIO ON BMSCs PROLIFERATION

As shown in Figure 2, treatment of canine BMSCs with 0.5 and 1.0 μM BIO slightly inhibited their proliferation (Figure 2a, b). The antiproliferative activity of BIO was dramatically enhanced at the concentration of 2.5 μM, as cells treated with 2.5 μM BIO showed slow proliferation and demonstrated significant morphological changes; most of them became irregularly circular and hypertrophic (Figure 2a, b). Even though a small fraction of the cells still maintained their fibroblast morphology on day 4, their shapes changed and became shorter and thicker. The control group demonstrated normal fibroblast morphology on day 4 (Figure 2b).

Figure 2 Effect of BIO on morphology, proliferation and mitochondrial transmembrane potential of canine BMSCs. Control: osteogenic medium; 0.5, 1.0 and 2.5μM BIO: osteogenic medium containing 0.5, 1.0 and 2.5 μM BIO. (a) Effect of BIO on proliferation of canine BMSCs. (n = 3). Error bars denote mean ± SD. *P < 0.05. (b) The morphology and proliferation of canine BMSCs grown for 4 days different medium as indicated. (c) Changes in the mitochondrial transmembrane potential of canine BMSCs grown for 4 days different medium as indicated. The red fluorescence (polymer) and green fluorescence (monomer) of canine BMSCs in osteogenic medium with or without BIO. Normally, mitochondria JC-1 use its potential as a red fluorescent emitter to form a polymer. In the destruction of mitochondrial function, JC-1 as a monomer dispersed and distributed in the cytoplasm, was detected as green fluorescence. Hoechst33342: Hoechst33342 staining of the nucleus; Merge: The superposition of red fluorescence (polymer), green fluorescence (monomer) and Hoechst33342 in canine BMSCs. 

The Δψm of the BMSCs was determined by JC-1 staining (Figure 2c). Strong red and weak green fluorescent signals were detected in osteogenic media containing 0, 0.5, and 1.0 μM BIO, while the osteogenic medium containing 2.5 μM BIO demonstrated relatively strong green and relatively weak red fluorescent signals. The significant decrease in the fluorescence intensity of the red signals in the 2.5 μM BIO group compared to the other groups indicates a decrease in the Δψm in this group. Based on the results of the cells proliferation and JC-1 staining assays, 0.5 and 1.0 μM were selected as the optimal BIO concentrations.

BIO ENHANCED THE DIFFERENTIATION OF CANINE BMSCs INTO OSTEOBLASTS

The incubation of canine BMSCs with various concentrations of BIO for 5 d resulted in an increase in the activity of ALP (Figure 3a, b), which is a marker enzyme for osteoblasts. As shown in Figure 3, treatment with 0.5 and 1.0 μM BIO significantly increased the number of ALP-positive BMSCs (Figure 3a, b), with 1.0 μM BIO exhibiting a stronger effect than 0.5 μM BIO. Moreover, treatment with 0.5 and 1.0 μM BIO for 14 d resulted in an increase in the mineralization level and calcium deposits, as revealed by Alizarin Red staining (Figure 3c). All these results suggest that BIO treatment could facilitate the differentiation of BMSCs into osteoblasts.

Figure 3 BIO increased canine BMSCs differentiation towards osteoblasts. (a) BIO enhances the number of ALP staining-positive cells and ALP activity. (b) Number of ALP-positive cells. Canine BMSCs were incubated with osteogenic medium with or without BIO for 5 days, and fixed for ALP staining or quantitative assay of ALP activity by using p-Npp as a substrate. (n = 3). Error bars denote mean ± SD. *P < 0.05. (c) BIO enhanced bone mineralization in canine BMSCs. Canine BMSCs were incubated with osteogenic medium followed by addition of 0, 0.5 and 1.0 μM BIO for 14 d and fixed for alizarin red staining. 

