Second capture of Promops centralis (Chiroptera) in French Guiana after 28 years of mist-netting and description of its echolocation and distress calls

Segunda captura de Promops centralis (Chiroptera) en la Guayana Francesa después de 28 años de muestreos con redes y descripción de su ecolocalización y sus llamadas de alarma

Jérémy S.P. FROIDEVAUX Charlotte ROEMER Clément LEMARCHAND Joan MARTÍ-CARRERAS Piet MAES Vincent RUFRAY Quentin URIOT Sylvain URIOT Adrià LÓPEZ-BAUCELLS About the authors

ABSTRACT

The Amazonian basin harbours some of the most bat-diverse ecosystems worldwide. Yet, information on elusive, high-flying bat species such as Molossidae is scarce or virtually missing in the literature, which hampers conservation efforts both locally and globally. The recent advent of new technologies specifically designed to survey bats, such as passive ultrasound detectors and acoustic lures, has significantly increased understanding of bat ecology and distribution, and has allowed researchers to gather new and valuable information which was impossible to collect in the past. We undertook a rapid bat diversity assessment in French Guiana using acoustic lures to aid in capturing high-flying insectivorous bat species. Here we report the second and third capture record of Promops centralis (Chiroptera, Molossidae) for French Guiana, captured after 28 years since the first and only captures so far in the county. One individual was a post-lactating female and represents the first record of breeding P. centralis in French Guiana. We provide (i) morphometric and acoustic data (including the species’ distress calls) as well as detail photography to aid in species identification; and (ii) COI and CytB sequences of the two individuals (first mitochondrial sequences for French Guiana).

Keywords:
Amazon; bats; bioacoustics; Molossidae; mitochondrial sequences

RESUMEN

La cuenca amazónica alberga algunos de los ecosistemas más diversos en fauna quiropterológica del mundo. Sin embargo, en la literatura científica no encontramos información muy detallada sobre especies de murciélago esquivas como las de la família Molossidae. Esta carencia condiciona y obstaculiza los esfuerzos de conservación tanto a escala local como global. El desarrollo reciente de nuevas tecnologías diseñadas específicamente para muestrear quirópteros, como los detectores de ultrasonidos pasivos o los reclamos acústicos mediante el uso de llamadas de alta frecuencia, ha incrementado nuestro conocimiento sobre su ecología y distribución. Además, ha permitido a los investigadores obtener nuevos datos que eran prácticamente imposibles de conseguir en el pasado. Llevamos a cabo una evaluación rápida de diversidad quiropterológica en la Guayana Francesa, utilizando reclamos acústicos con el objetivo de capturar especies insectívoras de vuelo alto. En este estudio, aportamos la segunda y tercera captura de Promops centralis (Chiroptera, Molossidae) para Guayana Francesa después de 28 años desde sus primeras y únicas capturas hasta ahora. Uno de los indivíduos capturados fue una hembra poslactante, el primer registro de reproducción de la especie. Aportamos (i) datos morfométricos, bioacústicos (incluyendo las llamadas de alarma típicas de la especie) y fotografías de detalles para facilitar su identificación; y (ii) las secuencias de COI y CytB de los dos individuos (las primeras secuencias mitocondriales para la Guayana Francesa).

Palabras clave:
Amazonas; bioacústica; murciélagos; Molossidae; secuencias mitocondriales

INTRODUCTION

Harbouring a rich diversity of habitats, including the tropical Amazonian forest, French Guiana represents a hotspot of bat diversity. Currently, 106 bat species from nine families are listed in this county (Catzeflis et al. 2013Catzeflis, F.; Dewynter, M.; Pineau, K. 2013. Liste taxonomique commentée des chiroptères de Guyane. Le Rhinolophe, 19: 89-102.; Moratelli et al. 2015Moratelli, R.; Dewynter, M.; Delaval, M.; Catzeflis, F.; Ruedi, M. 2015. First record of Myotis albescens (Chiroptera, Vespertilionidae) in French Guiana. Biodiversity Data Journal, 3: e5314.; Rufray 2015Rufray, V. 2015. First records of Molossops neglectus and Promops nasutus (Molossidae) in French Guiana. Le Vespère, 5: 349-356.). The advent of new techniques for surveying bats such as the use of bioacoustics is currently pushing forward our understanding of bat ecology and distribution (Britzke et al. 2013Britzke, E.R.; Gillam, E.H.; Murray, K.L. 2013. Current state of understanding of ultrasonic detectors for the study of bat ecology. Acta Theriologica, 58: 109-117.; Gibb et al. 2019Gibb, R.; Browning, E.; Glover-Kapfer, P.; Jones, K.E. 2019. Emerging opportunities and challenges for passive acoustics in ecological assessment and monitoring. Methods in Ecology and Evolution 10: 169-185.), allowing the discovery of new species and opening ecological research questions and fields that were entirely inaccessible in the past.