BIO INHIBITED GSK3β ACTIVITY AND PROMOTED THE ACCUMULATION OF β-CATENIN IN THE NUCLEUS OF CANINE BMSCs

β-Catenin is known to be an important transcriptional regulator in the Wnt signaling pathway; the nuclear accumulation of β-catenin is a critical step in Wnt/β-catenin signaling. Being a specific inhibitor of GSK3β, BIO can promote the accumulation of β-catenin in the nucleus and thus activate Wnt/β-catenin signaling. Results of western blotting and β-catenin IF staining demonstrated that BIO activated the Wnt/β-catenin signaling pathway in canine BMSCs (Figure 4). Treatment of the cells with 0.5 and 1.0 μM BIO for 4 d resulted in a significant upregulation in β-catenin levels, with 1.0 μM BIO showing a stronger effect than 0.5 μM BIO (Figure 4a). Moreover, cells treated with 0.5 and 1.0 μM BIO demonstrated detectable β-catenin expression in the nuclei compared to control cells (Figure 4b). Furthermore, we examined the direct inhibitory activity of BIO on GSK3β. Canine BMSCs were cultured with 0.5 and 1.0 μM BIO under osteogenic conditions for 6 h. Then, GSK3β and p-GSK3β levels were determined by western blotting. Our results showed that GSK3β phosphorylation was significantly upregulated by BIO treatment, and that p-GSK3β levels in cells treated with 1.0 μM BIO were slightly higher than in cells treated with 0.5 μM BIO (Figure 5). These results indicate that BIO inhibits GSK3β activity, suggesting that GSK3β is the target of BIO for enhancing osteogenesis.

Figure 4 BIO activated Wnt/β-catenin signalling pathways in canine BMSCs. (a) BIO up-regulated β-catenin expression in canine BMSCs. (b) BIO promoted the accumulation of β-catenin in the cell nuclei. Canine BMSCs were incubated with basic medium, osteogenic medium with or without BIO for 4 days, detected expression of β-catenin by Western blot and immunocytochemistry staining. (n = 3). Error bars denote mean ± SD. *P < 0.05. Control: osteogenic medium; 0.5 and 1.0 μM BIO: osteogenic medium containing 0.5 and 1.0 μM BIO. DAPI: DAPI staining of the nucleus. β-catenin: β-catenin immunocytochemistry staining in nucleus. Merge: the superposition of DAPI and β-catenin immunocytochemistry in canine BMSCs. 

Figure 5 BIO enhanced the phosphorylation of GSK3β in canine BMSCs. Canine BMSCs were incubated with osteogenic medium with or without BIO for 6 hours, detected expression of phosphorylation of GSK3β by Western blot. (n = 3). The Gel Pro Software (Tanon Science & Technology Co., Ltd., China) was used to determine the gray values of the internal reference (β-actin) proteins and p-GSK3β protein bands, and the ratios were used as the relative expression of proteins. Calculating p-GSK3β relative expression and averaging. Error bars denote mean ± SD. *P < 0.05. Control: osteogenic medium; 0.5 and 1.0 μM BIO: osteogenic medium containing 0.5 and 1.0 μM BIO. 

BIO INCREASED THE MRNA EXPRESSION OF RUNX2, ALP, COI, ONN, AND OCN.

To investigate the effect of BIO on osteoblast differentiation, canine BMSCs were incubated with 0, 0.5, and 1.0 μM BIO for 3, 7, and 14 d, and the expression levels of osteoblast differentiation markers, such as RUNX2, ALP, COI, ONN, and OCN were examined by RT-PCR. As shown in Figure 6, COI and RUNX2 expression levels were evidently increased in cells treated with 0.5 and 1.0 μM BIO for 3, 7, and 14 d. Moreover, the expression of ALP, a marker of early osteoblast differentiation, was evidently increased in cells treated with 0.5 and 1.0 μM BIO for 3 and 7 d. However, cells cultured with BIO for 14 d showed lower relative mRNA expression of ALP than control cells. Moreover, markers of late osteoblast differentiation, OCN and ONN, were found to be strongly expressed in BMSCs treated with 0.5 and 1.0 μM BIO for 14 d. All these results indicate that BIO can promote the ability of canine BMSCs to differentiate into osteoblasts.

Figure 6 BIO enhanced the mRNA expression of osteoblast differentiation markers in canine BMSCs. Canine BMSCs were incubated with osteogenic medium with or without BIO for 3 d, 7 d and 14 d, collected the cells and detected expression of RUNX2, ALP, COI, ONN, and, OCN mRNA by qPT-PCR . (n = 3). Error bars denote mean ± SD. *P < 0.05. Control: osteogenic medium; 0.5 and 1.0 μM BIO: osteogenic medium containing 0.5 and 1.0 μM BIO. 

DISCUSSION

Previous research has shown that the Wnt signaling pathway plays an important role in the differentiation, proliferation, and migration of stem cells (Ling et al. 2009, Robinson et al. 2006, Zhu et al. 2016, Zhou et al. 2016), as Wnt signals play different roles under different conditions. For example, activation of the Wnt signaling pathway stimulates the differentiation of mouse MSCs towards the osteoblastic lineage (Gaur et al. 2005). In addition, activation of the Wnt/β-catenin signaling pathway by inhibition of GSK3β (Dravid et al. 2005, Anton et al. 2007) is important for the maintenance of pluripotency and self-renewal in human and mouse embryonic stem cells (Hur and Zhou 2010, Meijer et al. 2003), and for the modulation of apoptosis (Chon et al. 2015). In this study, we added different concentrations of BIO to BMSCs and examined whether the stimulation of canonical Wnt signaling by BIO positively affects the differentiation of these cells into osteoblasts. First, we found that 2.5 μM BIO inhibited the proliferation of BMSCs, thus, lower concentrations (0.5 and 1 µM BIO) were selected to be used in the experiments.

Osteogenic differentiation of BMSCs is the most important process in bone formation and reconstruction and is regulated by multiple signaling pathways (Lee et al. 2016, Zhou et al. 2016, Tang et al. 2016, Li et al. 2016). The classic Wnt/β-catenin signaling pathway is one of the key pathways that regulate bone formation and promote bone differentiation (Qian et al. 2015, Ma et al. 2016, Liu et al. 2016). The Wnt/β-catenin signaling pathway functions by regulating β-catenin phosphorylation and degradation in the cytoplasm. Upon activation of the canonical Wnt pathway, inhibition of GSK3β results in the dephosphorylation of β-catenin leading to its accumulation in the nucleus. In this study, we investigated the effects of BIO on the Wnt/β-catenin signaling pathway, and on the differentiation of canine BMSCs. Our results demonstrated that BIO treatment resulted in β-catenin upregulation and nuclear translocation, which indicates that BIO could activate Wnt/β-catenin signaling in canine BMSCs. Moreover, we found that BIO can robustly stimulate canine BMSCs differentiation; 0.5 and 1.0 μM BIO successfully enhanced the differentiation of canine BMSCs into osteoblasts. Furthermore, we investigated the direct inhibitory effect of BIO on GSK3β by western blot analysis, which demonstrated an upregulation in p-GSK3β levels in BIO-treated cells, indicating that the BIO-induced activation of Wnt/β-catenin signaling in canine BMSCs is mediated by inhibition of GSK3β activity.

The effect of the Wnt pathway on osteogenesis depends on both the cellular environment and the expression of target genes (Liu et al. 2013). Thus, we investigated the expression of osteoblast differentiation markers such as RUNX2, COI, ALP, ONN, and OCN, and found that they were increased in cells treated with BIO. RUNX2 activates and induces the differentiation of BMSCs into immature osteoblasts and regulates pre-osteoblast maturation. It also directly stimulates the transcription of OCN and COI during the differentiation of BMSCs into osteoblasts (Ducy et al. 1999, Okazaki and Sandell 2004). COI is the basis for the formation of calcium nodules (Owen et al. 1990), ALP activity is a useful early detector for features of osteogenesis, and OCN is a late marker of osteogenic differentiation (Maroni et al. 2012). Our results showed that, compared with the control cells, BIO-treated cells exhibited an evident increase in the relative mRNA expression of RUNX2 and COI. In addition, relative mRNA expression of ALP was evidently increased in cells treated with BIO for 3 and 7 d, while it was decreased in cells treated with BIO for 14 d. Moreover, OCN and ONN, markers of late osteoblast differentiation, were strongly expressed in BMSCs treated with BIO for 14 d compared to untreated cells, which indicates the formation of mature osteoblasts from canine BMSCs treated with BIO for 14 d. Alizarin Red staining proved osteoblast formation and matrix mineralization in BIO-treated cells on day 14, while it demonstrated their absence in the control cells. Collectively, all of the aforementioned results prove that BIO could increase the differentiation ability of BMSCs into osteoblasts through regulation of the target genes of β-catenin signaling.