The most common survey technique in bat studies used in the tropics is the ground mist-netting, followed by canopy netting, and direct roost search (MacSwiney et al. 2008MacSwiney, G.C.; Clarke, F.M.; Racey, P.A. 2008. What you see is not what you get: the role of ultrasonic detectors in increasing inventory completeness in Neotropical bat assemblages. Journal of Applied Ecology, 45: 1364-1371.). Nevertheless, the use of acoustic studies is increasing in the Neotropics (Barataud et al. 2013Barataud, M.; Giosa, S.; Leblanc, F.; Rufray, V.; Disca, T.; Tillon, L.; Delaval, M.; Haquart, A.; Dewynter, M. 2013. Identification et écologie acoustique des chiroptères de Guyane française. Le Rhinolophe, 19: 103-145.) due to the technological advances in new affordable detectors and automatic classifiers (Hill et al. 2019Hill, A.P.; Prince, P.; Snaddon, J.L.; Doncaster, C.P.; Rogers, A. 2019. AudioMoth: A low-cost acoustic device for monitoring biodiversity and the environment. HardwareX, 6: e00073.). While mist-netting has been proved to be highly efficient for phyllostomid bats, bioacoustics seem to be more appropriate for aerial insectivorous bats such as molossids or emballonurids (MacSwiney et al. 2008). More recently, the development of ultrasonic acoustic lures to attract bats to the mist-nets has gained momentum amongst bat researchers and naturalists (Quackenbush et al. 2016Quackenbush, H.; D’Acunto, L.E.; Flaherty, E.A.; Zollner, P.A. 2016. Testing the efficacy of an acoustic lure on bat mist-netting success in North American central hardwood forests. Journal of Mammalogy, 97: 1617-1622.; Samoray et al. 2019Samoray, S.T.; Gumbert, M.W.; Roby, P.L.; Janos, G.A.; Borthwick, R.R. 2019. Effectiveness of acoustic lures for increasing indiana bat captures in mist-nets. Journal of Fish and Wildlife Management, 10: 206-212.), especially for targeting elusive insectivorous species. Although their effectiveness has been proven in different contexts and for several species (Hill and Greenaway 2005Hill, D.A.; Greenaway, F. 2005. Effectiveness of an acoustic lure for surveying bats in British woodlands. Mammal Review, 35: 116-122.; Lintott et al. 2013Lintott, P.R.; Fuentes-Montemayor, E.; Goulson, D.; Park, K.J. 2013. Testing the effectiveness of surveying techniques in determining bat community composition within woodland. Wildlife Research, 40: 675-684.; Quackenbush et al. 2016), acoustic lures have been rarely used in the tropics (Chaverri et al. 2018Chaverri, G.; Ancillotto, L.; Russo, D. 2018. Social communication in bats. Biological Reviews, 93: 1938-1954.).

Amongst all bat families that occur in the Neotropics, Molossidae is one of the least known, probably due to the difficulty of capturing molossids using traditional sampling methods (Kalko et al. 2008Kalko, E.K.V.; Estrada Villegas, S.; Schmidt, M.; Wegmann, M.; Meyer, C.F. 2008. Flying high - assessing the use of the aerosphere by bats. Integrative and Comparative Biology, 48: 60-73.). These species roost in relatively inaccessible crevices or cavities and forage at high altitudes above forest canopies, in open areas and over aquatic habitats, where mist-netting is either impossible or inefficient (López-Baucells et al. 2018López-Baucells, A.; Rocha, R.; Da Cunha Tavares, V.; Martins Moras, L.; Silva, S.E.; Bobrowiec, P.E.D.; Meyer, C.F.J. 2018. Molecular, morphological and acoustic identification of Eumops maurus and Eumops hansae (Chiroptera: Molossidae) with new reports from Central Amazonia . Tropical Zoology, 31: 1-20.; Torrent et al. 2018Torrent, L.; López-Baucells, A.; Rocha, R.; Bobrowiec, P.E.D.; Meyer, C.F.J. 2018. The importance of lakes for bat conservation in Amazonian rainforests: an assessment using autonomous recorders. Remote Sensing in Ecology and Conservation, 4: 339-351. ). As a result, natural history data for these species are generally scarce or virtually missing in the literature. Among molossids, the big crested mastiff bat, Promops centralis is one of the most elusive and less studied species (Hintze et al. 2019Hintze, F.; Arias-Aguilar, A.; Dias-Silva, L.; Delgado-Jaramillo, M.; Silva, C.R.; Jucá, T.; et al. 2019. Molossid unlimited: extraordinary extension of range and unusual vocalization patterns of the bat, Promops centralis. Journal of Mammalogy, 101: 417-432.). As many other molossids, P. centralis seems to be a habitat-opportunist, having been reported in a wide range of environments such as forests, wetlands, deserts, and urban areas (Gregorin and Taddei 2000Gregorin, R.; Taddei, V. 2000. New records of Molossus and Promops from Brazil (Chiroptera: Molossidae). Mammalia, 64: 471-476.; Lim and Engstrom 2001Lim, B.; Engstrom, M. 2001. Species diversity of bats (Mammalia: Chiroptera) in Iwokrama Forest, Guyana, and the Guianan subregion: implications for conservation. Biodiversity and Conservation, 10: 613-657.; Jung and Kalko 2010Jung, K.; Kalko, E.K.V. 2010. Where forest meets urbanization: foraging plasticity of aerial insectivorous bats in an anthropogenically altered environment. Journal of Mammalogy, 91: 144-153., 2011Jung, K.; Kalko, E.K.V. 2011. Adaptability and vulnerability of high flying Neotropical aerial insectivorous bats to urbanization. Diversity and Distributions, 17: 262-274. ; Fischer et al. 2015Fischer, E.; Santos, C.F.; Carvalho, L.F.AdC.; Camargo, G.; Cunha, N.Ld.; Silveira, M.; Bordignon, M.O.; Silva, CdL. 2015. Bat fauna of Mato Grosso do Sul, southwestern Brazil. Biota Neotropica, 15: 1-17. ; González-Terrazas et al. 2016González-Terrazas, T.P.; Víquez, L.R.; Ibarra-Macías, A.; Ruíz, A.T.; Torres-Knoop, L.; Jung, K.; Tschapka, M.; Medellín, R.A. 2016. New records and range extension of Promops centralis (Chiroptera: Molossidae). Revista Mexicana de Biodiversidad, 87: 1407-1411.; Hintze et al. 2019). In terms of echolocation, P. centralis is easily recognizable, with alternate concave-convex pairs of pulses produced at ~30 and ~35 kHz, respectively (López-Baucells et al. 2016; Arias-Aguilar et al. 2018Arias-Aguilar, A.; Hintze, F.; Aguiar, L.M.S.; Rufray, V.; Bernard, E.; Pereira, M.J.R. 2018. Who’s calling? Acoustic idetification of Brazilian bats. Mammal Research, 63: 231-253.).

We undertook a rapid bat diversity assessment in French Guiana using mist nets and acoustic lures, with the main aim of improving the natural history understanding of molossid bats. Here we report the second and third capture records of P. centralis for French Guiana, captured after 28 years since the first and only captures in the county so far by Simmons and Voss (1998Simmons, N.B.; Voss, R.S. 1998. The mammals of Paracou, French Guiana: A Neotropical lowland rainforest fauna. Part 1. Bats. Bulletin of the American Museum of Natural History, 237: 1-219.). We present data on the morphology, echolocation (including distress calls), and mitochondrial cytochrome oxidase I (COI) and cytochrome b (CytB) gene sequences of P. centralis from French Guiana.

MATERIAL AND METHODS

Sampling design

We performed a total of 14 consecutive nights of bat trapping with mist nets between the 8 and 21 November 2019 at 14 sites (Figure 1; see details in the Supplementary Material, Table S1). At each site, we installed between two and five nets of 12 m length and 2.5 m height (Ecotone, Gdynia, Poland), and trapping took place from sunset for four hours. Each survey night, three mist nets were equipped with an acoustic lure (Bat Lure, Apodemus, Wageningen, The Netherlands) broadcasting social and distress calls (see Chaverri et al. 2018Chaverri, G.; Ancillotto, L.; Russo, D. 2018. Social communication in bats. Biological Reviews, 93: 1938-1954.) of bats from four different families: Phyllostomidae, Vespertillionidae, Molossidae and Emballonuridae.

Figure 1
Locations records of Promops centralis in French Guiana (acoustic records and capture sites, including the two new capture locations reported in here). Sampling sites where the species has not been recorded in our study are also shown. Locations of previously known acoustic records have been retrieved from Faune Guyane (www.faune-guyane.fr). Blue lines represent the main river systems. © Layers: Institut National de l’Information Géographique et Forestière 2017. This figure is in color in the electronic version.

Morphological, acoustic and genetic analyses

Mist nets were checked every 20 min, and bats were removed from the nets as soon as possible. Species were identified using identification keys from López-Baucells et al. (2016López-Baucells, A.; Rocha, R.; Bobrowiec, P.E.D.; Bernard, E.; Palmeirim, J.M.; Meyer, C.F.J. 2016. Field Guide to Amazonian Bats. Editora INPA, Manaus, 173p.) and Charles-Dominique et al. (2001Charles-Dominique, P.; Brosset, A.; Jouard, S. 2001. Les chauve-souris de Guyane. Muséum National d’Histoire Naturelle, Paris, 176p.). Information on sex, age (juvenile or adult), reproductive status (not reproductively active, reproductively active, lactating female, or pregnant female), body mass, and forearm length were taken for all captured individuals. Sex and reproductive status were assessed by inspecting genitalia, while age was determined by trans-retro-illuminating wing joints (Anthony 1988Anthony, E.L.P. 1988. Age determination in bats. In: Kunz, T.H. (Ed.). Ecological and Behavorial Methods for the Study of Bats, 2nd ed. The John Hopkins University Press, Baltimore, p. 47-58. ). Bat capture and handling were conducted following guidelines approved by the American Society of Mammalogists (Sikes and Gannon 2011Sikes, R.S.; Gannon, W.L. 2011. Guidelines of the American Society of Mammalogists for the use of wild mammals in research. Journal of Mammalogy 92: 235-253.). To confirm species identification of individuals with ambiguous morphological criteria, one to two wing punches were taken per individual and were subsequently processed and analysed to obtain mitochondrial genetic classification (hereafter referred as DNA barcoding). When the acoustic repertoire of a species was poorly described in the literature, we recorded echolocation calls while releasing individuals, either during the night if the acoustic activity of free-flying bats was very low, or at sunrise of the same night to avoid the simultaneous presence of other individuals. Different ultrasound microphones were used for the recordings: M500-384 (Pettersson, Uppsala, Sweden) and Echo Meter Touch Pro (Wildlife Acoustics, Maynard, USA). Releases were performed in open environments (forest clearings or wide roads). We also recorded distress calls when an individual was handled. Lactating females were always released at night.

Echolocation and distress calls of the two P. centralis individuals captured were analysed using Kaleidoscope (Wildlife Acoustics, USA) with a 512-Hanning FFT window. For each individual, we measured the frequency of maximum energy of ten good-quality echolocation calls. The first series of pulses recorded during the release were discarded as they were not truly representative calls. Distress calls were only recorded from the male while handled. Measurements such as call duration and frequency of maximum energy of harmonics were conducted on 19 good-quality calls.