CONCLUSIONS

Treatment of canine BMSCs with BIO resulted in upregulation of GSK3β phosphorylation, and thus inhibition of GSK3β activity and activation of Wnt/β-catenin signaling, consequently leading to accumulation of β-catenin in the cytoplasm and its translocation into the nucleus, where it induced the expression of downstream target genes and osteoblast differentiation markers. In conclusion, BIO-mediated activation of the canonical Wnt/β-catenin signaling pathway can increase the ability of canine BMSCs to differentiate into osteoblasts.

ACKNOWLEGMENTS

This study was supported by funds from the National Natural Science Foundation of China, grant number: 31772818.

REFERENCES

ANTON S, MELVILLE L and RENA G. 2007. Epigallocatechin gallate (EGCG) mimics insulin action on the transcription factor FOXO1a and elicits cellular responses in the presence and absence of insulin. Cell Signal 19: 378-383. [ Links ]

AUGELLO A and DE-BARI C. 2010. The regulation of differentiation in mesenchymal stem cells. Human Gene Therapy 21: 1226-1238. [ Links ]

AUGELLO A, KURTH TB and DE-BARI C. 2010. Mesenchymal stem cells: a perspective from in vitro cultures to in vivo migration and niches. Eur Cell Mater 20: 121-133. [ Links ]

BENNETT CN, OUYANG H, MA YL, ZENG Q, GERIN I, SOUSA KM, LANE TF, KRISHNAN V, HANKENSON KD and MACDOUGALD OA. 2007. Wnt10b increases postnatal bone formation by enhancing osteoblast differentiation. J Bone Miner. Res 22: 1924-1932. [ Links ]

CHON E, FLANAGAN B, DE SÁ RODRIGUES LC, PISKUN C and TIMOTHY J. 2015. Stein 6-Bromoindirubin-3′oxime (BIO) decreases proliferation and migration of canine melanoma cell lines. Vet J 205: 305-312. [ Links ]

DESCHASEAUX F, PONTIKOGLOU C and SENSEBE L. 2010. Bone regeneration: the stem/progenitor cells point of view. J Cell Mol Med 14: 103-115. [ Links ]

DRAVID G, YE Z, HAMMOND H, CHEN G, PYLE A, DONOVAN P, YU X AND CHENG L. 2005. Defining the role of Wnt/b-Catenin signaling in the survival, proliferation, and self-renewal of human embryonic stem cells. Stem Cells 23: 1489-1501. [ Links ]

DUAN Y, MA W, LI D, WANG T and LIU B. 2017. Enhanced osseointegration of titanium implants in a rat model of osteoporosis using multilayer bone mesenchymal stem cell sheets. Exp Ther Med 14: 5717-5726. [ Links ]

DUCY P, STARBUCK M, PRIEMEL M, SHEN J, PINERO G, GEOFFROY V, AMLING M and KARSENTY G. 1999. A Cbfa1-dependent genetic pathway controls bone formation beyond embryonic development. Genes Dev 13: 1025-1036. [ Links ]

GAUR T, LENGNER CJ, HOVHANNISYAN H, BHAT RA, BODINE PV, KOMM BS, JAVED A, VAN WIJNEN AJ, STEIN JL and STEIN GS. 2005. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem 280: 33132-33140. [ Links ]

HUR EM and ZHOU FQ. 2010. GSK3 signaling in neural development. Nat Rev, Neurosci 11: 539-551. [ Links ]

KILINC S et al. 2014. Evaluation of epithelial chimerism after bone marrow mesenchymal stromal cell infusion in intestinal transplant patients. Transplant Proc 46: 2125-2132. [ Links ]

LEE SH, PARK Y, SONG M, SRIKANTH S, KIM S, KANG MK, GWACK Y, PARK NH, KIM RH and SHIN KH. 2016. Orai1 mediates osteogenic differentiation via BMP signaling pathway in bone marrow mesenchymal stem cells. Biochem Biophys Res Commun 473: 1309-1314. [ Links ]

LI W, WEI S, LIU C, SONG M, WU H and YANG Y. 2016. Regulation of the osteogenic and adipogenic differentiation of bone marrow-derived stromal cells by extracellular uridine triphosphate: The role of P2Y2 receptor and ERK1/2 signaling. J Mol Med 37: 63-73. [ Links ]

LIANG Y, WEN L, SHANG F, WU J, SUI K and DING Y. 2016. Endothelial progenitors enhanced the osteogenic capacities of mesenchymal stem cells in vitro and in a rat alveolar bone defect model. Arch Oral Biol 21: 123-130. [ Links ]