Genetic analyses were conducted at the Department of Microbiology and Immunology at KU Leuven (Leuven, Belgium). Mitochondrial DNA from both individuals was extracted from muscular tissue (wing punches) using total nucleic acid extraction with RNAeasy mini kit (Cat No. 74104, Qiagen, USA), following specification from the manufacturer. Both COI and CytB sequences were amplified using One-Step RT-PCR kit (Cat No. 210210, Qiagen, Germany), following specifications from the manufacturer. Primers Molcit-F AATGACATGAAAAATCACCGTTGT and MVZ-16 AAATAGGAARTATCAYTCTGGTTTRAT were used to amplify CytB (Ibáñez et al. 2006Ibáñez, C.; Garcia-Mudarra, J.L.; Ruedi, M.; Stadelmann, B.; Juste, J. 2006. The Iberian contribution to cryptic diversity in European bats. Acta Chiropterologica, 8: 277-297.) and UTyr 5’-ACCYCTGTCYTTAGATTTACAGTC-3’ and C1L705 5’-ACTTCDGGGTGNCCRAARAATCA-3’ COI (Hassanin et al. 2012Hassanin, A.; Delsuc, F.; Ropiquet, A; Hammer, C.; Jansen van Vuuren, B.; Matthee, C.; et al. 2012. Pattern and timing of diversification of Cetartiodactyla (Mammalia, Laurasiatheria), as revealed by a comprehensive analysis of mitochondrial genomes. Comptes Rendus Biologies, 335: 32-50. ). Thermocycling was conducted as follows: 15 min at 94°C, 30 sec at 94°C, 30 sec at 55 °C, 1 min at 72 °C and 10 min at 72°C. Molecules were amplified for 40 cycles (a cycle corresponding to a repetition of the underlined temperatures and times). Amplicons for both individuals were purified using ExoSAP-IT (Cat No. 78201.1, Thermo Fisher Scientific, USA) and sequenced by Sanger sequencing (Macrogen Europe, Meibergdreef, Amsterdam-Zuidoost). Chromatograms were assembled with UGENE v1.31.0 and manually corrected. Sequences are deposited in GenBank as follows: MT350796 and MT350797 for the female individual and MT350798 and MT350799 for the male indiviudal (CytB and COI, respectivley).

RESULTS

We captured 450 individuals belonging to 40 bat species (overall results of the survey are available in www.faune-guyane.fr), including two individuals of Promops centralis. The identification was primarily based on morphological features, and was subsequently confirmed with acoustic and genetic analyses. The first individual was captured on 8 November at 18:25 in a net placed along a swimming pool located in a private garden of Remire-Montjoly (Figure 1). It was a non-reproductively active male with a forearm length of 51.8 mm, for which no other morphological features were measured. It was released at the same location. We captured the second individual on 21 November around 20:20, 131 km away from the first location, in a net placed over a shallow water body located near a secondary road westward of Iracoubo (Figure 1). This individual was captured in front of a bat lure playing distress and social calls of several molossid species, including distress calls recorded from the first P. centralis we captured. The individual was a post-lactating female and therefore represents the first report of breeding P. centralis in French Guiana (Figure 2). All the external morphological measurements have been included in Table 1.

Table 1
External morphological measurements of the (i) post-lactating female of Promops centralis captured near Iracoubo and (ii) two females captured by Simmons and Voss (1998Simmons, N.B.; Voss, R.S. 1998. The mammals of Paracou, French Guiana: A Neotropical lowland rainforest fauna. Part 1. Bats. Bulletin of the American Museum of Natural History, 237: 1-219.) near Paracou, French Guiana. Values for the two females are the mean (observed range).

Figure 2
External diagnostic morphological traits of the female Promops centralis. A − strong ridge on the nose; B − 4 lower incissors; C − extended fur across the lower part of the wings; D − yellowish tone of the skin around the eyes; E − global aspect of P. centralis. This figure is in color in the electronic version.

Regarding their echolocation, both individuals presented the typical acoustic features ofP. centralis, with alternate concave-convex pairs of modulated pulses. When hand-released, the male and female emitted concave calls with the frequency of maximum energy at 29.2 kHz (range: 27.8-29.8) and 27.4 kHz (26.9-27.8), respectively, and convex calls at 34.3 kHz (33.1-35.2) and 31.7 kHz (31.4-32.2), respectively (Figure 3; available at https://sonotheque.mnhn.fr/sounds/MNHN/SO/2020-192 and https://sonotheque.mnhn.fr/sounds/mnhn/so/2020-174). The most common distress calls of P. centralis consisted of long frequency-modulated calls (mean ± SD: 114.5 ± 52.5 ms; 19 calls), with several harmonics with mean frequency of maximum energy at 15.8 (SD 2.9), 30.7 (SD 5.5), 44.3 (SD 4.4) and 53.6 (SD 6.2) kHz (Figure 3; sample MNHN-SO-2020-193 available at https://sonotheque.mnhn.fr/sounds/MNHN/SO/2020-193). These structures are described by Nagel (2006Nagel, J.J. 2006. Variation in Distress Calls of New World Bats. Master’s thesis, University of Western Ontario, Canada.) as tonal calls, more specifically trills (> 3 frequency modulations, with irregular patterns), and could appear noisy.

Figure 3
Sonograms of A − echolocation calls recorded when the animals were hand released; and B − most common distress calls recorded while the animal was handled. Sonograms were produced using Kaleidoscope (Wildlife Acoustics, USA) with a 512-Hanning FFT window. This figure is in color in the electronic version.

Reconstruction of both COI and CytB sequences of the two individuals from DNA barcoding yielded in two diagnostic sequences of 655 and 784 nucleotides, respectively. All four sequences were analysed with BLAST (Mega-Blast) (Camacho et al. 2009Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. 2009. BLAST+: architecture and applications. BMC Bioinformatics, 10: 421. https://doi.org/10.1186/1471-2105-10-421
https://doi.org/10.1186/1471-2105-10-421...
) using the complete NCBI nucleotide database (accessed on April 2020). All sequences were affiliated to Promops centralis with an average nucleotide identity > 99% (Table 2). Controversially, the COI sequence from the female individual (GenBank accession number MT350797) had Promops davisoni as one of its closest references (GenBank accession number MH185193.1). Detailed inspection of secondary hits of MT350797 against NCBI Blast database showed comparable identities with Promops centralis. However, the CytB sequence from the same individual (GenBank accession number MT350796) was classified as Promops centralis (closest reference as GenBank accession number MG029508.1). Based on similarity results from CytB and COI sequences, it can be assumed that both individuals belong to the Promops centralis, concording with our previous assessment (Table 2).

Table 2
Summary of taxonomy affiliation of both Promops centralis individuals captured in French Guiana, based on genetic barcoding.

DISCUSSION

Using an integrative approach combining morphological, acoustic and genetic data, we confirmed the presence of Promops centralis in French Guiana, adding the second and third capture records for this county after more than 28 years from the first captures of this species (Simmons and Voss 1998Simmons, N.B.; Voss, R.S. 1998. The mammals of Paracou, French Guiana: A Neotropical lowland rainforest fauna. Part 1. Bats. Bulletin of the American Museum of Natural History, 237: 1-219.). We captured one male and one post-lactating female in two sites located 131 km apart and situated > 80 and > 45 km away, respectively, from the site where the first capture of P. centralis was made. Our capture records contribute to improve current knowledge of P. centralis distribution in French Guiana. At a larger scale, our records fall into the potential but poorly known distribution range of P. centralis in South America recently modelled by Hintze et al. (2019Hintze, F.; Arias-Aguilar, A.; Dias-Silva, L.; Delgado-Jaramillo, M.; Silva, C.R.; Jucá, T.; et al. 2019. Molossid unlimited: extraordinary extension of range and unusual vocalization patterns of the bat, Promops centralis. Journal of Mammalogy, 101: 417-432.).

Mist-net surveys have been intensively conducted in French Guiana since the 1990s, especially by Charles-Dominique et al. (2001Charles-Dominique, P.; Brosset, A.; Jouard, S. 2001. Les chauve-souris de Guyane. Muséum National d’Histoire Naturelle, Paris, 176p.) and through numerous research projects (e.g. Thoisy et al. 2014Thoisy, B.D.; Pavan, A.C.; Delaval, M.; Lavergne, A.; Luglia, T.; Pineau, K.; Ruedi, M.; Rufray, V.; Catzeflis, F. 2014. Cryptic diversity in common mustached bats Pteronotus cf. parnellii (Mormoopidae) in French Guiana and Brazilian Amapa. Acta Chiropterologica, 16: 1-13.; Moratelli et al. 2015Moratelli, R.; Dewynter, M.; Delaval, M.; Catzeflis, F.; Ruedi, M. 2015. First record of Myotis albescens (Chiroptera, Vespertilionidae) in French Guiana. Biodiversity Data Journal, 3: e5314.; Catzeflis et al. 2016Catzeflis, F.; Gager, Y.; Ruedi, M.; De Thoisy, B. 2016. The French Guianan endemic Molossus barnesi (Chiroptera: Molossidae) is a junior synonym for M. coibensis. Mammalian Biology, 81: 431-438.; Lavergne et al. 2016Lavergne, A.; Darcissac, E.; Bourhy, H.; Tirera, S.; de Thoisy, B,.; Lacoste, V. 2016. Complete genome sequence of a vampire bat rabies virus from French Guiana. Genome Announcements 4: e00188-16. ; Filippi-Codaccioni et al. 2018Filippi-Codaccioni, O.; Beugin, M.P.; de Vienne, D.M.; Portanier, E.; Fouchet, D.; Kaerle, C.; et al. 2018. Coexistence of two sympatric cryptic bat species in French Guiana: insights from genetic, acoustic and ecological data. Bmc Evolutionary Biology, 18: 175. https://doi.org/10.1186/s12862-018-1289-8
https://doi.org/10.1186/s12862-018-1289-...
). Yet it was only from 2011, with the advent of bioacoustics, that P. centralis was registered again using bat detectors (e.g. Barataud et al. 2013Barataud, M.; Giosa, S.; Leblanc, F.; Rufray, V.; Disca, T.; Tillon, L.; Delaval, M.; Haquart, A.; Dewynter, M. 2013. Identification et écologie acoustique des chiroptères de Guyane française. Le Rhinolophe, 19: 103-145.). The 25 acoustic records so far suggest thatP. centralisis well distributed in French Guiana (Figure 1; www.faune-guyane.fr) and present in many habitats, from tropical rainforest to marshes and lowland wetlands. Nevertheless, despite the relatively high capture effort and, more recently, the use of new capture techniques (e.g. canopy nets) the enigmatic and poorly studied P. centralis has remained uncaught in French Guiana for nearly three decades.