LING L, NURCOMBE V and COOL SM. 2009. Wnt signaling controls the fate of mesenehymal stem cells. Gene 433: 1-7. [ Links ]

LIU S, JIN D, WU JQ, XU ZY, FU S, MEI G, ZOU ZL and MA SH. 2016. Neuropeptide Y stimulates osteoblastic differentiation and VEGF expression of bone marrow mesenchymal stem cells related to canonical Wnt signaling activating in vitro. Neuropeptides 5: 105-113. [ Links ]

LIU W, LIU Y, GUO T, HU C, LUO H, ZHANG L, SHI S, CAI T, DING Y and JIN Y. 2013. TCF3, a novel positive regulator of osteogenesis, plays a crucial role in miR-17 modulating the diverse effect of canonical Wnt signaling in different microenvironments. Cell Death Dis 4: e539. [ Links ]

LONG H, SUN B, CHENG L, ZHAO S, ZHU Y, ZHAO R and ZHU J. 2017. miR-139-5p Represses BMSC Osteogenesis via Targeting Wnt/β-Catenin Signaling Pathway. DNA Cell Biol 36: 715-724. [ Links ]

MA ZG et al. 2016. Human urokinase-type plasminogen activator gene-modified bone marrow-derived mesenchymal stem cells attenuate liver fibrosis in rats by down-regulating the Wnt signaling pathway. World J Gastroenterol 22: 2092-2103. [ Links ]

MARONI P, BRINI AT, ARRIGONI E, DE GIROLAMO L, NIADA S, MATTEUCCI E, BENDINELLI P and DESIDERIO MA. 2012. Chemical and genetic blockade of HDACs enhances osteogenic differentiation of human adipose tissue-derived stem cells by oppositely affecting osteogenic and adipogenic transcription factors. Biochem Biophys Res Commun 428: 271-277. [ Links ]

MEIJER L et al. 2003. GSK-3-selective inhibitors derived from Tyrian purple indirubins. Chem Biol 10: 1255-1266. [ Links ]

MORVAN F, BOULUKOS K, CLÉMENT-LACROIX P, ROMAN ROMAN S, SUC-ROYER I, VAYSSIÈRE B, AMMANN P, MARTIN P, PINHO S and POGNONEC P. 2006. Deletion of a single allele of the Dkk1 gene leads to an increase in bone formation and bone mass. J Bone Miner Res 21: 934-945. [ Links ]

MÜLLER-DEUBERT S, SEEFRIED L, KRUG M, JAKOB F and EBERT R. 2017. Epidermal growth factor as a mechanosensitizer in human bone marrow stromal cells. Stem Cell Res 24: 69-76. [ Links ]

OKAZAKI K and SANDELL LJ. 2004. Extracellular matrix gene regulation. Clin Orthop Relat Res 427: S123-S128. [ Links ]

OWEN TA, ARONOW M, SHALHOUB V, BARONE LM, WILMING L, TASSINARI MS, KENNEDY MB, POCKWINSE S, LIAN JB and STEIN GS. 1990. Progressive development of the rat osteoblast phenotype in vitro: reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J Cell Physiol 143: 420-430. [ Links ]

ÖZDAL-KURT F, TUĞLU I, VATANSEVER HS, TONG S, ŞEN BH and DELILOĞĞLU-GÜRHAN SI. 2016. The effect of different implant biomaterials on the behavior of canine bone marrow stromal cells during their differentiation into osteoblasts. Biotech Histochem 91: 411-422. [ Links ]

PARK SJ, JUNG SH, JOGESWAR G, RYOO HM, YOOK JI, CHOI HS, RHEE Y, KIM CH and LIM SK. 2010. The transcription factor snail regulates osteogenic differentiation by repressing Runx2 expression. Bone 46: 1498-1507. [ Links ]

PHAM L, BEYER K, JENSEN ED, RODRIGUEZ JS, DAVYDOVA J, YAMAMOTO M, PETRYK A, GOPALAKRISHNAN R and MANSKY KC. 2011. Bone morphogenetic protein 2 signaling in osteoclasts is negatively regulated by the BMP antagonist, twisted gastrulation. J Cell Biochem 112: 793-803. [ Links ]

QIAN C, ZHU C, YU W, JIANG X and ZHANG F. 2015. High-Fat Diet/Low-Dose Streptozotocin-Induced Type 2 Diabetes in Rats Impacts Osteogenesis and Wnt Signaling in Bone Marrow Stromal Cells. PLoS ONE 10: e0136390. [ Links ]