Our results are of great interest considering the rarity of the mentions of this species in French Guiana and the difficulties of capturing high-flying foragers. It is likely, albeit not evidence-based, that the second P. centralis was attracted to the net due to the distress calls of the first individual, that were broadcasted by the acoustic lure. We provide the first recordings of distress calls for this species and make them available on open access, so other researchers can use them in the field. Comprehensive bat call libraries are essential to improve bat sampling efficacy and will probably drive the future of both acoustic and mist-netting bat surveys worldwide (Waters and Gannon 2004Waters, D.A.; Gannon, W.L. 2004. Bat call libraries: management and potential use. In: Brigham, R.M.; Kalko, E.; Jones, G.; Parsons, S.; Limpens, H.J.G.A. (Ed.). Bat Echolocation Research: Tools, Techniques, and Analysis. Bat Conservation International, Austin, p.150-157.; López-Baucells et al. 2019López-Baucells, A.; Torrent, L.; Rocha, R.; Bobrowiec, P.E.D.; Palmeirim, J.M.; Meyer, C.F.J. 2019. Stronger together: combining automated classifiers with manual post-validation optimizes the workload vs reliability trade-off of species identification in bat acoustic surveys. Ecological Informatics, 49: 45-53.). Further work is needed to confirm whether distress calls of P. centralis indeed attract conspecifics, as observed in other species (Chaverri et al. 2018Chaverri, G.; Ancillotto, L.; Russo, D. 2018. Social communication in bats. Biological Reviews, 93: 1938-1954.).

Promops centralis may be more common than previously expected in Central and South America (Hintze et al. 2019Hintze, F.; Arias-Aguilar, A.; Dias-Silva, L.; Delgado-Jaramillo, M.; Silva, C.R.; Jucá, T.; et al. 2019. Molossid unlimited: extraordinary extension of range and unusual vocalization patterns of the bat, Promops centralis. Journal of Mammalogy, 101: 417-432.), and several factors can explain the lack of records in the literature. Firstly, this species is difficult to capture using ground-nets due to its foraging behaviour. Optimizing net configuration and location may, however, help in increasing the capture rate (Trevelin et al. 2017Trevelin, L.C.; Novaes, R.L.; Colas-Rosas, P.F.; Benathar, T.C.; Peres, C.A. 2017. Enhancing sampling design in mist-net bat surveys by accounting for sample size optimization. PLoS ONE 12: e0174067.). In this study, the two individuals of P. centralis were captured in nets placed across a shallow water body in open spaces. While high-flying species are adapted to foraging above canopy levels, they descend to drink, and setting mist-nets across water bodies located in open space represents a better option than setting-up nets above the canopy. Besides, few acoustic surveys are conducted in the tropics, especially in the Amazon (MacSwiney et al. 2008MacSwiney, G.C.; Clarke, F.M.; Racey, P.A. 2008. What you see is not what you get: the role of ultrasonic detectors in increasing inventory completeness in Neotropical bat assemblages. Journal of Applied Ecology, 45: 1364-1371.; López-Baucells et al. 2016López-Baucells, A.; Rocha, R.; Bobrowiec, P.E.D.; Bernard, E.; Palmeirim, J.M.; Meyer, C.F.J. 2016. Field Guide to Amazonian Bats. Editora INPA, Manaus, 173p.). More information about the species distribution range could easily be gained by deploying more detectors in suitable habitats. Moreover, it is likely that the species is commonly confused by bat researchers and naturalists with other widespread molossid species that present similar morphology, such as Molossus rufus (Simmons and Voss 1998Simmons, N.B.; Voss, R.S. 1998. The mammals of Paracou, French Guiana: A Neotropical lowland rainforest fauna. Part 1. Bats. Bulletin of the American Museum of Natural History, 237: 1-219.). It is therefore of utmost importance to generate high-quality taxonomic affiliation of unique captures, as was achieved in this study.

CONCLUSIONS

Our reports of P. centralis constitute the most updated information for the species in French Guiana. We present morphological, acoustic, and genetic baseline information that will hopefully optimize the output of future bat research in the Neotropics - including genetic mitochondrial sequences and raw acoustic data - all of them usually scarce in the literature. The lack of genetic and acoustic references still represents an important obstacle that hinders bat research and conservation in the tropics. Further research is needed to understand the potential of acoustic lures to attract and capture elusive, high-flying bat species.

ACKNOWLEDGMENTS

This work was funded by the Direction de l’Environnement, de l’Aménagement et du Logement de la Guyane. We thank Gareth Jones (University of Bristol), the Muséum national d’Histoire naturelle (MNHN), the Natural Science Museum of Granollers, the Ecologistes de l’Euzière, Biotope and the Groupe Chiroptères Languedoc-Roussillon for lending fieldwork material. We also thank Michel Barataud, Adriana Schatton, Robert Ulrich, Katja Nitze, Vanessa Mata, and Francisco Amorim for making social and distress calls of bats available for this research. We are grateful to Audrey Rufray and the Parc Amazonien de Guyane for inviting us and providing essential logistical support, and Arthur Clarke (Office National des Forêts) for additional logistical help. We thank Lia R.V. Gilmour (University of West England) for proofreading the manuscript. The comments of Claudia Keller, Paulo Bobrowiec and two anonymous reviewers greatly helped improving this paper.

REFERENCES

  • Anthony, E.L.P. 1988. Age determination in bats. In: Kunz, T.H. (Ed.). Ecological and Behavorial Methods for the Study of Bats, 2nd ed. The John Hopkins University Press, Baltimore, p. 47-58.
  • Arias-Aguilar, A.; Hintze, F.; Aguiar, L.M.S.; Rufray, V.; Bernard, E.; Pereira, M.J.R. 2018. Who’s calling? Acoustic idetification of Brazilian bats. Mammal Research, 63: 231-253.
  • Barataud, M.; Giosa, S.; Leblanc, F.; Rufray, V.; Disca, T.; Tillon, L.; Delaval, M.; Haquart, A.; Dewynter, M. 2013. Identification et écologie acoustique des chiroptères de Guyane française. Le Rhinolophe, 19: 103-145.
  • Britzke, E.R.; Gillam, E.H.; Murray, K.L. 2013. Current state of understanding of ultrasonic detectors for the study of bat ecology. Acta Theriologica, 58: 109-117.
  • Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. 2009. BLAST+: architecture and applications. BMC Bioinformatics, 10: 421. https://doi.org/10.1186/1471-2105-10-421
    » https://doi.org/10.1186/1471-2105-10-421
  • Catzeflis, F.; Dewynter, M.; Pineau, K. 2013. Liste taxonomique commentée des chiroptères de Guyane. Le Rhinolophe, 19: 89-102.
  • Catzeflis, F.; Gager, Y.; Ruedi, M.; De Thoisy, B. 2016. The French Guianan endemic Molossus barnesi (Chiroptera: Molossidae) is a junior synonym for M. coibensis Mammalian Biology, 81: 431-438.
  • Charles-Dominique, P.; Brosset, A.; Jouard, S. 2001. Les chauve-souris de Guyane Muséum National d’Histoire Naturelle, Paris, 176p.
  • Chaverri, G.; Ancillotto, L.; Russo, D. 2018. Social communication in bats. Biological Reviews, 93: 1938-1954.
  • Filippi-Codaccioni, O.; Beugin, M.P.; de Vienne, D.M.; Portanier, E.; Fouchet, D.; Kaerle, C.; et al 2018. Coexistence of two sympatric cryptic bat species in French Guiana: insights from genetic, acoustic and ecological data. Bmc Evolutionary Biology, 18: 175. https://doi.org/10.1186/s12862-018-1289-8
    » https://doi.org/10.1186/s12862-018-1289-8
  • Fischer, E.; Santos, C.F.; Carvalho, L.F.AdC.; Camargo, G.; Cunha, N.Ld.; Silveira, M.; Bordignon, M.O.; Silva, CdL. 2015. Bat fauna of Mato Grosso do Sul, southwestern Brazil. Biota Neotropica, 15: 1-17.
  • Gibb, R.; Browning, E.; Glover-Kapfer, P.; Jones, K.E. 2019. Emerging opportunities and challenges for passive acoustics in ecological assessment and monitoring. Methods in Ecology and Evolution 10: 169-185.
  • González-Terrazas, T.P.; Víquez, L.R.; Ibarra-Macías, A.; Ruíz, A.T.; Torres-Knoop, L.; Jung, K.; Tschapka, M.; Medellín, R.A. 2016. New records and range extension of Promops centralis (Chiroptera: Molossidae). Revista Mexicana de Biodiversidad, 87: 1407-1411.
  • Gregorin, R.; Taddei, V. 2000. New records of Molossus and Promops from Brazil (Chiroptera: Molossidae). Mammalia, 64: 471-476.
  • Hassanin, A.; Delsuc, F.; Ropiquet, A; Hammer, C.; Jansen van Vuuren, B.; Matthee, C.; et al 2012. Pattern and timing of diversification of Cetartiodactyla (Mammalia, Laurasiatheria), as revealed by a comprehensive analysis of mitochondrial genomes. Comptes Rendus Biologies, 335: 32-50.
  • Hill, A.P.; Prince, P.; Snaddon, J.L.; Doncaster, C.P.; Rogers, A. 2019. AudioMoth: A low-cost acoustic device for monitoring biodiversity and the environment. HardwareX, 6: e00073.
  • Hill, D.A.; Greenaway, F. 2005. Effectiveness of an acoustic lure for surveying bats in British woodlands. Mammal Review, 35: 116-122.
  • Hintze, F.; Arias-Aguilar, A.; Dias-Silva, L.; Delgado-Jaramillo, M.; Silva, C.R.; Jucá, T.; et al 2019. Molossid unlimited: extraordinary extension of range and unusual vocalization patterns of the bat, Promops centralis Journal of Mammalogy, 101: 417-432.
  • Ibáñez, C.; Garcia-Mudarra, J.L.; Ruedi, M.; Stadelmann, B.; Juste, J. 2006. The Iberian contribution to cryptic diversity in European bats. Acta Chiropterologica, 8: 277-297.
  • Jung, K.; Kalko, E.K.V. 2010. Where forest meets urbanization: foraging plasticity of aerial insectivorous bats in an anthropogenically altered environment. Journal of Mammalogy, 91: 144-153.
  • Jung, K.; Kalko, E.K.V. 2011. Adaptability and vulnerability of high flying Neotropical aerial insectivorous bats to urbanization. Diversity and Distributions, 17: 262-274.
  • Kalko, E.K.V.; Estrada Villegas, S.; Schmidt, M.; Wegmann, M.; Meyer, C.F. 2008. Flying high - assessing the use of the aerosphere by bats. Integrative and Comparative Biology, 48: 60-73.
  • Lavergne, A.; Darcissac, E.; Bourhy, H.; Tirera, S.; de Thoisy, B,.; Lacoste, V. 2016. Complete genome sequence of a vampire bat rabies virus from French Guiana. Genome Announcements 4: e00188-16.