ROBINSON JA et al. 2006. Yaworsky Wnt/ Catenin Signaling Is a Normal Physiological. Response to Mechanical Loading in Bone. J Biol Chem 281: 31720-31728. [ Links ]

SATO N, MEIJER L, SKALTSOUNIS L, GREENGARD P and BRIVANLOU AH. 2004. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of wnt signaling by a pharmacological gsk-3-specific inhibitor. Nat Med 10: 55-63. [ Links ]

SCHWARTZ RE, REYES M, KOODIE L, JIANG Y, BLACKSTAD M, LUND T, LENVIK T, JOHNSON S, HU WS and VERFAILLIE CM. 2002. Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte-like cells. J Clin Invest 109: 1291-1302. [ Links ]

SU X, LIAO L, SHUAI Y, JING H, LIU S, ZHOU H, LIU Y and JIN Y. 2015. MiR-26a functions oppositely in osteogenic differentiation of BMSCs and ADSCs depending on distinct activation and roles of Wnt and BMP signaling pathway. Cell Death Dis 6: e1851. [ Links ]

SUN XJ, XIA LG, CHOU LL, ZHONG W, ZHANG XL, WANG SY, ZHAO J, JIANG XQ and ZHANG ZY. 2010. Maxillary sinus floor elevation using a tissue engineered bone complex with BMP-2 gene modified bMSCs and a novel porous ceramic scaffold in rabbits. Arch Oral Biol 55: 195-202. [ Links ]

TANG Z, WEI J, YU Y, ZHANG J, LIU L, TANG W, LONG J, ZHENG X and JING W. 2016. γ-Secretase inhibitor reverts the Notch signaling attenuation of osteogenic differentiation in aged bone marrow mesenchymal stem cells. Cell Biol Int 40: 439-447. [ Links ]

TEN DIJKE P, KRAUSE C, DE GORTER DJ, LOWIK CW and VAN BEZOOIJEN RL. 2008. Osteocyte-derived sclerostin inhibits bone formation: its role in bone morphogenetic protein and Wnt signaling. J Bone Joint Surg 90: 31-35. [ Links ]

TULI R, TULI S, NANDI S, WANG ML, ALEXANDER PG, HALEEM-SMITH H, HOZACK WJ, MANNER PA, DANIELSON KG and TUAN RS. 2003. Characterization of multipotential mesenchymal progenitor cells derived from human trabecular bone. Stem Cells 21: 681-693. [ Links ]

ZHANG X, BENDECK MP, SIMMONS CA and SANTERRE JP. 2017. Deriving vascular smooth muscle cells from mesenchymal stromal cells: Evolving differentiation strategies and current understanding of their mechanisms. Biomaterials 145: 9-22. [ Links ]

ZHAO Y, WANG X, DONG P, XU Q, MA Z, MU Q, SUN X, JIANG Z and WANG X. 2016. Bone marrow derived mesenchymal stem cells alleviated brain injury via down-regulation of interleukin-1β in focal cerebral ischemic rats. Am J Transl Res 8: 1541-1550. [ Links ]

ZHOU R, YUAN Z, LIU J and LIU J. 2016. Calcitonin gene-related peptide promotes the expression of osteoblastic genes and activates the WNT signal transduction pathway in bone marrow stromal stem cells. Mol Med Rep 13: 4689-4696. [ Links ]

ZHU C, ZHENG XF, YANG YH, LI B, WANG YR, JIANG SD and JIANG LS. 2016. LGR4 acts as a key receptor for R-spondin 2 to promote osteogenesis through Wnt signaling pathway. Cell Signal 28: 989-1000. [ Links ]

Received: May 14, 2018; Accepted: July 9, 2018

Correspondence to: Baohua Ma E-mail: malab@nwsuaf.edu.cn ORCid: https://orcid.org/0000-0002-8332-4275

AUTHOR CONTRIBUTIONS

All authors contributed equally to this work. Baohua Ma designed the study, Xiao-e Zhao and Zhenshan Yang performed the experiments and prepared the manuscript. Zhen Gao and Junbang Ge quantified gene expression, Qiang Wei collected and analyzed data. All authors discussed the results and implications and commented on the manuscript at all stages.

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License