  • Lim, B.; Engstrom, M. 2001. Species diversity of bats (Mammalia: Chiroptera) in Iwokrama Forest, Guyana, and the Guianan subregion: implications for conservation. Biodiversity and Conservation, 10: 613-657.
  • Lintott, P.R.; Fuentes-Montemayor, E.; Goulson, D.; Park, K.J. 2013. Testing the effectiveness of surveying techniques in determining bat community composition within woodland. Wildlife Research, 40: 675-684.
  • López-Baucells, A.; Rocha, R.; Bobrowiec, P.E.D.; Bernard, E.; Palmeirim, J.M.; Meyer, C.F.J. 2016. Field Guide to Amazonian Bats Editora INPA, Manaus, 173p.
  • López-Baucells, A.; Rocha, R.; Da Cunha Tavares, V.; Martins Moras, L.; Silva, S.E.; Bobrowiec, P.E.D.; Meyer, C.F.J. 2018. Molecular, morphological and acoustic identification of Eumops maurus and Eumops hansae (Chiroptera: Molossidae) with new reports from Central Amazonia . Tropical Zoology, 31: 1-20.
  • López-Baucells, A.; Torrent, L.; Rocha, R.; Bobrowiec, P.E.D.; Palmeirim, J.M.; Meyer, C.F.J. 2019. Stronger together: combining automated classifiers with manual post-validation optimizes the workload vs reliability trade-off of species identification in bat acoustic surveys. Ecological Informatics, 49: 45-53.
  • MacSwiney, G.C.; Clarke, F.M.; Racey, P.A. 2008. What you see is not what you get: the role of ultrasonic detectors in increasing inventory completeness in Neotropical bat assemblages. Journal of Applied Ecology, 45: 1364-1371.
  • Moratelli, R.; Dewynter, M.; Delaval, M.; Catzeflis, F.; Ruedi, M. 2015. First record of Myotis albescens (Chiroptera, Vespertilionidae) in French Guiana. Biodiversity Data Journal, 3: e5314.
  • Nagel, J.J. 2006. Variation in Distress Calls of New World Bats Master’s thesis, University of Western Ontario, Canada.
  • Quackenbush, H.; D’Acunto, L.E.; Flaherty, E.A.; Zollner, P.A. 2016. Testing the efficacy of an acoustic lure on bat mist-netting success in North American central hardwood forests. Journal of Mammalogy, 97: 1617-1622.
  • Rufray, V. 2015. First records of Molossops neglectus and Promops nasutus (Molossidae) in French Guiana. Le Vespère, 5: 349-356.
  • Samoray, S.T.; Gumbert, M.W.; Roby, P.L.; Janos, G.A.; Borthwick, R.R. 2019. Effectiveness of acoustic lures for increasing indiana bat captures in mist-nets. Journal of Fish and Wildlife Management, 10: 206-212.
  • Sikes, R.S.; Gannon, W.L. 2011. Guidelines of the American Society of Mammalogists for the use of wild mammals in research. Journal of Mammalogy 92: 235-253.
  • Simmons, N.B.; Voss, R.S. 1998. The mammals of Paracou, French Guiana: A Neotropical lowland rainforest fauna. Part 1. Bats. Bulletin of the American Museum of Natural History, 237: 1-219.
  • Thoisy, B.D.; Pavan, A.C.; Delaval, M.; Lavergne, A.; Luglia, T.; Pineau, K.; Ruedi, M.; Rufray, V.; Catzeflis, F. 2014. Cryptic diversity in common mustached bats Pteronotus cf. parnellii (Mormoopidae) in French Guiana and Brazilian Amapa. Acta Chiropterologica, 16: 1-13.
  • Torrent, L.; López-Baucells, A.; Rocha, R.; Bobrowiec, P.E.D.; Meyer, C.F.J. 2018. The importance of lakes for bat conservation in Amazonian rainforests: an assessment using autonomous recorders. Remote Sensing in Ecology and Conservation, 4: 339-351.
  • Trevelin, L.C.; Novaes, R.L.; Colas-Rosas, P.F.; Benathar, T.C.; Peres, C.A. 2017. Enhancing sampling design in mist-net bat surveys by accounting for sample size optimization. PLoS ONE 12: e0174067.
  • Waters, D.A.; Gannon, W.L. 2004. Bat call libraries: management and potential use. In: Brigham, R.M.; Kalko, E.; Jones, G.; Parsons, S.; Limpens, H.J.G.A. (Ed.). Bat Echolocation Research: Tools, Techniques, and Analysis Bat Conservation International, Austin, p.150-157.

SUPPLEMENTARY MATERIAL

(only available in the electronic version)

Froidevaux et al. Second capture of Promops centralis (Chiroptera) in French Guiana after 28 years of mist-netting and description of its echolocation and distress calls

Table S1
Information on the mist net survey for a rapid bat diversity assessment conducted in French Guyana (France) in November 2019. NA = data not available.

Publication Dates

  • Publication in this collection
    27 Nov 2020
  • Date of issue
    Oct-Dec 2020

History

  • Received
    23 Apr 2020
  • Accepted
    01 Aug 2020
Instituto Nacional de Pesquisas da Amazônia Av. André Araujo, 2936 Aleixo, 69060-001 Manaus AM Brasil, Tel.: +55 92 3643-3030, Fax: +55 92 643-3223 - Manaus - AM - Brazil
E-mail: acta@inpa.gov.br